Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

Medição de doi: 10.3791/54581 Published: February 22, 2017

Abstract

proteínas de HIV-1 envelope envolver receptores cognatos na superfície da célula-alvo, o que leva a fusão da membrana da célula virai seguida pela libertação do núcleo da cápside virai (CA) para o citoplasma. Subsequentemente, a transcriptase reversa virai (RT), como parte de um complexo homónimo nucleoproteína denominado o complexo Transcrição Reversa (RTC), converte o genoma de ARN viral de cadeia simples em uma cópia de ADN de cadeia dupla (vDNA). Isto leva a biogénese de outro complexo de nucleoproteínas, denominado o complexo de pré-integração (PIC), composto do vDNA e proteínas de vírus associados e factores do hospedeiro. A integrase viral associada-PIC (EM) orquestra a integração do vDNA no ADN cromossómico do hospedeiro em um processo de duas etapas espacialmente e temporalmente regulado. Em primeiro lugar, o nos processos de extremidades 3 'do vDNA no citoplasma e, em segundo lugar, após o PIC trafica para o núcleo, que medeia a integração do vDNA processado no ADN cromossómico. Os PICs isoladoa partir de células-alvo infectados de forma aguda com HIV-1 são funcionais in vitro, uma vez que são competentes para integrar o vDNA associado num ADN alvo heterólogo adicionado exogenamente. Tal-PIC com base em ensaios in vitro de integração têm contribuído significativamente para delinear os detalhes mecanicistas de integração retroviral e descobrindo em inibidores. Neste relatório, nós elaboramos sobre um ensaio PIC HIV-1 actualizado que emprega uma estratégia baseada aninhada em tempo real Polymerase Chain Reaction quantitativa (qPCR) para medir a atividade de integração in vitro de PICs nativas isoladas.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Replicação de HIV-1 na célula alvo envolve vários passos, agrupadas em duas fases: eventos precoces e tardias. Os eventos iniciais começam quando o HIV-1 liga-se a sequência do receptor de superfície da célula alvo CD4 e um dos dois co-receptores (CCR5 ou CXCR4) 1. Por conseguinte, o fusível membranas de células com vírus, e a cápside virai (CA) do núcleo é libertado para o citoplasma 2. O núcleo CA contenha o ARN virai genómico de cadeia simples (ssRNA) e várias proteínas, tanto virais e celulares na origem. As proteínas virais associadas-CA incluem Transcriptase Reversa (RT) e da integrase (IN), duas enzimas que medeiam passos críticos durante eventos precoces da replicação viral. A RT e IN função no contexto de complexos nucleoproteicos, nomeadamente a transcrição reversa Complexo (RTC) e o complexo de pré-integração (PIC), respectivamente 3, 4, 5 <sup>, 6. As extremidades do genoma viral ssRNA terminal do porto de repetição (R) elementos adjacentes às sequências U5 única (na extremidade 5 ') e U3 (na extremidade 3'). O RTC converte o genoma viral num ssRNA (DS) de cópia de ADN de cadeia dupla (vDNA). Este processo de transcrição reversa também resulta na duplicação das sequências U5 e U3, gerando, assim, repetições terminais longas (LTR) em ambas as extremidades do vDNA 7, 8. Subsequentemente, o EM-associado PIC catalisa duas reacções bioquímicas sequenciais que permitem a integração do vDNA no cromossoma do hospedeiro 9, 10, 11. Em primeiro lugar, no citoplasma, EM multímeros envolver ambas as LTRs 12 e clivar um dinucleótido de cada uma das extremidades 3 '-terminal. Este processamento de extremidade 3 'gera um grupo hidroxilo em cada extremidade 3' (CA OH) do vDNA.Em seguida, o PIC trafica para o núcleo, em que utiliza o vDNA CA OH como um nucleófilo para cortar ambas as cadeias do ADN cromossómico de forma escalonada. Simultaneamente, EM coordenadamente emendas de ambas as extremidades do vDNA para as ligações fosfodiéster que resultam em cadeias opostas do ADN cromossómico. Após este passo de transferência de cadeia, a maquinaria da célula hospedeira remove os dois nucleótidos desemparelhados nas extremidades 5 'do vDNA e repara as consequentes lacunas de cadeia simples na junção do local de integração. Os eventos iniciais, assim, culminar com a criação de uma cópia de DNA integrado (provírus) do HIV-1 genoma. O provírus proporciona um ambiente apropriado para a expressão do gene virai eficiente, o que inicia os eventos posteriores, incluindo a expressão das proteínas codificadas por vírus; montagem do vírus imaturo; e brotação, release, e maturação em viriões infecciosos 13.

Purificada IN retroviral recombinante é competente pararealizar, in vitro, ambas as atividades de processamento e transferência de cadeia 3'-end em exogenamente fornecido DNA substrato LTR-like. Os estudos bioquímicos usando tais IN recombinante purificada revelaram aspectos críticos da integração vDNA 14, 15, 16, 17. No entanto, ao contrário da infecção natural, esta reacção bioquímica in vitro não suporta integração combinada de ambas as extremidades do ADN substrato para a DNA-alvo. Em contraste, os PICs retrovirais isolados a partir de células infectadas de forma aguda concertadamente integrar ambas as extremidades do vDNA endógena no ADN alvo heterólogo. Isto levou à adopção generalizada e refinamentos subsequentes de ensaios in vitro Integração (IVI) I n usando PICs nativas isoladas.

No primeiro ensaio relatado retroviral IVI, extractos citoplasmáticos de células infectadas com um recombinante de murinoVírus da Leucemia (MLV) que alberga o gene de E. coli supF na sua LTR serviu como fonte de actividade em, e o ADN de um fago lambda mutante defeituoso no crescimento lítico foi fornecido exogenamente como o ADN alvo. A integração bem sucedida do ADN recombinante MLV copiar para o ADN de fago e a expressão consequente supF levou a restauração da capacidade de formação de placas de fagos recombinantes. No entanto, esta estratégia experimental é a integração trabalhoso e medidas de forma indireta. Para lidar com estas advertências, um ensaio de marcação terminal indirecta à base de Southern blot, que quantifica a actividade associada IVI-PIC como uma medida da vDNA endógena exógeno integrado no bacteriófago linearizado phiX174 ADN, foi desenvolvido 6, 7, 18. Embora este método proporciona uma medida directa de eventos de integração, quantidades relativamente elevadas de preparação PIC são necessários, o que continua a ser um desafio técnicoesforço. Para contornar isso, aninhados ensaios baseados em PCR que exigem apenas quantidades modestas de PICs foram desenvolvidos 4, 5, 19.

Neste relatório, nós descrevemos uma versão atualizada de um nested PCR baseado no método in vitro concebido para recapitular a atividade de integração do HIV-1 PIC-mediada que ocorrem durante a infecção natural. Este método utiliza os extractos citoplasmáticos de células alvo de HIV-1-infectadas como uma fonte de actividade PIC endógena, que é medido com um tempo real Polimerase Chain Reaction quantitativa (qPCR). Os procedimentos para isolar PICs e medir suas atividades de integração são adaptados, com modificações, a partir de protocolos publicados pelo laboratório Engelman 20. Neste método, a actividade de integração associada-PIC é iniciado, fornecendo um ADN alvo exógeno linear 21, e os produtos de DNA resultantesesta reacção integração são purificados e utilizados como material de partida para a quantificação baseado no PCR subsequente. Na primeira ronda de PCR convencional, as junções de ADN viral-alvo são amplificados utilizando iniciadores apropriados. Na segunda rodada qPCR, primers específicos de LTR são usadas para enriquecer especificamente a população vDNA do primeiro turno produtos de PCR. Por favor, consulte a seção de protocolo para uma descrição detalhada deste método.

Estudos in vitro com PICs retrovirais têm conduzido a avanços significativos na compreensão do mecanismo de integração de ADN retroviral e no desenvolvimento de inibidores de NOS. Com base na recente foco maior sobre mapeamento de HIV-1 sites de integração, determinar o papel dos fatores virais e do hospedeiro na HIV-1 integração e desenvolvimento de novas drogas antivirais para o combate à resistência aos medicamentos, prevemos um aumento do interesse e uso generalizado de ensaios IVI , como o descrito no presente relatório. Este, por sua vez, levará afuturos aperfeiçoamentos no método, diversificando assim o alcance de suas aplicações.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Produção 1. Vírus

NOTA: Para gerar títulos elevados de VIH-1 infeccioso, transfectar a linha celular de rim embrionário humano (HEK) 293T com um clone molecular infeccioso do HIV-1 usando um reagente de transfecção à base de dendrímero activado. Tem sido observado que o método de transfecção com fosfato de cálcio produz resultados comparáveis.

  1. Em um laboratório de Segurança Biológica Nível 2 (BSL2), semente de 3 x 10 6 293T células por placa de 10 cm em 8 ml de Dulbecco Modified Eagle Médium (DMEM) suplementado com 10% de Soro Fetal Bovino (FBS), penicilina e estreptomicina. Cultura das células numa incubadora a 37 ° C e 5% de CO 2 O / N.
  2. No dia seguinte, as células para transfecção em cada placa de 10 cm, dilui-se 8 ug de DNA do plasmídeo pNL4-3 (ver Materiais Tabela) a um volume final de 300 ul de DMEM sem soro e antibióticos. Adicionar 80 ul de reagente de transfecção, misturar bem por pipetagem, e incubar à TA durante5 - 10 min para a formação do complexo de transfecção.
  3. Remover o meio das placas por aspiração e adiciona 7 ml por placa de meio DMEM fresco contendo soro e antibióticos.
  4. Adicionar 1 ml de DMEM contendo soro e antibióticos para o complexo de transfecção, misturar por pipetagem, e adicionar esta mistura para as células. Agite suavemente o prato para facilitar a distribuição uniforme dos complexos de transfecção.
  5. Imediatamente transferir as células para o laboratório BSL3, lugar numa incubadora a 37 ° C e 5% de CO 2, e a cultura das células durante 48 h.
  6. Recolhe-se o sobrenadante da cultura de tecido contendo vírus, utilizando uma pipeta e, em seguida, transferi-lo para um tubo de centrífuga. Centrifuga-se a 300 xg durante 5 min para sedimentar as células e detritos, e, em seguida, filtrar o sobrenadante através de um filtro de seringa de 0,45 um tamanho de poro.
  7. Para eliminar qualquer ADN plasmídico transição nesta preparação de vírus livre de células, trata-se com ADNase 1 (20 ug / ml) a 37 ° C durante 1 h.
  8. Para quantificar aHIV-1 título, utilizar o enzyme-linked Immunosorbent Assay específicos de p24 (ELISA), como é um método rápido e propícios para uso rotineiro 22.
    NOTA: Deve-se notar que o ensaio ELISA de p24 mede o título física (número de partículas de vírus). Alternativamente, a medição da actividade associada ao vírus RT (ensaio de RT exógeno) ou de infecciosidade do vírus (ensaios de infecciosidade baseados em linha de célula indicadora TZM-bl) irá fornecer leitura exclusiva de partículas de vírus infecciosas.

2. Infecção do vírus de células Sup-T1 (BSL3 Lab)

  1. Num laboratório BSL2, manter as células SUP-T1 entre 1,0 x 10 6 e 2,0 x 10 6 células / ml em Roswell Park Memorial Institute (RPMI) meio suplementado com 10% de FBS inactivado pelo calor, penicilina e estreptomicina (razão de divisão de 1 : 2 a cada 2-3 d). Reunir as células SUP-T1 a partir dos frascos de cultura, misturar bem por pipetagem, e determinar a contagem de células viáveis ​​utilizando um hemacitómetro e a exclusão de azul de tripano rMétodo aining.
    1. Prepara-se o número necessário de partes alíquotas de 80 x 10 6 células (por infecção pelo vírus) em 50 ml de tubos de centrífuga cónico.
    2. Centrifugar as células em um rotor de balde a 500 xg e 25 ° C durante 5 min. Sem remover o meio de cultura celular, transferir os tubos contendo as células peletizadas para o laboratório BSL3 para processamento adicional. Aspirar cuidadosamente o meio de cultura de células a partir do tubo, sem perturbar o sedimento celular.
  2. Adicionar uma quantidade apropriada de inoculo de vírus tratada com ADNase I para as células no tubo e misturar bem por pipetagem suave. Durante 80 x 10 6 células, utilizar 30 ml de vírus tratada com ADNase I (50 ug de p24-vírus equivalente).
    NOTA: Isolamento de PICs funcional requer infectar as células-alvo com muito altas multiplicidades de infecção (MOI).
  3. Distribua a mistura uniformemente entre duas placas de cultura de tecidos de 6 poços (ou seja, 12 alíquotas x 2,5 ml; usar 2 placas por infectaríon).
  4. Para spinoculation, colocar as placas de cultura em suportes de pratos, e centrífuga utilizando um rotor basculante a 480 xg e 25 ° C durante 2 h.
  5. Incubar as células a 37 spinoculated ° C e 5% de CO 2 durante 5 h.

3. colheita e lise de células infectadas (laboratório BSL3)

  1. Reunir as células correspondentes a cada infecção a partir das placas de cultura para um tubo de 50 mL cónico de centrifugação (~ 30 mL no total).
  2. Colher as células por centrifugação a 300 xg e 25 ° C durante 10 min. Aspirar cuidadosamente o sobrenadante do tubo (em alternativa, usar uma pipeta).
  3. Para remover todas as partículas virais residuais, lavar cada pelete de células por adição de 2 ml de tampão de K - / - (KCl 150 mM, HEPES 20 mM, pH 7,6, 5 mM de MgCl2) e centrifugando a amostra a 300 xg e 25 ° C durante 10 min. Em seguida, sem perturbar o sedimento, remover cuidadosamente o sobrenadante por aspiração ou usando uma pipeta.
  4. REPEAt passo 3.3.
  5. Cuidadosamente remover qualquer tampão residual, utilizando uma micropipeta. Ressuspender cada pelete de células em 2 ml de gelo-frio de tampão de lise de K + / + (tampão de K - / - suplementado com 0,025% de digitonina, DTT 1 mM, 20 ug / ml de aprotinina), misturar o conteúdo por pipetagem suave, e transferir para um 2 mL tubo de microcentrífuga.

4. Preparação de PICs Citoplasmáticas (laboratório BSL3)

  1. Balançar as amostras num agitador rotativo à temperatura ambiente durante 10 min.
  2. Centrifugar as amostras, com o rotor pré-arref ecido a 4 ° C, a 1.500 xg e 4 ° C durante 4 min.
  3. Sem perturbar o sedimento, transferir cuidadosamente o sobrenadante para um tubo de microcentrífuga fresco e centrifuga-se a 16.000 xg e 4 ° C durante 1 min.
  4. Transferir cuidadosamente o sobrenadante para um tubo de microcentrifugação fresco. Adicionar RNase A (20 mg / ml) para uma concentração final de 20 ug / mL (2 mL para 2 mL de PICs) e incuba-se o conteúdo à TA durante 30 minutos (sem balanço). </ Li>
  5. Adicionar sacarose (60% w / v em tampão de K - / -) para uma concentração final de 7% e misturar bem por pipetagem suave. Preparar alíquotas (por exemplo, 200? L) de PICs em tubos de microcentrífuga, de flash por congelação em azoto líquido, e colocar num congelador de -80 ° C para armazenamento a longo prazo.

5. In Vitro Integração (IVI) Ensaios Usando HIV-1 PICs

  1. Prepara-se o ADN alvo utilizado no ensaio IVI por amplificação de uma região de 2,0 kb do DNA de plasmídeo com phiX174 PCR utilizando iniciadores feitos por medida, phiX174-F e phiX174-R.
    1. Montar a mistura de PCR como descrito na Tabela 1. Executar PCR num termociclador utilizando as condições de ciclos térmicos recomendadas na Tabela 2. Gel-purificar o produto de PCR utilizando um kit de purificação em gel (seguindo o protocolo recomendado pelo fabricante), e armazenar o ADN alvo purificado como alíquotas a -80 ° C até à sua utilização.
  2. Adicionar 600 ng de ADN alvo de 200 - & #181; L alíquota de PICs, misturar bem e incubar a 37 ° C durante 45 min.
    Nota: As reacções IVI omitindo ADN alvo ou incluindo um inibidor de integrase (por exemplo, raltegravir) são recomendados reacções de controlo.
  3. Parar a reacção por adição de IVI de SDS, EDTA e proteinase K para concentrações finais de 0,5%, 8 mM e 0,5 mg / mL, respectivamente. Misturar os conteúdos da reacção bem e incubar durante a noite a 56 ° C.
  4. No dia seguinte, purificar o ADN total a partir da reacção IVI por extracção com fenol / clorofórmio e precipitação com etanol. Realizar todas as etapas de centrifugação a 16.000 xg e RT.
  5. Adicionar um volume igual de fenol com a amostra desproteinizado, mistura-se vigorosamente por vortex e centrifugação durante 2 min. Cuidadosamente remover a fase aquosa superior e transferi-lo para um tubo fresco.
  6. Repita o passo 5.5. Transferir a fase aquosa superior para um tubo fresco.
  7. Adicionar um volume igual de 1: 1 fenol: mistura de clorofórmio, mistura-se vigorosamente por vortex, centrifugação e foR 2 min. Transferir a fase aquosa superior para um tubo fresco.
  8. Adicionar um volume igual de clorofórmio, mistura-se vigorosamente em vortex, e centrifuga-se durante 2 min. Transferir a fase aquosa superior para um tubo fresco.
  9. Para precipitar o DNA, adicionar glicogénio a uma concentração final de 0,1 mg / mL, 3 M de acetato de sódio a uma concentração final de 0,3 M e 2,5 volumes de etanol a 100% (arrefecido com gelo). Vortex para misturar, brevemente centrífuga para recolher o conteúdo, e colocar o tubo à temperatura de -80 ° CO / N.
  10. No dia seguinte, centrifugar a amostra durante 30 min a 16000 xg e 4 ° C durante 30 min. Remova cuidadosamente o sobrenadante sem perturbar o sedimento.
  11. Adicionar 500 ul de etanol a 80% (arrefecido com gelo) ao sedimento e centrifuga-se a 16.000 xg e 4 ° C durante 10 min. Secar o sedimento de DNA à TA e ressuspender completamente em 50 ul de água isenta de nuclease. Armazenar as amostras de ADN a -20 ° C.

6. Os ensaios de PCR para quantificar PIC Atividade

  1. Realizar a primeira ronda de PCR convencional utilizando iniciadores de segmentação da LTR viral e o ADN phiX174 (iniciadores LTR e phiX174, respectivamente) para amplificar as junções do ADN integrado de HIV-1.
    1. Monte da mistura de PCR da primeira rodada tal como descrito na Tabela 3. Montar uma mistura principal de todos os componentes, excluindo o ADN molde, dispensar-se alíquotas de 45 uL para dentro de tubos de PCR separadas, e adicionam-se 5 ul de DNA molde ou água livre de nuclease (controlo).
    2. Executar PCR num termociclador utilizando as condições de ciclos térmicos recomendadas na Tabela 4.
  2. Realizar a segunda rodada qPCR utilizando iniciadores que ladeiam uma pequena região do LTR viral (LTR-R e primers LTR-U) para amplificar seletivamente as sequências vDNA integrados do primeiro-round produtos de PCR. Para determinar os números de cópias integradas vDNA, gerar uma curva padrão, utilizando 10x diluições em série de números de cópias conhecidos (por exemplo, 10 0 - 10 8) do clone molecular de VIH-1.
    1. Montar a mistura qPCR segunda rodada, conforme descrito na Tabela 5. Montar uma mistura principal de todos os componentes, excluindo o ADN molde, cuidadosamente dispensar 25 mL alíquotas para um número adequado de poços em um de 96 poços de PCR placa de reacção, e, em seguida, adicionam-se 5 mL da primeira ronda não purificada produtos de PCR ou água livre de nuclease (ao controle). Executar todas as reações de qPCR em triplicado.
    2. Carregar a placa de PCR para o equipamento de PCR em tempo real e efectuar qPCR utilizando as condições de ciclização recomendadas na Tabela 6.
    3. Analisar os dados utilizando um software adequado.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

O isolamento do VIH-1 PICs

Um esquema do protocolo usado para o isolamento de PICs do VIH-1 a partir de células SUP-T1 infectados de forma aguda é representada na Figura 1. Este protocolo é derivado a partir dos métodos descritos por Engelman et ai. 19, 20. PICs do VIH-1 são complexos nucleoproteicos que são montados em células infectadas e são compostos da vDNA transcrito reversamente, proteínas virais e factores celulares 19, 20. O método descrito neste relatório utiliza os extractos citoplasmáticos de células HIV-1 infectadas como fonte de actividade de integração associada-PIC.

Em integração actividade in vitro de PICs do VIH-1

Figura 2. Este método utiliza uma estratégia baseada-qPCR aninhada para medir a actividade associada IVI-PIC, e os procedimentos são adaptados, com modificações, a partir de protocolos publicados pelo laboratório Engelman 19, 20, 21. Neste método, a actividade de integração associada-PIC é iniciado, fornecendo um ADN alvo heterólogo linear 21, e os produtos de DNA resultantes desta reacção de integração são purificadas e utilizadas como material de partida para a quantificação baseado no PCR subsequente. Na primeira ronda de PCR convencional, as junções de ADN viral-alvo são amplificados utilizando iniciadores apropriados. Na segunda rodada qPCR, primers específicos de LTR são usadas para enriquecer especificamente a população vDNA do primeiro turno produtos de PCR. Por favor, veja o protocolo sexão para uma descrição detalhada deste método.

Os resultados representativos de um ensaio IVI realizada utilizando o HIV-1 PICs são mostrados na Figura 3. As células SUP-T1 (80 x 10 6 células / infecção) foram spinoculated com 30 ml de DNase 1 tratadas com VIH-1 (~ 50 ug de p24 equivalente) na ausência ou na presença de 1 uM de HIV-1 EM inibidor raltegravir em 480 xg e 25 ° C durante 2 h. As células foram subsequentemente cultivadas durante 5 h a 37 ° C e 5% de CO 2. PICs foram isolados como descrito na secção de protocolo. As reacções foram realizadas IVI, cada uma usando 200 ul de PICs e 600 ng de ADN alvo (um fragmento de DNA de 2 kb amplificado a partir de ADN phiX174 por PCR), a 37 ° C durante 45 min. As reacções foram desproteinizadas por tratamento com proteinase K na presença de SDS e EDTA a 56 ° CO / N. Os produtos da reacção foram extraídos duas vezes com fenol, uma vez com um fenol: clorofórmio (1: 1) mistura, e uma vezcom clorofórmio. Subsequentemente, o DNA foi precipitado de etanol na presença de sal e o glicogénio co-precipitante, e o sedimento de DNA foi lavado uma vez com etanol a 80%. O ADN purificado foi ressuspenso em 50 ul de água isenta de nuclease. Uma estratégia qPCR aninhado foi usada para determinar o número de vDNA integrado no ADN phiX174. Na primeira ronda de PCR convencional, os iniciadores complementares das sequências de DNA alvo e phiX174 região LTR virais foram usadas para amplificar as junções de ADN viral-alvo integrados a partir de 5 ul dos produtos de reacção de ADN integração. Na segunda rodada qPCR, primers LTR-abrangendo foram utilizados para amplificar exclusivamente as sequências de DNA específicas para o HIV a partir de 5 mL da primeira rodada produtos amplicon e de 10 diluições em série de números de cópias conhecidas (10 8 -10 0) do clone molecular de HIV-1 (Padrões).

Todas as reacções de qPCR foram realizadas em triplicado e os dados WERe analisados ​​utilizando software comercial. Os valores determinados a partir dos padrões foram representadas graficamente para gerar uma curva padrão, a partir dos quais os números de cópias integradas vDNA foram interpolados. As barras de erro representam os desvios padrão. Como mostrado na Figura 3, os PICs do VIH-1 integrar robustamente o vDNA associado ao ADN alvo (pista 5). Importante, a eficiência de PICs IVI foi grandemente reduzida em reacções suplementadas com o inibidor EM raltegravir (Pista 6). Isto atribui fortemente a actividade de integração medido neste ensaio anti-HIV-1 EM. Além disso, as reacções de controlo contendo lisados ​​citoplasmáticos de células não infectadas (pista 1), pics sozinho (pista 2), o ADN alvo sozinha (pista 3), e o tampão sozinho (pista 4) não mostrou qualquer actividade de integração. Além disso, o controle que excluídos Taq polimerase no primeiro ciclo de PCR (pista 7) não amplificam produtos de integração. Nomeadamente, os dados do PICs-alone controlo (pista 2) indicou que a estratégia aninhada específi qPCRcamente mede a vDNA integrada, mas não o vDNA associada à PIC. Colectivamente, estes dados demonstram a medição da actividade de integração associada-PIC.

figura 1
Figura 1: Representação esquemática do protocolo para a preparação de HIV-1 PICs. Por favor clique aqui para ver uma versão maior desta figura.

extractos citoplasmáticos contendo PICs são isolados a partir de células SUP-T1 HIV-1 infectadas. Estes PICs são utilizados como fonte de actividade de integração no ensaio de integração in vitro.

Figura 2
Figura 2: Representação esquemática da In Vitro m> Ensaio de Integração de PICs do VIH-1. Por favor clique aqui para ver uma versão maior desta figura.

Os ensaios de integração foram realizados in vitro, utilizando HIV-1 PICs e o alvo de ADN heterólogo phiX174. O ADN de VIH-1 integrado foi medida através de uma estratégia de PCR aninhada, em que o primeiro ciclo de PCR convencional amplifica as junções de integração a partir dos quais as sequências específicas-vDNA são preferencialmente amplificados numa segunda ronda qPCR.

Figura 3
Figura 3: HIV-1 PIC-associado atividade de integração vDNA. Por favor clique aqui para ver uma versão maior desta figura.

"FO: manter-together.within-page =" 1 "> Os resultados representativos do ensaio de actividade de integração do HIV-1 PIC-associados Os vDNA integrados copiar números foram determinados traçando os valores derivados de uma curva padrão gerada utilizando diluições em série de 10x. números de cópias conhecidos de um clone molecular de HIV-1. Todas as reacções foram realizadas em triplicado e os dados foram analisados ​​utilizando o software comercial. as barras de erro representam os desvios padrão.

Componente estoque O volume final de reacção de 50 ul
DNA de plasmídeo phiX174 10 ng / mL 5,0 mL
tampão de reacção GoTaq 5x 10,0 mL
mix de nucleotídeos dNTP 10 mm em cada 1,0 mL
phiX174-F iniciador 10 μm 2,5 mL
phiX174-R iniciador 10 μm 2,5 mL
GoTaq ADN Polimerase (5 U / uL) 0,25 mL
água destilada livre de nuclease - 28.75 mL

Tabela 1.

95 ° C = 2 min
Ciclo 34 repetições de:
95 ° C = 30 s
53 ° C = 30 s
72 ° C = 2 min
72 ° C = 10 min
4 ° C = Reter

Mesa 2.

Componente estoque O volume final de reacção de 50 ul
produto de DNA reacção IVI - 5,0 mL
tampão de reacção GoTaq 5x 10,0 mL
mix de nucleotídeos dNTP 10 mm em cada 1,0 mL
LTR iniciador 10 μm 2,5 mL
phiX174 iniciador 10 μm 2,5 mL
GoTaq ADN Polimerase (5 U / uL) 0,25 mL
água destilada livre de nuclease - 28.75 mL

Tabela 3.

95 ° C = 5 min
Ciclo 23 repetições de:
94 ° C = 30 s
55 ° C = 30 s
72 ° C = 4 min
72 ° C = 10 min
4 ° C = Reter

Tabela 4.

<td> Probe Taqman
Componente estoque O volume final de reacção de 30 ul
1 produtos de PCR rodada st - 5,0 mL
LTR-R iniciador 10 μm 0,9 mL
LTR-L iniciador 10 μm 0,9 mL
10 μm 0,3 mL
iQ Supermix 2x 15,0 mL
água destilada livre de nuclease - 7,9 mL

Tabela 5.

95 ° C = 3 min
Ciclo 39 repetições de:
94 ° C = 15 s
58 ° C = 30 s
72 ° C = 30 s
placa Leia

Tabela 6.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

análises bioquímicas de PICs retrovirais têm proporcionado uma visão crítica sobre o mecanismo de integração do DNA retroviral. Medição da actividade de integração de PICs retrovirais pode ser conseguida por ensaio de placas de formação, a análise de mancha de Southern, e nested qPCR. A estratégia experimental do ensaio de placa é trabalhoso e utiliza um método indirecto para medir a integração 6, 7, 18. Integração ensaios medida baseada Southern blot diretamente, mas exigem quantidades relativamente altas de PICs 6, 7, 18.

Este relatório detalha uma estratégia qPCR aninhada para medir a atividade de integração do HIV-1 associada a PIC in vitro. A grande vantagem e significado deste método é a exigência de quantidades relativamente baixas de preparação PIC por reacção de 4, 5, 19. Os passos mais importantes do método são a geração de um vírus de título elevado de infecção e o manuseamento de preparação PIC. Deve notar-se aqui que o primeiro ciclo de PCR envolve a amplificação exponencial das junções de integração. Consequentemente, os números de cópias de integrada vDNA determinados na segunda rodada qPCR são semi-quantitativa e, portanto, têm a limitação de não dar uma medida de cópias vDNA associada à PIC. No entanto, o vDNA associada-PIC pode ser determinada por qPCR do ADN purificado a partir de PICs com primers específicos de LTR. A razão entre os números de cópias integradas vDNA ao vDNA associada-PIC correspondente pode fornecer informações sobre a eficiência da integração de uma reacção in vitro na integração. Este método pode ser modificado através da incorporação de outro ADN heteróloga alvo de escolha e outros iniciadores para detectar a integração em ambas as orientações. Em resumo, o métododescrito aqui mede a actividade de integração de PICs do VIH-1 quantitativamente e pode ser adoptado para a investigação desenvolvimento de uma compreensão dos detalhes bioquímicos da integração retroviral.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Os autores declaram não competindo interesses financeiros e não financeiros.

Acknowledgments

Este trabalho é parcialmente apoiada por doações DA024558, DA30896, DA033892 e DA021471 do NIDA / NIH para CD. Reconhecemos também o G12MD007586 concessão RCMI, o Vanderbilt CTSA conceder UL1RR024975, o Meharry Translational Research Center (MeTRC) CTSA U54 concessão RR026140 do NCRR / NIH, o MD007593 concessão U54 do NIMHD / NIH, eo Tennessee CFAR P30 concessão AI110527.

Materials

Name Company Catalog Number Comments

Fetal Bovine Serum (FBS)

GIBCO/Invitrogen

10437-028

Heat-inactivated Fetal Bovine Serum (Hi-FBS)

GIBCO/Invitrogen

10438-026

Dulbecco’s modified Eagle’s medium (DMEM)

GIBCO/Invitrogen

11995-065

Roswell Park Memorial Institute (RPMI) 1640 medium

GIBCO/Invitrogen

11875-093

Phosphate-buffered Saline (PBS) (1x)

GIBCO/Invitrogen

20012-027

Trypsin-EDTA (0.25%)

GIBCO/Invitrogen

25200-056

Penicillin-Streptomycin solution (100x)

Cellgro/Mediatech

30-002-CI

HEK293T cells (293T)

American Type Culture Collection (ATCC)

CRL-3216

HIV-1 proviral molecular clone pNL4-3

NIH AIDS Research and Reference Reagent Program

114

PolyFect transfection reagent

Qiagen

301107

DNase 1

Calbiochem/Merckmillipore

260913

Sup-T1 cells

American Type Culture Collection (ATCC)

CRL-1942

HEPES pH 7.2 - 7.5

(ready-to-use solution)

GIBCO/Invitrogen

15630-080

Potassium chloride (KCl) solution

Sigma-Aldrich

60142

Magnesium chloride (MgCl2) solution

Sigma-Aldrich

M1028

Dithiothreitol (DTT)

Sigma-Aldrich

43815

Aprotinin

Sigma-Aldrich

A6106

Digitonin

Sigma-Aldrich

D141

RNase A

Invitrogen

12091-021

Sucrose

Sigma-Aldrich

S0389

phiX174 Replicative Form 1 DNA

Promega

D1531

PhiX174-F primer:

5’-CGCTTCCATGACGCAGAAGTT-3’

PhiX174-R primer:

5’-CACTGACCCTCAGCAATCTTA-3’

Invitrogen and/or IDT-DNA

dNTP mix

Promega

U1515

Go Taq DNA Polymerase

Promega

M3005

Qiaquick gel extraction kit

Qiagen

28706

Ultrapure distilled water

Invitrogen

10977-015

Tris-EDTA (TE) buffer (100x)

Sigma-Aldrich

T9285

Sodium Dodecyl Sulphate (SDS)

Sigma-Aldrich

L3771

Ethylenediamine tetraacetic acid, disodium salt (EDTA) solution, 0.5 M, pH 8.0

Sigma-Aldrich

E7889

Proteinase K (20 mg/mL ready-to-use solution)

Qiagen

19131

Phenol (equilibrated with 10 mM Tris HCl, pH 8.0 and 1 mM EDTA)

Sigma-Aldrich

P4557

Chloroform

Sigma-Aldrich

288306

Glycogen (5 mg/mL solution)

Ambion/Invitrogen

AM9510

Sodium acetate (3 M, pH 5.2)

Sigma-Aldrich

S7899

Ethanol

Sigma-Aldrich

E7023

First round LTR primer:

5’-GTGCGCGCTTCAGCAAG-3’

First round phiX174 primer:

5’-CACTGACCCTCAGCAATCTTA-3’

Invitrogen and/or IDT-DNA

---

Second round LTR-R primer:

5’-TCTGGCTAACTAGGGAACCCA-3’

Second round LTR-U primer:

5’-CTGACTAAAAGGGTCTGAGG-3’

Second round Taqman probe:

 5’-6- FAM/TTAAGCCTCAATAAAGCTTGC

CTTGAGTGC/6-TAMRA/-3’

Invitrogen and/or IDT-DNA

---

iQ Supermix

Bio-Rad

170-8862

DOWNLOAD MATERIALS LIST

References

  1. Sattentau, Q. J., Weiss, R. A. The CD4 antigen: physiological ligand and HIV receptor. Cell. 52, (5), 631-633 (1988).
  2. Wilen, C. B., Tilton, J. C., Doms, R. W. Molecular mechanisms of HIV entry. Adv Exp Med Biol. 726, 223-242 (2012).
  3. Bowerman, B., Brown, P. O., Bishop, J. M., Varmus, H. E. A nucleoprotein complex mediates the integration of retroviral DNA. Genes Dev. 3, (4), 469-478 (1989).
  4. Bukrinsky, M. I., Sharova, N., Dempsey, M. P., et al. Active nuclear import of human immunodeficiency virus type 1 preintegration complexes. Proc Natl Acad Sci. 9, (14), 6580-6584 (1992).
  5. Hansen, M. S., Smith, G. J. 3rd, Kafri, T., Molteni, V., Siegel, J. S., Bushman, F. D. Integration complexes derived from HIV vectors for rapid assays in vitro. Nature biotechnol. 17, (6), 578-582 (1999).
  6. Farnet, C. M., Haseltine, W. A. Integration of human immunodeficiency virus type 1 DNA in vitro. Proc Natl Acad Sci. 87, (11), 4164-4168 (1990).
  7. Fujiwara, T., Mizuuchi, K. Retroviral DNA integration: structure of an integration intermediate. Cell. 54, (4), 497-504 (1988).
  8. Brown, P. O., Bowerman, B., Varmus, H. E., Bishop, J. M. Correct integration of retroviral DNA in vitro. Cell. 49, (3), 347-356 (1987).
  9. Lewinski, M. K., Bushman, F. D. Retroviral DNA integration--mechanism and consequences. Adv Genet. 55, 147-181 (2005).
  10. Engelman, A., Mizuuchi, K., Craigie, R. HIV-1 DNA integration: mechanism of viral DNA cleavage and DNA strand transfer. Cell. 67, (6), 1211-1221 (1991).
  11. Goff, S. P. Genetics of retroviral integration. Ann rev gen. 26, 527-544 (1992).
  12. Panganiban, A. T., Temin, H. M. The terminal nucleotides of retrovirus DNA are required for integration but not virus production. Nature. 306, (5939), 155-160 (1983).
  13. Bieniasz, P. D. The cell biology of HIV-1 virion genesis. Cell host microbe. 5, (6), 550-558 (2009).
  14. Sherman, P. A., Fyfe, J. A. Human immunodeficiency virus integration protein expressed in Escherichia coli possesses selective DNA cleaving activity. Proc Natl Acad Sci. 87, (13), 5119-5123 (1990).
  15. Katzman, M., Katz, R. A., Skalka, A. M., Leis, J. The avian retroviral integration protein cleaves the terminal sequences of linear viral DNA at the in vivo sites of integration. J Virol. 63, (12), 5319-5327 (1989).
  16. Craigie, R., Mizuuchi, K., Bushman, F. D., Engelman, A. A rapid in vitro assay for HIV DNA integration. Nucl acid res. 19, (10), 2729-2734 (1991).
  17. Bushman, F. D., Craigie, R. Activities of human immunodeficiency virus (HIV) integration protein in vitro: specific cleavage and integration of HIV DNA. Proc Natl Acad Sci. 88, (4), 1339-1343 (1991).
  18. Pauza, C. D. Two bases are deleted from the termini of HIV-1 linear DNA during integrative recombination. Virology. 179, (2), 886-889 (1990).
  19. Engelman, A. Isolation and analysis of HIV-1 preintegration complexes. Meth Mol Biol. 485, 135-149 (2009).
  20. Engelman, A., Oztop, I., Vandegraaff, N., Raghavendra, N. K. Quantitative analysis of HIV-1 preintegration complexes. Methods. 47, (4), 283-290 (2009).
  21. Addai, A. B., Pandhare, J., Paromov, V., Mantri, C. K., Pratap, S., Dash, C. Cocaine modulates HIV-1 integration in primary CD4+ T cells: implications in HIV-1 pathogenesis in drug-abusing patients. J Leuk Biol. 97, (4), 779-790 (2015).
  22. Wehrly, K., Chesebro, B. p24 antigen capture assay for quantification of human immunodeficiency virus using readily available inexpensive reagents. Methods. 12, (4), 288-293 (1997).
Medição de<em&gt; In Vitro</em&gt; Actividade integração do HIV-1 de pré-integração Complexos
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Balasubramaniam, M., Davids, B., Addai, A. B., Pandhare, J., Dash, C. Measurement of In Vitro Integration Activity of HIV-1 Preintegration Complexes. J. Vis. Exp. (120), e54581, doi:10.3791/54581 (2017).More

Balasubramaniam, M., Davids, B., Addai, A. B., Pandhare, J., Dash, C. Measurement of In Vitro Integration Activity of HIV-1 Preintegration Complexes. J. Vis. Exp. (120), e54581, doi:10.3791/54581 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter