Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

måling av doi: 10.3791/54581 Published: February 22, 2017

Abstract

HIV-1 envelope proteinene engasjere beslektede reseptorer på målcellen overflaten, noe som fører til viral-cellemembranfusjon, fulgt av frigjøring av det virale kapsid (CA), kjerne inn i cytoplasma. Deretter viral revers transkriptase (RT), som en del av en navne nukleoprotein kompleks betegnet Reverse Transcription-komplekset (RTC), omdanner viralt enkelt-trådet RNA-genom inn i en dobbeltkjedet DNA-kopi (vDNA). Dette fører til biogenese av en annen nukleoprotein kompleks, betegnet pre-integrasjon kompleks (PIC), sammensatt av vDNA og tilknyttede virusproteiner og vertsfaktorer. PIC-assosierte virale integrase (IN) arrangerer integrering av vDNA inn i vertens kromosomale DNA i et tidsmessig og romlig regulerte to-trinns prosess. Først, behandler i de 3 'endene av vDNA i cytoplasma og for det andre etter at PIC traffics til kjernen, det medierer integrering av den behandlede vDNA inn i det kromosomale DNA. Bildene isolertfra målceller akutt infisert med HIV-1 er funksjonell in vitro, som de er i stand til å integrere den tilhørende vDNA inn i et eksogent tilsatte heterologt mål-DNA. Slike PIC-basert in vitro integrerings analyser har bidratt betydelig til opptegning av mekanistiske detaljer om retroviral integrering og for å oppdage IN-hemmere. I denne rapporten utdype vi på en oppdatert HIV-1 PIC analyse som benytter en nestet sanntid kvantitativ Polymerase Chain Reaction (qPCR) -basert strategi for å måle in vitro integrering aktivitet av isolerte innfødte Pics.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

HIV-1-replikasjon i målcellen involverer flere trinn, grovt gruppert i to faser: tidlige og sene hendelser. De tidlige begivenheter begynne når HIV-1 i rekkefølge bindes til mål-celleoverflatereseptoren CD4 og en av de to co-reseptorer (CCR5 eller CXCR4) 1. Følgelig virus-cellemembraner sikring, og det virale kapsid (CA), kjerne frigjøres i cytoplasmaet 2. CA-kjerne inneholder det virale genomiske enkelt-trådet RNA (ssRNA) og flere proteiner, både virale og cellulær opprinnelse. CA-assosiert virale proteiner inkluderer revers transkriptase (RT) og integrase (IN), to enzymer som formidler viktige skritt i tidlige hendelser i virusreplikasjon. RT og IN funksjon i sammenheng med nukleoprotein komplekser, nemlig revers transkripsjonskompleks (RTC) og pre-integrasjons kompleks (PIC), henholdsvis 3, 4, 5 <sup> 6. Endene av det virale genomet ssRNA havn terminal gjentagelse (R) elementer hosliggende til den unike sekvenser U5 (ved 5'-enden) og U3 (ved 3'-enden). RTC omdanner det virale genomet ssRNA inn i en dobbelt-trådet (ds) DNA-kopi (vDNA). Denne revers transkripsjon prosess resulterer også i duplisering av de U5 og U3-sekvenser, og dermed generere lange terminale gjentagelser (LTR) i begge ender av den vDNA 7, 8. Deretter katalyserer PIC-assosierte IN to sekvensielle biokjemiske reaksjoner som muliggjør integrering av det vDNA i vertskromosomet 9, 10, 11. Først, i cytoplasma, IN multimerer engasjere både LTR 12 og spalte et dinukleotid fra hver av de 3'-terminale ender. Denne 3'-ende behandlingen genererer en hydroksylgruppe ved hver 3'-ende (CA OH) av vDNA.Deretter PIC traffics til kjernen, karakterisert v e d IN benytter vDNA CA OH som en nukleofil for å kutte begge tråder av det kromosomale DNA i en forskjøvet måte. Samtidig IN koordinert skjøter begge ender av vDNA til de resulterende fosfodiesterbindinger på motsatte retninger av det kromosomale DNA. Etter dette strand overføringstrinn, fjerner vertscellen maskiner de to uparede nukleotider på 5 'endene av vDNA og reparasjoner de påfølgende enkelt strandet hull i krysset av integrasjonen nettstedet. De tidlige hendelser dermed kulminere med etablering av et integrert DNA-kopi (provirus) av HIV-1 genomet. Proviruset gir et egnet miljø for effektiv viral genekspresjon, som starter senere begivenheter, inkludert uttrykk for virus-kodet proteiner; Monteringen av umodne virus; og spirende, utgivelsen, og modning i smittsomme viruspartikler 13.

Renset rekombinant retroviral IN er kompetent til ågjennomføre, in vitro, både 3'-ende prosessering og tråd overføring aktiviteter på eksogent tilførte LTR-lignende substrat DNA. Biokjemiske studier med slik renset rekombinant I har avdekket kritiske aspekter ved vDNA integrasjon 14, 15, 16, 17. Imidlertid, i motsetning til i naturlig infeksjon, betyr dette in vitro biokjemisk reaksjon støtter felles integrasjon av begge ender av substratet DNA i mål-DNA. I motsetning til dette retrovirus PICs isolert fra akutt infiserte celler concertedly integrere begge ender av den endogene vDNA inn i heterologe mål-DNA. Dette førte til utbredt bruk og påfølgende avgrensninger av I n Vitro Integration (IVI) analyser ved hjelp av isolerte innfødte Pics.

I det første rapporterte retrovirale assay IVI, cytoplasmiske ekstrakter fra celler infisert med et rekombinant murintLeukemi virus (MLV) skjuler den E. coli supF-genet i sin LTR tjente som kilde for IN-aktivitet, og DNA av en mutant som er defekt i lambda-fage lytisk vekst ble eksogent tilført som det mål-DNA. Vellykket integrering av det rekombinante DNA-MLV kopiere, i den fag-DNA og den påfølgende supF uttrykket førte til gjenopprettelse av den plakk-dannende egenskaper av de rekombinante fager. Imidlertid er denne forsøks strategien arbeidskrevende og tiltak for integrering på en indirekte måte. For å løse slike begrensninger, var en Southern blot-baserte indirekte ende-merking assay, som kvantifiserer PIC-assosiert IVI-aktivitet som et mål på den endogene vDNA integrert i eksogent linearisert bakteriofag phiX174 DNA, utviklet 6, 7, 18. Selv om denne metode gir et direkte mål på integrasjonshendelser, blir forholdsvis store mengder av PIC fremstilling kreves, som fortsatt er en teknisk krevendebestrebelse. For å omgå dette, ble nestet PCR-baserte analyser krever bare beskjedne mengder Pics utviklet 4, 5, 19.

I denne rapporten beskriver vi en oppdatert versjon av en nestet PCR-basert in vitro metode utviklet for å rekapitulere den HIV-1 PIC-mediert integrering aktivitet oppstår under naturlig infeksjon. I denne metoden brukes cytoplasmiske ekstrakter av HIV-1-infiserte målceller som en kilde av endogen PIC-aktivitet, som er målt med en sanntids kvantitativ polymerasekjedereaksjon (qPCR). Prosedyrene for å isolere Pics og måle deres integreringsarbeidet er tilpasset, med modifikasjoner, fra protokoller utgitt av Engelman laboratorium 20. I denne fremgangsmåten blir det PIC-assosierte integrering aktivitet initiert ved å tilveiebringe et eksogent lineært mål-DNA 21, og DNA-produktene som skyldesdenne integrasjonen reaksjonen blir renset og anvendt som utgangsmateriale for påfølgende PCR-baserte kvantifisering. I første runde konvensjonell PCR blir viral-target DNA veikryss forsterket ved hjelp av egnede primere. I andre runde qPCR, er LTR-spesifikke primere som brukes til å spesifikt berike vDNA befolkningen fra første runde PCR produktene. Vennligst se protokollen seksjonen for en detaljert beskrivelse av denne metoden.

In vitro-studier med retrovirale Pics har ført til betydelige fremskritt i vår forståelse av mekanismen for retrovirale DNA integrasjon og i utviklingen av IN-hemmere. Basert på siste økt fokus på kartlegging HIV-1 integrering nettsteder, bestemme rollen som virus og vertsfaktorer i HIV-1 integrasjon og utvikling av nye antivirale medikamenter for å bekjempe narkotika motstand, ser vi for oss en økt interesse for og utbredt bruk av IVI analyser , som den som er beskrevet i denne rapporten. Dette i sin tur vil medførefremtidige forbedringer i metoden, og dermed spre omfanget av sine programmer.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Virus Produksjon

MERK: For å generere høye titer av smittsomme HIV-1, transfektere Human embryonale nyre (HEK) cellelinje 293T med en smittende HIV-1 molekylære klone med en aktivert dendrimer-baserte transfeksjon reagens. Det har blitt observert at kalsiumfosfat transfeksjon metode gir sammenlignbare resultater.

  1. I et biologisk sikkerhetsnivå 2 (BSL2) lab, frø 3 x 10 6 293T celler pr 10 cm plate i 8 ml av Dulbeccos modifiserte Eagle-medium (DMEM) supplert med 10% føtalt bovint serum (FBS), penicillin, streptomycin og. Kultur ble cellene i en inkubator innstilt på 37 ° C og 5% CO 2 O / N.
  2. Den neste dag, for å transfektere celler i hver 10 cm tallerken, fortynne 8 ug pNL4-3 plasmid-DNA (se Materialer tabell) til et endelig volum på 300 ul DMEM mangler serum og antibiotika. Legg 80 pl av transfeksjon reagens, bland godt ved pipettering, og inkuber ved romtemperatur i5 - 10 min for transfeksjon kompleksdannelse.
  3. Fjern mediet fra oppvasken ved aspirasjon og legge 7 ml per fat med fersk DMEM inneholder serum og antibiotika.
  4. Tilsett 1 ml DMEM inneholdende serum og antibiotika til transfeksjon komplekset, blandes ved pipettering, og legge til denne blanding til cellene. Forsiktig virvel parabolen til rette for jevn fordeling av transfeksjonsagensene komplekser.
  5. Umiddelbart overføre cellene til BSL3 lab, sted i en inkubator innstilt på 37 ° C og 5% CO2, og cellene kultur i 48 timer.
  6. Samle den virusinneholdende kultursupernatant vev ved hjelp av en pipette og deretter overføre den til et sentrifugerør. Sentrifuger ved 300 xg i 5 minutter for å pelletere cellene og rusk, og deretter filtrere supernatanten gjennom et 0,45 pm pore-størrelse sprøytefilter.
  7. For å eliminere en hvilken som helst overførings plasmid-DNA i denne cellefritt virus-preparat, behandle med DNase 1 (20 ug / ml) ved 37 ° C i 1 time.
  8. For å kvantifisereHIV-1-titer, bruker p24-spesifikke enzym-bundet immunosorbent assay (ELISA), som det er en hurtig og mottagelig fremgangsmåte for rutinemessig bruk 22.
    NB: Det bør bemerkes at p24 ELISA måler den fysiske titer (antall viruspartikler). Alternativt vil måle virusassosiert RT aktivitet (eksogene RT-analyse) eller virus smittsomhet (TZM-bl indikatorcellelinje-baserte smittsomhet analyser) gir eksklusive avlesning av smittsomme viruspartikler.

2. virus infeksjon av Sup-T1 Cells (BSL3 Lab)

  1. I en BSL2 lab, opprettholde Sup-T1 celler mellom 1,0 x 10 6 og 2,0 x 10 6 celler / ml i Roswell Park Memorial Institute (RPMI) medium supplementert med 10% varme-inaktivert FBS, penicillin og streptomycin (splitt forhold på 1 : 2 hver 2 - 3 d). Pool de Sup-T1 celler fra kulturflasker, bland godt ved pipettering, og bestemme levedyktige celler ved hjelp av en hemocytometer og trypanblått eksklusjon stinnelukker metode.
    1. Fremstille det nødvendige antall porsjoner av 80 x 10 6 celler (pr virus infeksjon) i 50 ml konisk sentrifugerør.
    2. Sentrifuger cellene i en svingende spannrotor-ved 500 xg og 25 ° C i 5 minutter. Uten å fjerne cellekulturmediet, overføre rør som inneholder pelle celler til BSL3 lab for videre behandling. aspirate nøye cellekulturmediet fra røret uten å forstyrre cellepelleten.
  2. Tilsett en passende mengde av DNase-behandlede virus inokulum til cellene i røret og bland godt ved forsiktig pipettering. For 80 x 10 6 celler ved å bruke 30 ml DNase-behandlede virus (50 ug p24-virus ekvivalent).
    MERK: Isolering av funksjonelle Pics krever infisere målcellene med svært høye multiplicities på infeksjon (MOI).
  3. Fordel blandingen jevnt mellom to seks-brønns vevskulturplater (dvs. 12 x 2,5-ml porsjoner; bruke 2 plater per infisereion).
  4. For spinoculation, plasserer kulturplater i platebærer og sentrifuger ved hjelp av en svingende spannrotor ved 480 xg og 25 ° C i 2 timer.
  5. Inkuber spinoculated cellene ved 37 ° C og 5% CO2 i 5 timer.

3. Høsting og Lysis av infiserte celler (BSL3 lab)

  1. Pool cellene som svarer til hver infeksjon fra kulturplatene inn i et 50 ml konisk sentrifugerør (~ 30 ml totalt).
  2. Høste cellene ved sentrifugering ved 300 xg og 25 ° C i 10 minutter. aspirer forsiktig supernatanten fra røret (alternativt bruke en pipette).
  3. For å fjerne eventuelle gjenværende virale partikler, vask hver celle pellet ved å tilsette 2 ml av buffer K - / - (150 mM KCl, 20 mM HEPES, pH 7,6, 5 mM MgCl2) og sentrifugering av prøven ved 300 xg og 25 ° C i 10 min. Deretter, uten å forstyrre pelleten forsiktig fjerne supernatanten ved aspirasjon eller ved hjelp av en pipette.
  4. Repeat trinn 3.3.
  5. fjerne eventuelle gjenværende buffer forsiktig ved anvendelse av en mikropipette. Suspender hver celle pellet i 2 ml iskald lyseringsbuffer K + / + (Buffer K - / - supplert med 0,025% digitonin, 1 mM DTT, 20 ug / ml aprotinin), bland innholdet ved forsiktig pipettering, og overføre til en 2 ml mikrosentrifugerør.

4. Utarbeidelse av cytoplasmatiske Pics (BSL3 lab)

  1. Rock prøvene på en rotasjonsrister ved RT i 10 min.
  2. Sentrifuger prøvene, med rotoren foravkjølt til 4 ° C, ved 1500 xg og 4 ° C i 4 min.
  3. Uten å forstyrre pelleten, overfører nøye supernatanten til et nytt mikrosentrifugerør og sentrifuger ved 16 000 xg og 4 ° C i 1 min.
  4. Overfør supernatanten forsiktig til et nytt mikrosentrifugerør. Legg RNase A (20 mg / ml) til en sluttkonsentrasjon på 20 pg / ml (2 mL for 2 ml av bilder) og inkuber innholdet ved RT i 30 minutter (ingen vippe). </ Li>
  5. Legg sukrose (60% vekt / volum i buffer K - / -) til en sluttkonsentrasjon på 7% og bland godt ved forsiktig pipettering. Forbered porsjoner (f.eks 200 mL) av bildene i Mikrosentrifugerør, flash-fryse i flytende nitrogen, og plasser i en -80 ° C fryser for langtidslagring.

5. In Vitro Integration (IVI) Analyser ved hjelp av HIV-1 pics

  1. Forbered mål-DNA brukes i IVI analysen ved å forsterke en 2.0 kb region fra phiX174 plasmid DNA med PCR ved hjelp av skreddersydde primere, phiX174-F og phiX174-R.
    1. Monter PCR-blanding som beskrevet i tabell 1. Utføre PCR i en termosykler ved hjelp av termiske sykluser betingelser som anbefales i tabell 2. Gel-rensing av PCR-produktet ved hjelp av en gel-rensesett (ved å følge produsentens anbefalte protokoll), og lagrer den rensede mål-DNA som alikvoter ved -80 ° C inntil bruk.
  2. Legg 600 ng av target DNA til 200 - & #181; L alikvot av bilder, bland godt og inkuber ved 37 ° C i 45 min.
    Merk: IVI reaksjoner utelate target DNA eller inkludert en integrase inhibitor (f.eks Raltegravir) anbefales kontroll reaksjoner.
  3. Stopp IVI reaksjonen ved tilsetning av SDS, EDTA og proteinase K til endelige konsentrasjoner på 0,5%, 8 mM, og 0,5 mg / ml, respektivt. Bland reaksjons innholdet grundig og inkuberes over natten ved 56 ° C.
  4. Den neste dag, rense den samlede DNA fra den IVI reaksjonen ved fenol / kloroform-ekstraksjon og etanolutfelling. Utføre alle sentrifugeringstrinn på 16 000 xg og RT.
  5. Legge til et likt volum av fenol til avproteinisert prøven, blandes kraftig ved virvling, og sentrifuger i 2 min. fjerne den øvre vandige fasen grundig og overføre den til et nytt rør.
  6. Gjenta trinn 5.5. Overfør den øvre vandige fasen til et nytt rør.
  7. Legge til et like stort volum av 1: 1 fenol: kloroform-blanding, blandes kraftig ved virvling, og sentrifuger for 2 min. Overfør den øvre vandige fasen til et nytt rør.
  8. Legge til et likt volum av kloroform, blandes kraftig ved virvling, og sentrifuger i 2 min. Overfør den øvre vandige fasen til et nytt rør.
  9. For å felle ut DNA, legge til glykogen til en endelig konsentrasjon på 0,1 ug / ul, 3 M natriumacetat til en sluttkonsentrasjon på 0,3 M, og 2,5 volumer 100% etanol (iskald). Vortex for å blande, kort sentrifuger for å samle innholdet, og plassere røret ved -80 ° CO / N.
  10. Den neste dag, sentrifuger prøven i 30 minutter ved 16000 xg og 4 ° C i 30 minutter. Fjern forsiktig supernatanten uten å forstyrre pelleten.
  11. Legge til 500 ul av 80% etanol (iskald) til pelleten og sentrifuger ved 16 000 xg og 4 ° C i 10 min. Air-tørke DNA pellet ved RT og grundig resuspender i 50 mL av nukleasefritt vann. Oppbevar DNA-prøvene ved -20 ° C.

6. PCR-analyser for å kvantifisere PIC aktivitet

  1. Utfør første runde konvensjonell PCR bruke primere rettet mot viral LTR og phiX174 DNA (LTR og phiX174 primere, henholdsvis) for å forsterke veikryssene integrert HIV-1 DNA.
    1. Montere den første runde PCR-blanding som beskrevet i Tabell 3. Sett sammen en mester blanding av alle komponenter unntatt malen DNA, dispensere 45-ul porsjoner i separate PCR-rør, og legge til 5 mL av templat-DNA eller nukleasefritt vann (kontroll).
    2. Utføre PCR i en termosykler ved hjelp av termiske sykluser betingelser som anbefales i tabell 4.
  2. Utføre andre runde qPCR anvendelse av primere som flankerer et kort område av det virale LTR (LTR-R og LTR-U primere) for selektivt å forsterke den integrerte vDNA sekvensene fra første-round PCR-produkter. For å bestemme den integrerte vDNA kopitall, å generere en standardkurve ved bruk av 10x seriefortynninger av kjente kopiantall (f.eks, 10 0 - 10 8) av HIV-1 molekylær klon.
    1. Montere den andre runde qPCR blanding som beskrevet i tabell 5. Sett sammen en mester blanding av alle komponenter unntatt malen DNA, nøye dispensere 25 ul porsjoner inn i riktig antall brønner i en 96-brønns PCR reaksjon plate, og deretter legge til 5 mL av urenset første runde PCR produkter eller nukleasefritt vann (kontroll). Utføre alle qPCR reaksjoner i tre eksemplarer.
    2. Last PCR-platen inn i real-time PCR instrument og utføre qPCR ved hjelp av sykkelforhold anbefalt i tabell 6.
    3. Analysere dataene ved hjelp av et egnet programvare.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Isolering av HIV-1 Pics

En skjematisk av protokollen som brukes for isolering av HIV-1 PICs fra akutt infiserte Sup-T1 celler er vist i figur 1. Denne protokollen er avledet fra fremgangsmåtene beskrevet av Engelman et al. 19, 20. HIV-1-bildene er nukleoprotein komplekser som er satt sammen i infiserte celler, og er omfattet av den reverstranskribert vDNA, virusproteiner og cellulære faktorer 19, 20. Den metode som er beskrevet i denne rapporten benytter cytoplasmiske ekstrakter av HIV-1-infiserte celler som kilde for PIC-assosiert integrering aktivitet.

In vitro integrering aktivitet av HIV-1 pics

figur 2. Denne metoden benytter en nestet qPCR-basert strategi for måling av PIC-assosiert IVI-aktivitet, og fremgangsmåten er tilpasset, sammen med modifikasjoner av protokollene som utgis av Engelman laboratoriet 19, 20, 21. I denne fremgangsmåten blir det PIC-assosierte integrering aktivitet initiert ved å tilveiebringe et heterologt lineært mål-DNA 21, og DNA-produktene som resulterer fra denne reaksjon integrasjonen er renset og anvendt som utgangsmateriale for påfølgende PCR-baserte kvantifisering. I første runde konvensjonell PCR blir viral-target DNA veikryss forsterket ved hjelp av egnede primere. I andre runde qPCR, er LTR-spesifikke primere som brukes til å spesifikt berike vDNA befolkningen fra første runde PCR produktene. Vennligst se protokollen sEL for en detaljert beskrivelse av denne metoden.

Representative resultater fra en IVI-analyse utført ved anvendelse av HIV-1-bilder er vist i figur 3. Sup-T1 celler (80 x 10 6 celler / infeksjon) ble spinoculated med 30 ml DNase 1-behandlede HIV-1 (~ 50 pg av p24 ekvivalent) i fravær eller nærvær av 1 uM HIV-1 IN inhibitor Raltegravirs ved 480 xg og 25 ° C i 2 timer. Celler ble deretter dyrket i 5 timer ved 37 ° C og 5% CO2. Bildene ble isolert som beskrevet i fremgangs delen. De IVI Reaksjonene ble utført, hver ved anvendelse av 200 ul av bilder og 600 ng av mål-DNA (et fragment 2 kb DNA amplifisert fra phiX174 DNA ved PCR), ved 37 ° C i 45 min. Reaksjonene ble avproteinisert ved proteinase K-behandling i nærvær av SDS og EDTA ved 56 ° CO / N. Reaksjonsproduktene ble ekstrahert to ganger med fenol, en gang med fenol: kloroform (1: 1) blanding, og en gangmed kloroform. Deretter ble DNA ble etanol-presipitert i nærvær av salt og co-fellingsmiddel glykogen, og den DNA-pelleten ble vasket en gang med 80% etanol. Det rensede DNA ble resuspendert i 50 ul av nuklease-fritt vann. En nestet qPCR strategi ble anvendt for å bestemme antall vDNA integrert i phiX174 DNA. I første runde konvensjonell PCR, ble primere komplementære til sekvenser på phiX174 target DNA og viral LTR region brukes til å forsterke den integrerte viral-target DNA veikryss fra 5 mL av integrasjon reaksjons DNA-produkter. I den andre runden qPCR-, LTR-primere som spenner over ble anvendt for å amplifisere utelukkende de HIV-spesifikke DNA-sekvenser fra 5 ul av de først rund amplikonet produkter og fra 10-gangers seriefortynninger av kjente kopiantall (10 8 -10 0) av HIV-1 molekylær klon (Standards).

Alle qPCR reaksjoner ble utført i tre eksemplarer og dataene were analysert ved hjelp av kommersiell programvare. De avledet fra standardene verdier ble plottet for å generere en standardkurve, hvorfra de integrerte vDNA kopitall ble interpolert. Feilfelt representerer standardavvik. Som vist i figur 3, er HIV-1-PICs robust integrere den tilhørende vDNA til mål-DNA (felt 5). Viktigst, IVI effektiviteten av Pics ble sterkt redusert i reaksjonene supplert med in-hemmer Raltegravir (Lane 6). Dette attributter sterkt integrasjons aktivitet målt i denne analysen til HIV-1 IN. Videre er kontrollreaksjoner inneholdende cytoplasmatiske lysater fra uinfiserte celler (kolonne 1), bilder alene (spor 2), mål-DNA alene (spor 3), og buffer alene (kolonne 4) viste ingen integrering aktivitet. I tillegg gjorde den kontrollen som utelukket Taq polymerase i første runde PCR (Lane 7) ikke forsterke integrering produkter. Spesielt data fra Pics-alene-kontroll (Lane 2) indikerte at nestet qPCR strategi spesifitisk måler den integrerte vDNA men ikke PIC-assosiert vDNA. Sammen er disse data viser målingen av PIC-assosiert integrering aktivitet.

Figur 1
Figur 1: Skjematisk fremstilling av protokollen for utarbeiding av HIV-1 pics. Klikk her for å se en større versjon av dette tallet.

Cytoplasmatiske ekstrakter som inneholder bildene er isolert fra HIV-1-infiserte Sup-T1 celler. Disse bildene er anvendt som kilde for integrering aktivitet i in vitro-analysen integrasjon.

Figur 2
Figur 2: Skjematisk representasjon av in vitro m> Integrering analyse av HIV-1 pics. Klikk her for å se en større versjon av dette tallet.

Integrasjons analyser ble utført in vitro ved å bruke HIV-1-bilder og det heterologe target phiX174 DNA. Den integrerte HIV-1 DNA ble målt ved hjelp av en nestet PCR-strategi, karakterisert ved at den første runde konvensjonell PCR forsterker integrasjons knutepunktene hvorfra vDNA-spesifikke sekvensene er fortrinnsvis forsterket i en andre runde qPCR.

Figur 3
Figur 3: HIV-1 PIC-forbundet vDNA Integration aktivitet. Klikk her for å se en større versjon av dette tallet.

"Fo: hold-together.within-siden =" en "> Representative resultater av HIV-1 PIC-assosiert integrering aktivitetsanalyse De integrerte vDNA kopitall ble bestemt ved å plotte verdier avledet fra en standardkurve dannet ved anvendelse av 10 x seriefortynninger av. kjente kopiantall av en HIV-1 molekylær klon. Alle reaksjoner ble utført in triplo, og dataene ble analysert ved anvendelse av kommersiell programvare. Feilstolper representerer standardavvik.

Komponent Lager Sluttvolumet for 50 mL reaksjon
phiX174 plasmid DNA 10 ng / mL 5,0 mL
GoTaq reaksjon buffer 5x 10,0 mL
dNTP nucleotide blanding 10 mm hver 1,0 mL
phiX174-F primer 10 mikrometer 2,5 mL
phiX174-R primer 10 mikrometer 2,5 mL
GoTaq DNA Polymerase (5 U / mL) 0,25 mL
Nukleasefritt destillert vann - 28.75 mL

Tabell 1.

95 ° C = 2 min
Cycle 34 repetisjoner av:
95 ° C = 30 sek
53 ° C = 30 sek
72 ° C = 2 min
72 ° C = 10 min
4 ° C = Hold

Tabell 2.

Komponent Lager Sluttvolumet for 50 mL reaksjon
IVI reaksjon DNA produkt - 5,0 mL
GoTaq reaksjon buffer 5x 10,0 mL
dNTP nucleotide blanding 10 mm hver 1,0 mL
LTR primer 10 mikrometer 2,5 mL
phiX174 primer 10 mikrometer 2,5 mL
GoTaq DNA Polymerase (5 U / mL) 0,25 mL
Nukleasefritt destillert vann - 28.75 mL

Tabell 3.

95 ° C = 5 min
Cycle 23 repetisjoner av:
94 ° C = 30 sek
55 ° C = 30 sek
72 ° C = 4 min
72 ° C = 10 min
4 ° C = Hold

Tabell 4.

<td> Taqman Probe
Komponent Lager Sluttvolumet for 30 mL reaksjon
1 st runde PCR-produkter - 5,0 mL
LTR-R primer 10 mikrometer 0,9 mL
LTR-U primer 10 mikrometer 0,9 mL
10 mikrometer 0,3 mL
iQ Supermix 2x 15,0 mL
Nukleasefritt destillert vann - 7,9 mL

Tabell 5.

95 ° C = 3 min
Cycle 39 repetisjoner av:
94 ° C = 15 s
58 ° C = 30 sek
72 ° C = 30 sek
plate Les

Tabell 6.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Biokjemiske analyser av retrovirale Pics har gitt kritiske innsikt i mekanismen av retrovirale DNA integrering. Måling av integrasjonen aktivitet av retrovirale PICs kan oppnås ved plakkdannelse assay, Southern blot-analyse, og nestet qPCR. Den eksperimentelle formasjonen plaque-analysen er arbeidskrevende og utnytter en indirekte metode for å måle integrering 6, 7, 18. Southern blot-baserte analyser måler direkte integrering, men krever forholdsvis store mengder av bilder 6, 7, 18.

Denne rapporten detaljer en nestet qPCR strategi for måling av HIV-1 PIC-assosiert integrering aktivitet in vitro. Den store fordel og betydning av denne fremgangsmåte er kravet om forholdsvis lave mengder av PIC-preparat per reaksjon 4, 5, 19. De mest kritiske trinn i denne fremgangsmåten er genereringen av et høyt titer for virus infeksjon og håndtering av PIC preparat. Det skal her bemerkes at den første runden av PCR innebærer eksponensiell amplifisering av integrasjons veikryss. Derfor kopierings antall integrert vDNA fastsatt i andre runde qPCR er semi-kvantitative og dermed har begrensning av ikke å gi et mål på PIC-forbundet vDNA kopier. Imidlertid kan den PIC-assosierte vDNA bestemmes ved qPCR av DNA renset fra bilder med LTR-spesifikke primere. Forholdet mellom de integrerte vDNA kopiere numre til tilsvarende PIC-forbundet vDNA kan gi informasjon om integrering effektiviteten av en in vitro integrasjon reaksjon. Denne metoden kan endres ved å innlemme andre heterologe target DNA av valg og andre primere for å oppdage integrering i begge retninger. I sammendraget, metodenbeskrevet her måler integrering aktiviteten av HIV-1 pics kvantitativt og kan tas i bruk for forskning utvikle en forståelse av de biokjemiske detaljer om retroviral integrering.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne erklærer ingen konkurrerende finansielle eller ikke-finansielle interesser.

Acknowledgments

Dette arbeidet er delvis støttet med tilskudd DA024558, DA30896, DA033892, og DA021471 fra NIDA / NIH til CD. Vi erkjenner også RCMI tilskuddet G12MD007586, Vanderbilt CTSA gi UL1RR024975, den Meharry Translasjonell Research Center (MeTRC) CTSA stipend U54 RR026140 fra NCRR / NIH, den U54 tilskuddet MD007593 fra NIMHD / NIH, og Tennessee CFAR tilskuddet P30 AI110527.

Materials

Name Company Catalog Number Comments

Fetal Bovine Serum (FBS)

GIBCO/Invitrogen

10437-028

Heat-inactivated Fetal Bovine Serum (Hi-FBS)

GIBCO/Invitrogen

10438-026

Dulbecco’s modified Eagle’s medium (DMEM)

GIBCO/Invitrogen

11995-065

Roswell Park Memorial Institute (RPMI) 1640 medium

GIBCO/Invitrogen

11875-093

Phosphate-buffered Saline (PBS) (1x)

GIBCO/Invitrogen

20012-027

Trypsin-EDTA (0.25%)

GIBCO/Invitrogen

25200-056

Penicillin-Streptomycin solution (100x)

Cellgro/Mediatech

30-002-CI

HEK293T cells (293T)

American Type Culture Collection (ATCC)

CRL-3216

HIV-1 proviral molecular clone pNL4-3

NIH AIDS Research and Reference Reagent Program

114

PolyFect transfection reagent

Qiagen

301107

DNase 1

Calbiochem/Merckmillipore

260913

Sup-T1 cells

American Type Culture Collection (ATCC)

CRL-1942

HEPES pH 7.2 - 7.5

(ready-to-use solution)

GIBCO/Invitrogen

15630-080

Potassium chloride (KCl) solution

Sigma-Aldrich

60142

Magnesium chloride (MgCl2) solution

Sigma-Aldrich

M1028

Dithiothreitol (DTT)

Sigma-Aldrich

43815

Aprotinin

Sigma-Aldrich

A6106

Digitonin

Sigma-Aldrich

D141

RNase A

Invitrogen

12091-021

Sucrose

Sigma-Aldrich

S0389

phiX174 Replicative Form 1 DNA

Promega

D1531

PhiX174-F primer:

5’-CGCTTCCATGACGCAGAAGTT-3’

PhiX174-R primer:

5’-CACTGACCCTCAGCAATCTTA-3’

Invitrogen and/or IDT-DNA

dNTP mix

Promega

U1515

Go Taq DNA Polymerase

Promega

M3005

Qiaquick gel extraction kit

Qiagen

28706

Ultrapure distilled water

Invitrogen

10977-015

Tris-EDTA (TE) buffer (100x)

Sigma-Aldrich

T9285

Sodium Dodecyl Sulphate (SDS)

Sigma-Aldrich

L3771

Ethylenediamine tetraacetic acid, disodium salt (EDTA) solution, 0.5 M, pH 8.0

Sigma-Aldrich

E7889

Proteinase K (20 mg/mL ready-to-use solution)

Qiagen

19131

Phenol (equilibrated with 10 mM Tris HCl, pH 8.0 and 1 mM EDTA)

Sigma-Aldrich

P4557

Chloroform

Sigma-Aldrich

288306

Glycogen (5 mg/mL solution)

Ambion/Invitrogen

AM9510

Sodium acetate (3 M, pH 5.2)

Sigma-Aldrich

S7899

Ethanol

Sigma-Aldrich

E7023

First round LTR primer:

5’-GTGCGCGCTTCAGCAAG-3’

First round phiX174 primer:

5’-CACTGACCCTCAGCAATCTTA-3’

Invitrogen and/or IDT-DNA

---

Second round LTR-R primer:

5’-TCTGGCTAACTAGGGAACCCA-3’

Second round LTR-U primer:

5’-CTGACTAAAAGGGTCTGAGG-3’

Second round Taqman probe:

 5’-6- FAM/TTAAGCCTCAATAAAGCTTGC

CTTGAGTGC/6-TAMRA/-3’

Invitrogen and/or IDT-DNA

---

iQ Supermix

Bio-Rad

170-8862

DOWNLOAD MATERIALS LIST

References

  1. Sattentau, Q. J., Weiss, R. A. The CD4 antigen: physiological ligand and HIV receptor. Cell. 52, (5), 631-633 (1988).
  2. Wilen, C. B., Tilton, J. C., Doms, R. W. Molecular mechanisms of HIV entry. Adv Exp Med Biol. 726, 223-242 (2012).
  3. Bowerman, B., Brown, P. O., Bishop, J. M., Varmus, H. E. A nucleoprotein complex mediates the integration of retroviral DNA. Genes Dev. 3, (4), 469-478 (1989).
  4. Bukrinsky, M. I., Sharova, N., Dempsey, M. P., et al. Active nuclear import of human immunodeficiency virus type 1 preintegration complexes. Proc Natl Acad Sci. 9, (14), 6580-6584 (1992).
  5. Hansen, M. S., Smith, G. J. 3rd, Kafri, T., Molteni, V., Siegel, J. S., Bushman, F. D. Integration complexes derived from HIV vectors for rapid assays in vitro. Nature biotechnol. 17, (6), 578-582 (1999).
  6. Farnet, C. M., Haseltine, W. A. Integration of human immunodeficiency virus type 1 DNA in vitro. Proc Natl Acad Sci. 87, (11), 4164-4168 (1990).
  7. Fujiwara, T., Mizuuchi, K. Retroviral DNA integration: structure of an integration intermediate. Cell. 54, (4), 497-504 (1988).
  8. Brown, P. O., Bowerman, B., Varmus, H. E., Bishop, J. M. Correct integration of retroviral DNA in vitro. Cell. 49, (3), 347-356 (1987).
  9. Lewinski, M. K., Bushman, F. D. Retroviral DNA integration--mechanism and consequences. Adv Genet. 55, 147-181 (2005).
  10. Engelman, A., Mizuuchi, K., Craigie, R. HIV-1 DNA integration: mechanism of viral DNA cleavage and DNA strand transfer. Cell. 67, (6), 1211-1221 (1991).
  11. Goff, S. P. Genetics of retroviral integration. Ann rev gen. 26, 527-544 (1992).
  12. Panganiban, A. T., Temin, H. M. The terminal nucleotides of retrovirus DNA are required for integration but not virus production. Nature. 306, (5939), 155-160 (1983).
  13. Bieniasz, P. D. The cell biology of HIV-1 virion genesis. Cell host microbe. 5, (6), 550-558 (2009).
  14. Sherman, P. A., Fyfe, J. A. Human immunodeficiency virus integration protein expressed in Escherichia coli possesses selective DNA cleaving activity. Proc Natl Acad Sci. 87, (13), 5119-5123 (1990).
  15. Katzman, M., Katz, R. A., Skalka, A. M., Leis, J. The avian retroviral integration protein cleaves the terminal sequences of linear viral DNA at the in vivo sites of integration. J Virol. 63, (12), 5319-5327 (1989).
  16. Craigie, R., Mizuuchi, K., Bushman, F. D., Engelman, A. A rapid in vitro assay for HIV DNA integration. Nucl acid res. 19, (10), 2729-2734 (1991).
  17. Bushman, F. D., Craigie, R. Activities of human immunodeficiency virus (HIV) integration protein in vitro: specific cleavage and integration of HIV DNA. Proc Natl Acad Sci. 88, (4), 1339-1343 (1991).
  18. Pauza, C. D. Two bases are deleted from the termini of HIV-1 linear DNA during integrative recombination. Virology. 179, (2), 886-889 (1990).
  19. Engelman, A. Isolation and analysis of HIV-1 preintegration complexes. Meth Mol Biol. 485, 135-149 (2009).
  20. Engelman, A., Oztop, I., Vandegraaff, N., Raghavendra, N. K. Quantitative analysis of HIV-1 preintegration complexes. Methods. 47, (4), 283-290 (2009).
  21. Addai, A. B., Pandhare, J., Paromov, V., Mantri, C. K., Pratap, S., Dash, C. Cocaine modulates HIV-1 integration in primary CD4+ T cells: implications in HIV-1 pathogenesis in drug-abusing patients. J Leuk Biol. 97, (4), 779-790 (2015).
  22. Wehrly, K., Chesebro, B. p24 antigen capture assay for quantification of human immunodeficiency virus using readily available inexpensive reagents. Methods. 12, (4), 288-293 (1997).
måling av<em&gt; In Vitro</em&gt; Integrering Aktivitet av HIV-1 Preintegration Komplekser
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Balasubramaniam, M., Davids, B., Addai, A. B., Pandhare, J., Dash, C. Measurement of In Vitro Integration Activity of HIV-1 Preintegration Complexes. J. Vis. Exp. (120), e54581, doi:10.3791/54581 (2017).More

Balasubramaniam, M., Davids, B., Addai, A. B., Pandhare, J., Dash, C. Measurement of In Vitro Integration Activity of HIV-1 Preintegration Complexes. J. Vis. Exp. (120), e54581, doi:10.3791/54581 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter