Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

측정 doi: 10.3791/54581 Published: February 22, 2017

Abstract

HIV-1 외피 단백질은 세포질로의 바이러스 캡시드 (CA) 코어의 박리 하였다 바이러스 세포 막 융합을 유도하는 표적 세포의 표면에 동족 수용체 결합. 이어서, 바이러스 성 역전사 효소 (RT)를하는 딴 핵 단백질 복합체의 일부로서 복합 역전사 (RTC)를 이중 - 가닥 DNA 카피 (vDNA)에 바이러스의 단일 가닥 RNA 게놈을 변환 불린다. 이것은 다른 핵 단백질 복합체의 생물 발생에 이르게 상기 vDNA과 관련된 바이러스 단백질, 숙주 인자 이루어지는 사전 통합 복합체 (PIC)를 불린다. PIC는 관련 바이러스 인테그라 제 (IN)은 시간적 및 공간적으로 조절 두 단계에서 호스트 염색체 DNA 내로 vDNA의 통합을 조정한다. 우선, IN은 PIC의 핵 트래 피킹 후에는 염색체 DNA 내로 통합 처리 vDNA을 매개, 둘째, 세포질에서 vDNA의 3 '말단을 처리하고. 찍어 절연그들이 이종 외생 첨가 타겟 DNA에 관련된 vDNA를 통합하는 능력이 급격 같이 HIV-1 감염 표적 세포에서 시험 관내 기능이다. 이러한 PIC 기반 체외 통합 분석에서 크게 레트로 바이러스 통합의 기계적인 세부 사항을 서술 및 억제제 년에 발견에 기여했다. 이보고에서는 절연 기본 찍어 관내 통합 활동을 측정하기위한 중첩 정량적 실시간 중합 효소 연쇄 반응 (qPCR에) 기반 전략을 채택 업데이트 HIV-1 PIC 분석에 상세히.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

초기와 후기 이벤트 : 표적 세포에서 HIV-1 복제는 크게 두 단계로 구분 여러 단계를 포함한다. HIV-1을 순차적으로 표적 세포 표면 수용체 CD4 및 두 개의 공동 수용체 (CCR5 또는 CXCR4 1) 중 하나에 결합 할 때 초기 이벤트는 시작한다. 따라서, 바이러스 세포막 퓨즈 및 바이러스 캡시드는 (CA) 코어는이 세포질로 방출된다. 칼슘 코어는 바이러스와 기원 세포 모두 바이러스 게놈의 단일 가닥 RNA (ssRNA) 및 여러 가지 단백질을 포함하고 있습니다. 칼슘 - 관련 바이러스 성 단백질은 역전사 효소 (RT) 및 인테그라 (IN), 바이러스 복제의 초기 발생시 중요한 단계를 매개이 효소를 포함한다. 역전사 및 핵 단백질 복합체, 즉 역전사 착체 (RTC) 및 사전 통합 복합체 (PIC)는 각각 3, 4, 5의 문맥 함수 IN <SUP> 6. "(말 3에서) (끝 U3 바이러스 ssRNA 게놈 항구 터미널 반복 (R) 5시) '고유 시퀀스 U5에 인접 요소의 끝. RTC는 이중 가닥 (DS) DNA 사본 (vDNA)에 바이러스 ssRNA 게놈 변환합니다. 이 역전사 과정은 따라서 vDNA (7, 8)의 양단의 긴 말단 반복 (LTR)을 생성하는 U5 및 U3 서열의 중복을 초래한다. 이어서, PIC 관련 IN 호스트 염색체 9, 10, 11로 vDNA의 통합을 가능하게 두 개의 연속 생화학 적 반응을 촉매한다. 우선, 세포질, 다량 모두의 LTR (12)와 결합 및 3'- 말단의 각각으로부터 뉴클레오티드를 절단. 이것은 3'- 말단 처리가 각 3'- 단부 vDNA의 (CA OH)에 수산기를 생성한다.IN은 지그재그 방식으로 염색체 DNA의 두 가닥을 절단하는 친핵체로서 vDNA CA를 사용하는 것을 특징이어서, PIC는 핵 트래 피킹. 동시에, IN은 배위 염색체 DNA의 반대쪽 가닥에 생성 된 포스 포디 에스테르 결합에 vDNA의 양 단부를 접합한다. 이 스트랜드 전사 공정 후, 숙주 세포 기계 통합 사이트의 교차점에서 5 '를 vDNA의 단부 및 수리 계속되는 본쇄 갭의 2 개의 비 결합 (unpaired) 뉴클레오타이드를 제거한다. 초기 이벤트는 따라서 HIV-1 게놈의 통합 DNA 사본 (프로 바이러스)의 설립과 함께 절정에 달하다. 프로 바이러스는 바이러스 - 인 코드 된 단백질의 발현을 포함하여 이후의 이벤트를 시작 효율적인 바이러스 유전자 발현에 적합한 환경을 제공하고; 미성숙 바이러스의 조립; 감염성 비리 (13)에 신진, 릴리스 및 성숙.

정제 된 재조합 레트로 바이러스의 IN은에 능력이시험관 내에서, 수행, 모두 3'- 말단 처리 및 가닥 전송 활동에 외생 적 LTR 같은 기판 DNA 제공. 이러한 정제 된 재조합의 IN을 사용하여 생화학 연구 vDNA 통합 14, 15, 16, 17의 중요한 측면을 계시했다. 그러나, 자연 감염과는 달리,이 시험 관내 생화학 적 반응은 표적 DNA에 기판 DNA의 양 단부의 공동의 통합을 지원하지 않는다. 대조적으로, 심하게 감염된 세포로부터 단리 레트로 찍어 concertedly 이종 대상 DNA로 내인성 vDNA의 양단을 통합한다. 이것은 고립 된 원시 사진을 사용하여 널리 채택 및 I n은 체외 통합 (IVI) 분석의 후속 개선되었다.

처음에 레트로 바이러스 IVI 분석, 재조합 쥐에 감염된 세포로부터 세포질 추출물을보고그 LTR의 대장균 supF 유전자 형질 백혈병 바이러스 (MLV)는 IN 활성 소스 및 용균 성장 결함이 외생 대상 DNA로 공급 하였다 돌연변이 람다 파지 DNA 역임. 재조합 MLV DNA의 성공적인 통합은 파지 DNA에 복사하고 supF 다음의 표현은 재조합 파지의 플라크 형성 능력의 복원되었다. 그러나이 실험 전략은 간접적 인 방식으로 힘들고 조치 통합이다. 이러한주의 사항을 해결하기 위하여, 외인성 선형 박테리오 phiX174 DNA에 통합 내인성 vDNA의 척도로서 PIC 관련 IVI 활성을 정량화 서던 블롯 기반 간접 단부 라벨링 분석은, 18 (7), (6)을 개발 하였다. 이 방법은 통합 이벤트의 직접적인 측정을 제공하지만, PIC 제제의 상대적으로 높은 양의 기술적 도전 유지하는 필요노력. 이 문제를 회피하기 위해, PICS는의 적당한 양을 필요로하는 중첩 된 PCR 기반의 분석은, 19 (5), 4 개발되었다.

이 보고서에서 우리는의 업데이트 된 버전을 설명 중첩 된 자연 감염시 발생하는 HIV-1 PIC 매개 통합 활동을 요점을 되풀이하기 위해 고안 체외 방법에서 PCR 기반. 이 방법은 실시간 정량 중합 효소 연쇄 반응 (qPCR에)로 측정 PIC 내인성 활성 소스로서 HIV-1 감염 표적 세포의 세포질 추출물을 사용한다. 자신의 통합 활동을 사진을 분리하고 측정하기위한 절차는 Engelman 실험실 (20)에 의해 출판 프로토콜에서, 수정과, 적응하고 있습니다. 이 방법에서, PIC 관련된 통합 활동 외인성 선형 표적 DNA (21)로부터 생성 된 DNA의 제품을 제공함으로써 개시된다이러한 통합 반응으로 정제 이후 PCR 기반 정량 용 원료로서 사용된다. 제 1 라운드 PCR 통상적으로, 바이러스 표적 DNA 접합은 적절한 프라이머를 사용하여 증폭된다. 두 번째 라운드에서 qPCR에가, LTR 특정 프라이머는 특히 1 라운드 PCR 제품에서 vDNA 인구를 풍부하게하는 데 사용됩니다. 이 방법에 대한 자세한 설명을위한 프로토콜 섹션을 참조하십시오.

레트로 바이러스 찍어와 시험관 연구에서 레트로 바이러스 DNA 통합의 메커니즘에 대한 우리의 이해와 IN 억제제의 개발에 상당한 발전을 주도하고있다. HIV-1 통합 바이러스 및 호스트 요인의 역할을 결정하고, 약물 내성 퇴치를 향해 새로운 항 바이러스 약물을 개발, 매핑 HIV-1 통합 사이트에서 최근 증가 초점을 바탕으로, 우리는 IVI 분석의 증가 된 관심과 광범위한 사용을 직시 이 보고서에 설명 된 것과 같은. 이 차례로 이어질 것상기 방법은 향후 개선함으로써, 그 응용 범위를 다양.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. 바이러스 생산

참고 : 감염성 HIV-1의 높은 역가를 생성 활성화 된 덴드리머 기반의 형질 전환 시약을 사용하여 감염성 HIV-1 분자 복제와 인간 배아 신장 (HEK) 세포주 293T를 형질합니다. 이 인산 칼슘 트랜 스펙 션 방법은 유사한 결과를 얻을 수 있음이 관찰되었다.

  1. 바이오 안전성 레벨 2 (BSL2) 실험실, 종자 8 10cm 접시 당 3 × 10 6 293T 세포 mL의 10 % 태아 소 혈청 (FBS), 페니실린과 스트렙토 마이신이 보충 된 둘 베코의 수정 독수리 중간 (DMEM)의. 문화 37 ° C로 설정 배양기 5 %의 셀 CO 2 O / N.
  2. 다음날, 각 10cm 접시에 세포를 형질 감염에 대한 혈청과 항생제가없는 DMEM 300 μL의 최종 볼륨에 pNL4-3 플라스미드 DNA (참조 자료 표)의 8 μg의 희석. 의 형질 전환 시약 80 μL를 추가 피펫으로 잘 혼합하고 실온에서 부화5 - 형질 전환 복합체 형성을위한 10 분.
  3. 흡인하여 요리에서 배지를 제거하고 혈청과 항생제가 포함 된 신선한 DMEM의 접시 당 7 mL를 넣어.
  4. , 트랜 단지에 DMEM 포함 된 혈청과 항생제 1 mL를 넣고 피펫으로 혼합하고, 세포 혼합물을 추가합니다. 조심스럽게 형질 단지의 균일 한 분포를 용이하게 접시를 소용돌이 친다.
  5. 즉시 48 시간 동안 세포를 CO 2, 37 ℃, 5 %로 설정 인큐베이터에서 BSL3 실험실 배치하는 셀을 전송하고 배양.
  6. 피펫을 이용하여 바이러스 - 함유 조직 배양 상등액을 수집 한 후 원심 분리 튜브로 옮긴다. 5 분 동안 300 × g으로 원심 분리는 세포 파편 펠렛 후, 0.45 ㎛의 공극 크기의 주사기 필터로 상청액을 필터링한다.
  7. 이 무 세포 바이러스 제제의 임의 이월 플라스미드 DNA를 제거하기 위해 1 시간 동안 37 ° C에서 하나의 DNase (20 μg의 / mL)로 처리한다.
  8. 을 정량화하기그것은 일상적인 사용 (22)에 대한 신속하고 의무 방법으로 HIV-1 역가,은 P24 특정 효소 면역 분석 (ELISA)를 사용합니다.
    주 : P24 ELISA 물리적 역가 (바이러스 입자의 수)를 측정된다는 사실을 주목해야한다. 대안으로, 바이러스 관련된 RT 활동 (외인성 RT 분석) 또는 바이러스 감염 (TZM-BL 표시 세포주 계 감염성 분석)를 측정하는 감염성 바이러스 입자를 제외한 판독을 제공한다.

먹어 볼래요-T1 세포의 2. 바이러스 감염 (BSL3 실험실)

  1. BSL2 연구실에서 1 6 10 × 10 × 1.0 6 2.0 세포 / 로즈웰 파크 기념 연구소 (RPMI) 10 % 열 - 불 활성화 FBS, 페니실린 보충 매체 및 스트렙토 마이신의 ㎖ (분할 비율 먹어 볼래요-T1 세포를 유지 : 2 매 2-3 D). 배양 플라스크로부터 섭-T1 세포 풀 피펫 팅하여 잘 혼합하고, 혈구 및 트리 판 블루 배제 성을 이용하여 생존 세포 수를 결정방법을 aining.
    1. 50 mL의 원뿔 원심 분리기 튜브에 (바이러스 감염 당) 80 × 10 6 세포의 분취 필요한 수를 준비합니다.
    2. 500 XG에서 스윙 버킷 로터에서 세포를 원심 분리기, 5 분 동안 25 ° C. 세포 배양 배지를 제거하지 않고, 상기 처리를 위해 BSL3 실험실로 펠렛 세포를 함유하는 튜브에 옮긴다. 조심스럽게 세포 펠렛을 방해하지 않고, 튜브로부터 세포 배양 배지를 흡인.
  2. 관의 세포의 DNase I 처리 된 바이러스 접종 물을 적당량 첨가하고 부드럽게 피펫 팅하여 잘 혼합한다. 80 × 10 6 세포의 경우, DNase의 I-처리 바이러스 (P24-해당하는 바이러스의 50 μg의) 30 ㎖를 사용합니다.
    참고 : 기능 PICS는의 분리는 감염의 매우 높은 다중도 (MOI)와 표적 세포를 감염이 필요합니다.
  3. 균일 즉이 6 잘 조직 배양 플레이트 (12 X 2.5 mL를 씩 사이의 혼합물을 배포, 감염되고 당이 판을 사용이온).
  4. spinoculation를 들어, 스윙 버킷 480 XG에 로터와 2 시간 동안 25 ° C를 사용하여 플레이트 캐리어 원심 분리기의 문화 판을 놓습니다.
  5. 5 시간 동안 CO (2)을 37 ° C에서 spinoculated 세포를 인큐베이션하고, 5 %.

감염된 세포의 3. 수확 및 용해 (BSL3 실험실)

  1. 한 50㎖ 원추형 원심 분리 튜브에 배양 플레이트에서 각각 감염에 대응하는 셀 (~ 총 30 ml)에 풀.
  2. 300 × g으로 원심 분리하여 세포를 수확하고 10 분 동안 25 ° C. 조심스럽게 튜브에서 뜨는을 대기음 (또는, 피펫 사용).
  3. 남아있는 바이러스 입자를 제거하려면 버퍼 K 2 ㎖를 추가하여 각각의 세포 펠렛을 씻어 - / - (150 밀리미터의 KCl, 20 mM의 HEPES, pH가 7.6, 5 밀리미터의 MgCl 2) 300 XG에 샘플 25 ° C에 대한 원심 분리 10 분. 그 후, 펠렛을 방해하지 않고, 조심스럽게 흡인에 의해 또는 피펫을 이용하여 상층 액을 제거합니다.
  4. Repeat 단계 3.3.
  5. 조심스럽게 마이크로 피펫을 사용하여 남아있는 버퍼를 제거합니다. 빙냉 용해 완충액 K 2 ㎖에 각 세포 펠렛을 재현 탁 + / + (버퍼 K - / - 0.025 %의 디기 토닌, 1 mM의 DTT, 20 μg의 / ㎖ 아프로 티닌 보충) 부드러운 피펫 팅하여 내용물을 혼합하고, 편입 2 ML의 microcentrifuge 관.

세포질의 PICS는 4. 준비 (BSL3 실험실)

  1. 실온에서 10 분 동안 회전 진탕 기에서 샘플 락.
  2. 1,500 XG에서, 4 ° C에 예비 냉각 로터와, 샘플을 원심 분리기 4 분 동안 4 ° C.
  3. 펠렛을 방해하지 않고, 신중 16,000 XG에서 새로운 microcentrifuge 관과 원심 분리기에 뜨는을 전송하고 1 분 4 ° C.
  4. 조심스럽게 새로운 microcentrifuge 관에 뜨는을 전송합니다. 30 분 (NO 요동)을 실온에서 20 μg의 내용 / ㎖ (찍어 2ml를 2 μL)의 최종 농도의 RNase A (20 ㎎ / ㎖)를 첨가하고, 배양한다. </ 리>
  5. 7 %의 최종 농도로 부드러운 피펫으로 잘 혼합 (- - / 버퍼 K에 w 60 % / v)의 크로스를 추가합니다. 액체 질소에서 동결 플래시 및 장소에서 -80 장기 보존 C 냉동기 °, 마이크로 원심 튜브에 분취 찍어 (예, 200 μL)를 준비한다.

체외 통합 5. (IVI) 분석 실험은 HIV-1 사진을 사용하여

  1. 주문 제작 프라이머, phiX174-F와 phiX174-R을 사용하여 PCR로 phiX174 플라스미드 DNA에서 2.0 kb의 영역을 증폭하여 IVI 분석에 사용되는 타겟 DNA를 준비합니다.
    1. 표 1에 기재된 바와 같이 PCR 혼합물을 조립한다. 표 2에서 권장 열 사이클링 조건을 사용하여 열 순환기 PCR을 수행한다. (제조사 권장 프로토콜 다음) 겔 정제 키트를 사용하여 PCR 생성물을 겔 - 정제하고, 사용시까지 -80 ℃에서 분취로 정제 된 타겟 DNA를 저장한다.
  2. (200)에 표적 DNA 600 ng의 추가 - & #(181), PICS는의 L 나누어지는이 잘 혼합하고, 45 분 동안 37 ° C에서 품어.
    참고 : 인테그라 제 억제제 (예를 들어, Raltegravir)을 대상 DNA를 생략하거나 포함 IVI 반응은 제어 반응을 권장합니다.
  3. 0.5 %, 8 mm의 각각 0.5 ㎎ / ㎖의 최종 농도로 SDS, EDTA, 및 프로 티나 제 K를 첨가하여 IVI 반응을 멈춘다. 철저하게 반응 내용을 혼합하고 하룻밤에 56 ° C를 품어.
  4. 그 다음날, 페놀 / 클로로포름 추출 및 에탄올 침전에 의해 IVI 반응에서 전체 DNA를 정제. 16,000 XG 및 RT의 모든 원심 분리 단계를 수행하십시오.
  5. 2 분 들어, 탈 단백 시료에 페놀의 동일한 볼륨을 추가 텍싱에 의해 격렬하게 혼합하고, 원심 분리기. 조심스럽게 위 수성 상을 제거하고 새로운 튜브로 전송할 수 있습니다.
  6. 단계를 반복 5.5. 새로운 튜브로 위 수성 위상을 전송합니다.
  7. , 클로로포름 혼합물 텍싱에 의해 격렬하게 혼합하고, 원심 분리 기용 : 1 페놀 : 1의 동일한 볼륨을 추가R 2 분. 새로운 튜브로 위 수성 위상을 전송합니다.
  8. 클로로포름의 동일한 볼륨을 추가 텍싱에 의해 격렬하게 혼합하고, 2 분 동안 원심 분리. 새로운 튜브로 위 수성 위상을 전송합니다.
  9. , DNA를 침전 0.3 M의 최종 농도 0.1 μg의 / μL, 초산 나트륨 3 M의 최종 농도로 글리코겐을 추가하고, 100 % 에탄올 (빙냉) 2.5 볼륨. 소용돌이는 내용을 수집, 원심 분리기 간략하게 혼합하고, -80 ° CO / N에 튜브를 배치합니다.
  10. 다음 날, 16,000 XG에서 30 분 동안 샘플을 원심 분리하고 30 분 동안 4 ° C. 조심스럽게 펠렛을 방해하지 않고 뜨는을 제거합니다.
  11. 16,000 XG에서 펠렛 원심 분리기 80 % 에탄올 (얼음처럼 차가운) 500 μL를 추가하고 10 분 동안 4 ° C. RT에서 DNA 펠렛을 공기 - 건조하고 철저하게 클레아없는 물 50 μL에 재현 탁. -20 ° C에서 DNA 샘플을 저장합니다.

정량화 PIC 활동 6. PCR 분석 실험

  1. 통합 된 HIV-1 DNA의 접합을 증폭 (각각 LTR 및 phiX174 프라이머) 바이러스 LTR과 phiX174 DNA를 대상으로 프라이머를 사용하여 1 라운드 기존의 PCR을 수행합니다.
    1. 표 3에 기재된 바와 같이 1 라운드 PCR 혼합물을 조립한다. 템플릿 DNA를 제외한 모든 구성 요소의 마스터 믹스를 조립, 별도의 PCR 튜브에 45 μL 씩 분배하고, 템플릿 DNA 또는 클레아없는 물 (제어)의 5 μL를 추가합니다.
    2. 표 4에서 권장 열 사이클링 조건을 사용하여 열 순환기 PCR을 수행한다.
  2. 상기 제 1 로로부터 집적 vDNA 서열을 증폭 바이러스 LTR (LTR-R 및 LTR-U 프라이머)의 짧은 영역의 측면에 프라이머를 사용하여 두 번째 라운드 qPCR을 수행싶게 PCR 제품. 통합 vDNA 숫자를 복사 확인하려면 알려진 사본 번호의 10 배 연속 희석을 사용하여 표준 곡선을 생성 (예를 들어, 10 0-10 8) HIV-1 분자 클론의.
    1. 표 5에 기재된 바와 같이 2 라운드 qPCR의 혼합물을 조립한다. 96 웰 PCR 반응 플레이트에 웰의 적절한 수에 25 μL 씩 분배주의, 템플릿 DNA를 제외한 모든 구성 요소의 마스터 믹스를 조립 한 후 정제되지 않은 1 라운드의 PCR 제품이나 클레아없는 물을 5 μL를 추가 (제어). 세중의 모든 qPCR에 반응을 수행합니다.
    2. 실시간 PCR 장비로 PCR 플레이트를 넣고 표 6에 추천 사이클링 조건을 사용하여 qPCR을 수행합니다.
    3. 적합한 소프트웨어를 사용하여 데이터를 분석한다.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

HIV-1 PICS는의 분리

급성 감염 섭-T1 세포에서 HIV-1 찍어 분리에 사용되는 프로토콜의 개략도는도 1에 도시되어있다. 이 프로토콜은 Engelman 등에 의해 기술 된 방법에서 파생됩니다. 19, 20. HIV-1 감염 세포 찍어 조립하고 역전사 vDNA 구성되어 핵 단백질 복합체 바이러스 단백질, 및 세포 인자 (19), (20)이다. 이 보고서에 기술 된 방법은 PIC 관련된 통합 활성 소스로서 HIV-1 감염 세포의 세포질 추출물을 사용한다.

HIV-1 PICS는의 체외 통합 활동

개략도가도 2에 도시되어있다. 이 방법은 PIC 관련 IVI 활성을 측정하기위한 중첩 qPCR에 기반 전략을 이용하고, 절차는 Engelman 실험실 19, 20, 21 일 발행 프로토콜에서 변형으로 구성된다. 이 방법에서, PIC 관련된 통합 활성 이종 선형 표적 DNA (21)를 제공함으로써 개시되고,이 통합 반응으로부터 생성 된 DNA 제품은 정제 및 후속 PCR 기반 정량 용 원료로서 사용된다. 제 1 라운드 PCR 통상적으로, 바이러스 표적 DNA 접합은 적절한 프라이머를 사용하여 증폭된다. 두 번째 라운드에서 qPCR에가, LTR 특정 프라이머는 특히 1 라운드 PCR 제품에서 vDNA 인구를 풍부하게하는 데 사용됩니다. 프로토콜의을 참조하십시오이 방법에 대한 자세한 설명은 ection.

IVI 분석에서 대표 결과는 HIV-1 PICS는이 그림 3에 표시됩니다 사용하여 수행. 한모금-T1 셀 (80 × 106 세포 / 감염)의 DNase 1 처리 된 HIV-1 30 mL로 spinoculated 하였다 (~ P24 당량를 50㎍) (480)의 부재 또는 억제제 Raltegravir IN 1 μM HIV-1의 존재하에 XG 2 시간 동안 25 ° C. 세포는 37 ° C에서 5 시간, 5 % CO 2의 후속 배양 하였다. 프로토콜 절에 설명 된대로 찍어 절연 하였다. IVI 반응은 45 분 동안 37 ℃에서 각각 사용 찍어 200 μL와 타겟 DNA의 600 NG (PCR에 의한 phiX174의 DNA로부터 증폭하여 2kb DNA 단편)을 행 하였다. 반응은 56 ° CO / N에서 SDS 및 EDTA의 존재하에 프로 테이나 제 K 처리에 의해 탈 단백 하였다. 클로로포름 (1 : 1)의 반응 생성물이 일단 페놀, 페놀 회 추출 하였다 혼합하고 일단클로로포름. 이어서, DNA를 에탄올 침전 염과 공동 침전물 글리코겐의 존재는이고, DNA 펠렛을 80 % 에탄올로 한 번 세척 하였다. 정제 된 DNA는 뉴 클레아 제 무 물 50 μL에 재현 탁시켰다. 중첩 qPCR의 전략은 phiX174 DNA에 통합 vDNA의 수를 결정하는 데 사용되었다. 제 1 라운드 종래의 PCR에서, phiX174 타겟 DNA와 바이러스 LTR 영역의 서열에 상보적인 프라이머는 통합 반응 DNA 제품의 5 μL로 통합 바이러스 표적 DNA 접합을 증폭하는데 사용되었다. 두 번째 라운드에서 qPCR에가, LTR-에 걸쳐 프라이머가 독점적으로 1 라운드 앰플 리콘 제품의 5 μL로부터의 HIV-특정 DNA 서열을 증폭하는 데 사용 된 알려진 사본 번호의 연속 희석을 10 배 (10 8 -10 0) 에이즈-1 분자 클론 (표준).

모든 qPCR의 반응을 3 중으로 수행 하였다 데이터 WERE는 상용 소프트웨어를 이용하여 분석 하였다. 기준으로부터 유도 된 값은 통합 vDNA 숫자 보간이 복사되는 표준 곡선을 생성하는 플롯 하였다. 오차 막대는 표준 편차를 나타냅니다. 그림 3에 도시 된 바와 같이, HIV-1 찍어 견고 표적 DNA (레인 5)에 연결된 vDNA 통합. 중요한 것은, 사진을 IVI의 효율을 크게 IN 억제제 Raltegravir (레인 6)으로 보충 반응이 감소 하였다. 이것은 강력한 HIV-1 IN이 분석에서 측정 통합 활동 속성. 또한, 감염되지 않은 세포로부터 세포질 분해물을 포함하는 제어 반응 (레인 1) 단독으로 찍어 (레인 2)는 단독으로 DNA (레인 3)를 대상으로하고, 임의의 적분 활성을 나타내지 않았다 단독 (레인 4) 버퍼. 또한, 첫번째 라운드 PCR의 Taq 중합 효소를 제외한 제어 (레인 7)를 통합 제품을 증폭하지 않았다. 특히, PICS는 형 제어 (레인 2)의 데이터가 표시 그 중첩 된 qPCR에 전략보고 특정으로는 통합 vDNA 아닌 PIC 관련 vDNA을 측정합니다. 종합적으로, 이들 데이터는 PIC 관련된 통합 활동의 측정 값을 보여준다.

그림 1
그림 1 : HIV-1 PICS는의 준비를위한 프로토콜의 도식 표현. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

사진을 포함하는 세포질 추출물은 HIV-1에 감염된 먹어 볼래요-T1 세포로부터 격리됩니다. 이러한 찍어은 통합 시험 관내 분석에서의 통합 활동의 소스로서 사용된다.

그림 2
그림 2 : 시험관의 개략도 m> HIV-1 PICS는 통합 분석. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

통합 분석은 HIV-1 사진과 이종 phiX174 타겟 DNA를 이용하여 시험 관내에서 수행 하였다. 집적 HIV-1 DNA는 1 차 PCR은 종래 vDNA 특정 서열을 우선적으로 2 라운드 qPCR에 증폭되어 이로부터 통합 접합을 증폭하여 상기 중첩 PCR 전략에 의해 측정 하였다.

그림 3
그림 3 : HIV-1 vDNA 통합 활동을 PIC 관련. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

"fo를하기 : 유지-together.within 페이지를 ="1 "> 통합 vDNA가의 10 배 연속 희석을 사용하여 생성 된 표준 곡선에서 파생 된 값을 플롯에 의해 결정되었다 번호를 복사 HIV-1 PIC 관련 통합 활동 분석의 대표 결과. HIV-1 분자 클론의 복사본 공지 번호. 모든 반응은 삼중으로 수행하고, 데이터는 상용 소프트웨어를 이용하여 분석 하였다. 오차 막대는 표준 편차를 나타낸다.

구성 요소 스톡 50 μL 반응에 대한 최종 부피
phiX174 플라스미드 DNA 10 NG / μL 5.0 μL
GoTaq 반응 버퍼 5 배 10.0 μL
염기의 dNTP 믹스 10 mM의 각 1.0 μL
phiX174-F 프라이머 10 μM 2.5 μL
phiX174-R 프라이머 10 μM 2.5 μL
GoTaq DNA 중합 효소 (5 U / μL) 0.25 μL
클레아없는 증류수 - 28.75 μL

1 번 테이블.

= 2 분 95 ° C
사이클 34 반복 :
95 ° C (30)들 =
53 ° C (30)들 =
= 2 분, 72 ° C
72 ℃에서 10 분 =
4 ° C = 보류

표 2.

구성 요소 스톡 50 μL 반응에 대한 최종 부피 IVI 반응 DNA 제품 - 5.0 μL GoTaq 반응 버퍼 5 배 10.0 μL 염기의 dNTP 믹스 10 mM의 각 1.0 μL LTR 프라이머 10 μM 2.5 μL phiX174 프라이머 10 μM 2.5 μL GoTaq DNA 중합 효소 (5 U / μL) 0.25 μL 클레아없는 증류수 - 28.75 μL

표 3.

= 5 분 95 ° C
사이클 23 반복 :
94 ° C (30)들 =
55 ° C (30)들 =
= 4 분 72 ° C
72 ℃에서 10 분 =
4 ° C = 보류

표 4.

<TD>의 TaqMan 프로브
구성 요소 스톡 30 μL 반응에 대한 최종 부피
1 라운드 PCR 제품 - 5.0 μL
LTR-R 프라이머 10 μM 0.9 μL
LTR-U 프라이머 10 μM 0.9 μL
10 μM 0.3 μL
지능 지수 수퍼 믹스 15.0 μL
클레아없는 증류수 - 7.9 μL

표 5.

= 3 분 95 ° C
사이클 39 반복 :
94 ° C (15)들 =
58 ° C (30)들 =
72 ° C (30)들 =
플레이트 읽기

표 6.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

레트로 바이러스 PICS는의 생화학 적 분석은 레트로 바이러스 DNA 통합의 메커니즘에 중요한 통찰력을 제공하고 있습니다. 레트로 바이러스 찍어 통합 활성 측정은 플라크 형성 분석법, 서던 블롯 분석, 및 중첩 qPCR에 의해 달성 될 수있다. 플라크 분석의 실험적 전략은 힘든이고 통합 6, 7, 18를 측정하는 간접 방법을 이용한다. 남부 오점 기반 분석 측정 통합은 직접하지만 PICS는 6, 7, 18의 비교적 높은 금액을 필요로한다.

이 보고서는 시험관 내에서 HIV-1 PIC 관련된 통합 활동을 측정하기위한 중첩 qPCR의 전략 사항. 가장 큰 장점이 방법의 의미는 반응 4 당 PIC 준비의 상대적으로 낮은 양의 요구 사항입니다5, 19. 이 방법의 가장 중요한 단계는 감염에 대한 높은 역가의 바이러스의 생성 및 PIC의 준비 처리이다. PCR의 첫 번째 라운드가 통합 접합부의 지수 적 증폭을 포함하는 것이 주목되어야한다. 따라서, 두 번째 라운드 qPCR에 결정된 통합 vDNA의 카피 수는, 따라서, PIC 관련 vDNA 복사본의 측정치를 제공하지 않는 한 제한 반 정량적이고. DNA가 LTR 특이 적 프라이머로 찍어로부터 정제의 그러나, PIC 관련 vDNA는 qPCR에 의해 결정될 수있다. 통합 vDNA의 비율은 시험 관내 통합 반응 통합 효율성에 대한 정보를 제공 할 수있는 대응 PIC 관련 vDNA에 번호를 복사한다. 이 방법은 두 방향에서의 통합을 검출하기 위해 선택하고, 다른 프라이머의 다른 이종의 타겟 DNA를 도입함으로써 변형 될 수있다. 요약하면, 방법여기에 설명 된 정량적 HIV-1 찍어 통합 활성을 측정하고, 레트로 바이러스 통합 생화학 상세한 이해를 개발 연구를 위해 채택 될 수있다.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

저자는 더 경쟁 재무 및 비재무 이익을 선언합니다.

Acknowledgments

이 작품은 부분적으로 CD에 NIDA / NIH 보조금 DA024558, DA30896, DA033892 및 DA021471에 의해 지원됩니다. 우리는 또한 RCMI 부여 G12MD007586을 인정, 밴더빌트 CTSA는 UL1RR024975을 부여의 Meharry 중개 연구의 중앙에 NCRR / NIH의 NIMHD / NIH에서 U54 그랜트 MD007593, 그리고 테네시 CFAR 보조금 P30의 AI110527에서 (MeTRC) CTSA 부여 U54의 RR026140.

Materials

Name Company Catalog Number Comments

Fetal Bovine Serum (FBS)

GIBCO/Invitrogen

10437-028

Heat-inactivated Fetal Bovine Serum (Hi-FBS)

GIBCO/Invitrogen

10438-026

Dulbecco’s modified Eagle’s medium (DMEM)

GIBCO/Invitrogen

11995-065

Roswell Park Memorial Institute (RPMI) 1640 medium

GIBCO/Invitrogen

11875-093

Phosphate-buffered Saline (PBS) (1x)

GIBCO/Invitrogen

20012-027

Trypsin-EDTA (0.25%)

GIBCO/Invitrogen

25200-056

Penicillin-Streptomycin solution (100x)

Cellgro/Mediatech

30-002-CI

HEK293T cells (293T)

American Type Culture Collection (ATCC)

CRL-3216

HIV-1 proviral molecular clone pNL4-3

NIH AIDS Research and Reference Reagent Program

114

PolyFect transfection reagent

Qiagen

301107

DNase 1

Calbiochem/Merckmillipore

260913

Sup-T1 cells

American Type Culture Collection (ATCC)

CRL-1942

HEPES pH 7.2 - 7.5

(ready-to-use solution)

GIBCO/Invitrogen

15630-080

Potassium chloride (KCl) solution

Sigma-Aldrich

60142

Magnesium chloride (MgCl2) solution

Sigma-Aldrich

M1028

Dithiothreitol (DTT)

Sigma-Aldrich

43815

Aprotinin

Sigma-Aldrich

A6106

Digitonin

Sigma-Aldrich

D141

RNase A

Invitrogen

12091-021

Sucrose

Sigma-Aldrich

S0389

phiX174 Replicative Form 1 DNA

Promega

D1531

PhiX174-F primer:

5’-CGCTTCCATGACGCAGAAGTT-3’

PhiX174-R primer:

5’-CACTGACCCTCAGCAATCTTA-3’

Invitrogen and/or IDT-DNA

dNTP mix

Promega

U1515

Go Taq DNA Polymerase

Promega

M3005

Qiaquick gel extraction kit

Qiagen

28706

Ultrapure distilled water

Invitrogen

10977-015

Tris-EDTA (TE) buffer (100x)

Sigma-Aldrich

T9285

Sodium Dodecyl Sulphate (SDS)

Sigma-Aldrich

L3771

Ethylenediamine tetraacetic acid, disodium salt (EDTA) solution, 0.5 M, pH 8.0

Sigma-Aldrich

E7889

Proteinase K (20 mg/mL ready-to-use solution)

Qiagen

19131

Phenol (equilibrated with 10 mM Tris HCl, pH 8.0 and 1 mM EDTA)

Sigma-Aldrich

P4557

Chloroform

Sigma-Aldrich

288306

Glycogen (5 mg/mL solution)

Ambion/Invitrogen

AM9510

Sodium acetate (3 M, pH 5.2)

Sigma-Aldrich

S7899

Ethanol

Sigma-Aldrich

E7023

First round LTR primer:

5’-GTGCGCGCTTCAGCAAG-3’

First round phiX174 primer:

5’-CACTGACCCTCAGCAATCTTA-3’

Invitrogen and/or IDT-DNA

---

Second round LTR-R primer:

5’-TCTGGCTAACTAGGGAACCCA-3’

Second round LTR-U primer:

5’-CTGACTAAAAGGGTCTGAGG-3’

Second round Taqman probe:

 5’-6- FAM/TTAAGCCTCAATAAAGCTTGC

CTTGAGTGC/6-TAMRA/-3’

Invitrogen and/or IDT-DNA

---

iQ Supermix

Bio-Rad

170-8862

DOWNLOAD MATERIALS LIST

References

  1. Sattentau, Q. J., Weiss, R. A. The CD4 antigen: physiological ligand and HIV receptor. Cell. 52, (5), 631-633 (1988).
  2. Wilen, C. B., Tilton, J. C., Doms, R. W. Molecular mechanisms of HIV entry. Adv Exp Med Biol. 726, 223-242 (2012).
  3. Bowerman, B., Brown, P. O., Bishop, J. M., Varmus, H. E. A nucleoprotein complex mediates the integration of retroviral DNA. Genes Dev. 3, (4), 469-478 (1989).
  4. Bukrinsky, M. I., Sharova, N., Dempsey, M. P., et al. Active nuclear import of human immunodeficiency virus type 1 preintegration complexes. Proc Natl Acad Sci. 9, (14), 6580-6584 (1992).
  5. Hansen, M. S., Smith, G. J. 3rd, Kafri, T., Molteni, V., Siegel, J. S., Bushman, F. D. Integration complexes derived from HIV vectors for rapid assays in vitro. Nature biotechnol. 17, (6), 578-582 (1999).
  6. Farnet, C. M., Haseltine, W. A. Integration of human immunodeficiency virus type 1 DNA in vitro. Proc Natl Acad Sci. 87, (11), 4164-4168 (1990).
  7. Fujiwara, T., Mizuuchi, K. Retroviral DNA integration: structure of an integration intermediate. Cell. 54, (4), 497-504 (1988).
  8. Brown, P. O., Bowerman, B., Varmus, H. E., Bishop, J. M. Correct integration of retroviral DNA in vitro. Cell. 49, (3), 347-356 (1987).
  9. Lewinski, M. K., Bushman, F. D. Retroviral DNA integration--mechanism and consequences. Adv Genet. 55, 147-181 (2005).
  10. Engelman, A., Mizuuchi, K., Craigie, R. HIV-1 DNA integration: mechanism of viral DNA cleavage and DNA strand transfer. Cell. 67, (6), 1211-1221 (1991).
  11. Goff, S. P. Genetics of retroviral integration. Ann rev gen. 26, 527-544 (1992).
  12. Panganiban, A. T., Temin, H. M. The terminal nucleotides of retrovirus DNA are required for integration but not virus production. Nature. 306, (5939), 155-160 (1983).
  13. Bieniasz, P. D. The cell biology of HIV-1 virion genesis. Cell host microbe. 5, (6), 550-558 (2009).
  14. Sherman, P. A., Fyfe, J. A. Human immunodeficiency virus integration protein expressed in Escherichia coli possesses selective DNA cleaving activity. Proc Natl Acad Sci. 87, (13), 5119-5123 (1990).
  15. Katzman, M., Katz, R. A., Skalka, A. M., Leis, J. The avian retroviral integration protein cleaves the terminal sequences of linear viral DNA at the in vivo sites of integration. J Virol. 63, (12), 5319-5327 (1989).
  16. Craigie, R., Mizuuchi, K., Bushman, F. D., Engelman, A. A rapid in vitro assay for HIV DNA integration. Nucl acid res. 19, (10), 2729-2734 (1991).
  17. Bushman, F. D., Craigie, R. Activities of human immunodeficiency virus (HIV) integration protein in vitro: specific cleavage and integration of HIV DNA. Proc Natl Acad Sci. 88, (4), 1339-1343 (1991).
  18. Pauza, C. D. Two bases are deleted from the termini of HIV-1 linear DNA during integrative recombination. Virology. 179, (2), 886-889 (1990).
  19. Engelman, A. Isolation and analysis of HIV-1 preintegration complexes. Meth Mol Biol. 485, 135-149 (2009).
  20. Engelman, A., Oztop, I., Vandegraaff, N., Raghavendra, N. K. Quantitative analysis of HIV-1 preintegration complexes. Methods. 47, (4), 283-290 (2009).
  21. Addai, A. B., Pandhare, J., Paromov, V., Mantri, C. K., Pratap, S., Dash, C. Cocaine modulates HIV-1 integration in primary CD4+ T cells: implications in HIV-1 pathogenesis in drug-abusing patients. J Leuk Biol. 97, (4), 779-790 (2015).
  22. Wehrly, K., Chesebro, B. p24 antigen capture assay for quantification of human immunodeficiency virus using readily available inexpensive reagents. Methods. 12, (4), 288-293 (1997).
측정<em&gt; 체외</em&gt; HIV-1 사전 통합 단지의 통합 활동
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Balasubramaniam, M., Davids, B., Addai, A. B., Pandhare, J., Dash, C. Measurement of In Vitro Integration Activity of HIV-1 Preintegration Complexes. J. Vis. Exp. (120), e54581, doi:10.3791/54581 (2017).More

Balasubramaniam, M., Davids, B., Addai, A. B., Pandhare, J., Dash, C. Measurement of In Vitro Integration Activity of HIV-1 Preintegration Complexes. J. Vis. Exp. (120), e54581, doi:10.3791/54581 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter