Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

Medida de doi: 10.3791/54581 Published: February 22, 2017

Abstract

proteínas del VIH-1 del sobre se involucran receptores afines en la superficie de células diana, lo que conduce a la fusión de membranas de células viral seguido por la liberación del núcleo de la cápside viral (CA) en el citoplasma. Posteriormente, el viral transcriptasa inversa (RT), como parte de un complejo de nucleoproteína homónimo denomina la transcripción inversa Complex (RTC), convierte el genoma de ARN de una sola hebra viral en una copia de ADN de doble cadena (ADNv). Esto conduce a la biogénesis de otro complejo de nucleoproteína, llamado el complejo de pre-integración (PIC), compuesto por el vDNA y proteínas del virus asociados y los factores del huésped. La integrasa viral PIC-asociado (IN) orquesta la integración del ADNv en el ADN cromosómico del huésped en un proceso de dos pasos regulado temporal y espacialmente. En primer lugar, en los procesos de la los extremos 3 'de la ADNv en el citoplasma y, segundo, después de que el PIC trafica al núcleo, que media la integración del ADNv procesado en el ADN cromosómico. Los PIC aisladosde las células diana infectadas de forma aguda con VIH-1 son funcionales in vitro, ya que son competentes para integrar el ADNv asociado en un ADN diana heterólogo añadido exógenamente. Tal integración en ensayos in vitro basados en PIC han contribuido significativamente a delinear los detalles de la mecánica de la integración retroviral y para el descubrimiento de inhibidores de la IN. En este informe, se elabora sobre un ensayo de VIH-1 PIC actualizada que emplea una estrategia basada en anidada en tiempo real de reacción en cadena de la polimerasa cuantitativa (qPCR) para medir la actividad de integración in vitro de los PIC nativas aisladas.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

VIH-1 de replicación en la célula diana implica varios pasos, en términos generales, agrupadas en dos fases: eventos tempranos y tardíos. Los primeros eventos comienzan cuando el VIH-1 secuencialmente une a la superficie de la célula diana receptor CD4 y uno de los dos co-receptores (CCR5 o CXCR4) 1. En consecuencia, el fusible membranas virus-célula, y la cápside viral (CA) de núcleo se libera en el citoplasma 2. El núcleo CA contiene el ARN viral genómico de cadena sencilla (ssRNA) y varias proteínas, tanto virales y celulares de origen. Las proteínas virales CA-asociados incluyen la transcriptasa inversa (RT) y la integrasa (IN), dos enzimas que median pasos críticos durante los primeros eventos en la replicación viral. El RT y EN la función en el contexto de complejos de nucleoproteína, a saber, la transcripción inversa Complex (RTC) y el complejo de pre-integración (PIC), respectivamente 3, 4, 5 <sup>, 6. Los extremos del genoma viral de ARN de cadena simple terminal del puerto de repetición (R) elementos adyacentes a la U5 secuencias únicas (en el extremo 5 ') y U3 (en el extremo 3'). El RTC convierte el genoma ARN de cadena simple viral en un (ds) de copias de ADN de doble cadena (ADNv). Este proceso de transcripción inversa también da lugar a la duplicación de las secuencias U5 y U3, generando así repeticiones terminales largas (LTR) en ambos extremos de la ADNv 7, 8. Posteriormente, el IN PIC-asociado cataliza dos reacciones bioquímicas secuenciales que permiten la integración de la ADNv en el cromosoma huésped 9, 10, 11. En primer lugar, en el citoplasma, IN multímeros participar ambas LTRs 12 y escindir un dinucleótido de cada uno de los extremos 3'-terminales. Este procesamiento extremo 3 'genera un grupo hidroxilo en cada extremo 3' (CA OH) de la ADNv.A continuación, PIC trafica al núcleo, en el que en el ADNv utiliza CA OH como nucleófilo para cortar ambas cadenas del ADN cromosómico de una manera escalonada. Simultáneamente, en empalmes coordinadamente ambos extremos del ADNv a los enlaces fosfodiéster resultantes en cadenas opuestas del ADN cromosómico. Después de esta etapa de transferencia de cadena, la maquinaria de la célula huésped elimina los dos nucleótidos no apareados en los extremos 5 'de la vDNA y reparaciones de las brechas de cadena sencilla consiguientes en la unión del sitio de integración. Así, los primeros eventos culminan con la creación de una copia de ADN integrado (provirus) del genoma del VIH-1. El provirus proporciona un entorno adecuado para la expresión génica viral eficiente, que inicia los eventos posteriores, incluyendo la expresión de las proteínas codificadas por el virus; ensamblaje del virus inmaduro; y en ciernes, la liberación y la maduración en viriones infecciosos 13.

Retroviral recombinante purificada EN es competente parallevar a cabo, in vitro, tanto en las actividades de procesamiento y el capítulo de transferencia del extremo 3 'de ADN exógena suministrados sustrato LTR-similares. Los estudios bioquímicos utilizando dicha purificado en recombinante han puesto de manifiesto los aspectos críticos de la integración ADNv 14, 15, 16, 17. Sin embargo, a diferencia de la infección natural, esta reacción bioquímica in vitro no es compatible con la integración concertada de ambos extremos del sustrato de ADN en el ADN objetivo. Por el contrario, PICs retrovirales aisladas de células infectadas de forma aguda se integran concertada ambos extremos de la ADNv endógeno en el ADN diana heterólogo. Esto condujo a la adopción generalizada y posteriores refinamientos de ensayos in vitro de Integración (IVI) E n el uso de los PIC nativas aisladas.

En la primera informado ensayo retroviral IVI, extractos citoplasmáticos de células infectadas con un recombinante murinoVirus de la leucemia (MLV) que alberga el gen E. coli supF en su LTR sirvió como la fuente de la actividad de IN, y el ADN de un fago lambda mutante defectuoso en el crecimiento lítico fue suministrado exógenamente como el ADN diana. La integración exitosa del ADN recombinante MLV copia en el ADN del fago y la consiguiente p F expresión condujo a la restauración de la capacidad formadora de placa de los fagos recombinantes. Sin embargo, esta estrategia experimental es laborioso y medidas de integración de una manera indirecta. Para hacer frente a estas advertencias, un ensayo de marcaje terminal indirecto basado en la transferencia de Southern, que cuantifica la actividad IVI PIC-asociado como una medida de la ADNv endógeno integrado en el ADN exógeno phiX174 bacteriófago linealizado, se desarrolló 6, 7, 18. Aunque este método proporciona una medida directa de eventos de integración, se requieren cantidades relativamente altas de preparación PIC, que sigue siendo un desafío técnicoesfuerzo. Para evitar esto, ensayos basados en PCR anidados que requieren sólo cantidades modestas de PICs se desarrollaron 4, 5, 19.

En este informe se describe una versión actualizada de una PCR anidada-basado en el método in vitro ideado para recapitular la actividad de integración mediada PIC VIH-1 se produce durante la infección natural. Este método utiliza los extractos citoplasmáticos de las células diana infectadas por VIH-1 como fuente de actividad endógena PIC, que se mide con un tiempo real de la polimerasa cuantitativa reacción en cadena (qPCR). Los procedimientos para el aislamiento de los PIC y la medición de sus actividades de integración se adaptan, con modificaciones, a partir de los protocolos publicados por el laboratorio Engelman 20. En este método, la actividad de integración PIC-asociado se inicia proporcionando una diana de ADN exógeno lineal 21, y los productos de ADN resultantes deesta reacción integración se purifican y se utiliza como material de partida para la cuantificación basada en la PCR subsiguiente. En la primera ronda de PCR convencional, las uniones de ADN viral diana se amplifican mediante el uso de cebadores apropiados. En la segunda ronda qPCR, cebadores LTR-específicos se utilizan para enriquecer específicamente a la población a partir de los vDNA primera ronda productos de PCR. Por favor, vea la sección de protocolo para una descripción detallada de este método.

Los estudios in vitro con PICs retrovirales han dado lugar a avances significativos en nuestra comprensión del mecanismo de integración del ADN retroviral y en el desarrollo de inhibidores de la IN. Sobre la base de la reciente mayor enfoque en la cartografía del VIH-1 sitios de integración, la determinación del papel de los factores virales y del huésped en el VIH-1 la integración y desarrollo de nuevos fármacos antivirales para combatir la resistencia a los medicamentos, prevemos un aumento del interés y el uso generalizado de los ensayos de IVI , como el descrito en este informe. Esto, a su vez, dará lugar afuturas mejoras en el método, diversificando de esta manera el alcance de sus aplicaciones.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Virus de Producción

NOTA: Para generar altos títulos de VIH-1 infeccioso, transfectar la línea celular de riñón embrionario humano (HEK) 293T con un clon molecular infeccioso de VIH-1 usando un reactivo de transfección a base de dendrímero activado. Se ha observado que el método de fosfato de calcio transfección produce resultados comparables.

  1. En un laboratorio de bioseguridad de nivel 2 (BSL2), semilla de 3 x 10 6 293T células por placa de 10 cm en 8 ml de de Eagle modificado por Dulbecco (DMEM) suplementado con 10% suero bovino fetal (FBS), penicilina, y estreptomicina. Cultivar las células en un incubador a 37 ° C y 5% de CO 2 O / N.
  2. El día siguiente, para la transfección de células en cada placa de 10 cm, diluir 8 g de plásmido ADN pNL4-3 (ver Tabla de Materiales) a un volumen final de 300 l de DMEM carente de suero y antibióticos. Añadir 80 l de la reactivo de transfección, mezclar bien pipeteando, y se incuba a TA durante5-10 min para la formación de complejos de transfección.
  3. Retire el medio de las placas por aspiración y 7 ml por placa de DMEM fresco que contenía suero y antibióticos.
  4. Añadir 1 ml de DMEM que contenía suero y antibióticos para el complejo de transfección, mezclar con la pipeta, y añadir esta mezcla a las células. Hacer girar suavemente el plato para facilitar la distribución uniforme de los complejos de transfección.
  5. Inmediatamente transferir las células al laboratorio BSL3, lugar en un incubador a 37 ° C y 5% de CO 2, y cultivar las células durante 48 h.
  6. Recoger el sobrenadante de cultivo de tejidos que contiene el virus con una pipeta y luego transferirlo a un tubo de centrífuga. Se centrifuga a 300 g durante 5 min para sedimentar las células y los residuos, y después se filtra el sobrenadante a través de un filtro de jeringa de 0,45 micras de tamaño de poro.
  7. Para eliminar cualquier ADN plásmido remanente en esta preparación de virus libre de células, el tratamiento con DNasa 1 (20 mg / ml) a 37 ° C durante 1 h.
  8. Para cuantificar laVIH-1 título, utilice el ensayo de inmunoabsorción ligado a enzimas p24-específico (ELISA), ya que es un método rápido y susceptible para el uso rutinario 22.
    NOTA: Se debe señalar que la p24 ELISA mide el título físico (número de partículas de virus). Como alternativa, la medición de la actividad asociada al virus RT (RT ensayo exógena) o la infectividad del virus (ensayos de infectividad basados ​​en la línea celular indicadora TZM-bl) proporcionará lectura exclusiva de partículas virales infecciosas.

2. infección por el virus de las células Sup-T1 (NBS3 Lab)

  1. En un laboratorio BSL2, mantener las células Sup-T1 entre 1,0 x 10 6 y 2,0 x 10 6 células / ml en Roswell Park Memorial Institute (RPMI) complementado con 10% FBS inactivado por calor, penicilina y estreptomicina (relación de división de 1 : 2 cada 2 - 3 d). Se combinan las células Sup-T1 a partir de los frascos de cultivo, mezclar bien con la pipeta, y determinar el recuento de células viables utilizando un hemocitómetro y la exclusión de azul de tripano staining método.
    1. Prepare el número necesario de alícuotas de 80 x 10 6 células (por infección por el virus) en 50 ml tubos cónicos de centrífuga.
    2. Centrifugar las células en un rotor oscilante-cubo en 500 xg y 25 ° C durante 5 min. Sin retirar el medio de cultivo celular, la transferencia de los tubos que contienen células sedimentadas al laboratorio BSL3 para su posterior procesamiento. aspirar cuidadosamente el medio de cultivo celular a partir de tubo sin alterar el sedimento celular.
  2. Añadir una cantidad apropiada de inóculo de virus tratado con DNasa I a las células en el tubo y mezclar bien pipeteando suavemente. Durante 80 x 10 6 células, utilizar 30 ml de virus tratado con DNasa I (50 g de virus de la p24-equivalente).
    NOTA: El aislamiento de PICs funcional requiere la infección de las células diana con muy altas multiplicidades de infección (MOI).
  3. Distribuir la mezcla en partes iguales entre dos placas de cultivo de tejidos de 6 pocillos (es decir, 12 x alícuotas de 2.5 mL, el uso de 2 planchas por Infection).
  4. Para espinoculación, colocar las placas de cultivo en portadores de placas y de centrífuga usando un rotor de cubeta oscilante a 480 xg y 25 ° C durante 2 h.
  5. Se incuban las células spinoculated a 37 ° C y 5% de CO2 durante 5 h.

3. La recolección y lisis de las células infectadas (laboratorio NBS3)

  1. Reunir las células correspondientes a cada infección de las placas de cultivo en un tubo de 50 ml de centrífuga cónico (~ 30 ml en total).
  2. Recoger las células por centrifugación a 300 xg y 25 ° C durante 10 min. aspirar cuidadosamente el sobrenadante del tubo (alternativamente, utilizar una pipeta).
  3. Para eliminar las partículas virales residuales, lavar cada sedimento celular mediante la adición de 2 ml de tampón de K - / - (KCl 150 mM, HEPES 20 mM, pH 7,6, 5 mM MgCl 2) y centrifugando la muestra a 300 xg y 25 ° C durante 10 minutos. Entonces, sin alterar el sedimento, retirar con cuidado el sobrenadante por aspiración o mediante el uso de una pipeta.
  4. REPEAt paso 3.3.
  5. Con cuidado, retire cualquier tampón residual mediante el uso de una micropipeta. Resuspender cada sedimento de células en 2 ml de helado de tampón de lisis K + / + (tampón K - / - suplementado con 0,025% de digitonina, DTT 1 mM, 20 mg / ml de aprotinina), mezclar el contenido por pipeteo suave, y la transfiere a una 2 ml tubo de microcentrífuga.

4. Preparación de los PIC citoplasmáticos (laboratorio NBS3)

  1. Roca las muestras en un agitador rotatorio a TA durante 10 min.
  2. Centrifugar las muestras, con el rotor enfriado previamente a 4 ° C, a 1500 xg y 4 ° C durante 4 min.
  3. Sin perturbar el sedimento, transferir cuidadosamente el sobrenadante a un tubo de microcentrífuga nuevo y se centrifuga a 16.000 xg y 4 ° C durante 1 min.
  4. transferir con cuidado el sobrenadante a un tubo de microcentrífuga nuevo. Añadir RNasa A (20 mg / ml) a una concentración final de 20 mg / ml (2 l durante 2 ml de PICs) y se incuba el contenido a temperatura ambiente durante 30 min (sin balanceo). </ Li>
  5. Añadir sacarosa (60% w / v en tampón K - / -) a una concentración final de 7% y mezclar bien pipeteando suavemente. Preparar alícuotas (por ejemplo, 200 l) de los PICs en tubos de microcentrífuga, flash-congelación en nitrógeno líquido, y colocar en un congelador -80 ° C para el almacenamiento a largo plazo.

5. Integración In Vitro (IVI) ensayos que utilizan VIH-1 PICs

  1. Preparar el ADN diana usado en el ensayo IVI mediante la amplificación de una región de 2,0 kb a partir del plásmido de ADN phiX174 con PCR usando los cebadores a medida, phiX174-F y phiX174-R.
    1. Montar la mezcla de PCR como se describe en la Tabla 1. Realizar PCR en un ciclador térmico usando las condiciones de ciclos térmicos recomendados en la Tabla 2. Gel-purificar el producto de la PCR usando un kit de purificación en gel (siguiendo el protocolo recomendado por el fabricante), y almacenar el ADN diana purificada como alícuotas a -80 ° C hasta su uso.
  2. Añadir 600 ng de ADN diana de 200 - & #181; L alícuota de los PIC, se mezcla bien y se incuba a 37 ° C durante 45 minutos.
    Nota: Las reacciones IVI omitiendo ADN diana o incluyendo un inhibidor de la integrasa (por ejemplo, raltegravir) se recomiendan las reacciones de control.
  3. Detener la reacción mediante la adición de IVI SDS, EDTA y proteinasa K a concentraciones finales de 0,5%, 8 mM, y 0,5 mg / ml, respectivamente. Mezclar los contenidos de la reacción a fondo y incubar durante la noche a 56 ° C.
  4. El día siguiente, purificar el ADN total de la reacción IVI mediante extracción con fenol / cloroformo y precipitación con etanol. Llevar a cabo todas las etapas de centrifugación a 16.000 xg y RT.
  5. Añadir un volumen igual de fenol a la muestra desproteinizado, mezclar vigorosamente por agitación, y se centrifuga durante 2 min. Retire cuidadosamente la fase acuosa superior y la transfiere a un tubo nuevo.
  6. Repita el paso 5.5. Transferir la fase acuosa superior a un tubo nuevo.
  7. Añadir un volumen igual de 1: 1 de fenol: cloroformo mezcla, mezclar enérgicamente con el vórtex y centrifugar for 2 min. Transferir la fase acuosa superior a un tubo nuevo.
  8. Añadir un volumen igual de cloroformo, la mezcla vigorosamente por agitación, y se centrifuga durante 2 min. Transferir la fase acuosa superior a un tubo nuevo.
  9. Para precipitar el ADN, añadir glucógeno a una concentración final de 0,1 g / l, 3 M de acetato de sodio a una concentración final de 0,3 M, y 2,5 volúmenes de etanol al 100% (enfriado en hielo). Mezclar en vórtex, centrifugar brevemente para recoger el contenido, y colocar el tubo a -80 ° CO / N.
  10. Al día siguiente, centrifugar la muestra durante 30 min a 16.000 xg y 4 ° C durante 30 min. Retirar con cuidado el sobrenadante sin perturbar el sedimento.
  11. Añadir 500 l de etanol al 80% (enfriado en hielo) al sedimento y se centrifuga a 16.000 xg y 4 ° C durante 10 min. El aire seco de la pastilla de ADN a temperatura ambiente y completamente volver a suspender en 50 l de agua libre de nucleasa. Almacenar las muestras de ADN a -20 ° C.

6. Las pruebas de PCR para cuantificar la actividad de CFP

  1. Realizar la primera ronda de PCR convencional utilizando cebadores dirigidos a la LTR viral y el ADN phiX174 (LTR y PhiX174 cebadores, respectivamente) para amplificar las uniones del VIH-1 de ADN integrado.
    1. Montar la mezcla de PCR de primera ronda como se describe en la Tabla 3. Montar una mezcla maestra de todos los componentes excluyendo el ADN molde, dispensar alícuotas de 45 mu l en tubos de PCR separadas, y añadir 5 l de ADN plantilla o agua libre de nucleasa (control).
    2. Realizar PCR en un ciclador térmico usando las condiciones de ciclos térmicos recomendados en la Tabla 4.
  2. Realice la qPCR segunda ronda usando cebadores que flanquean una región corta de la LTR viral (LTR-R y cebadores LTR-U) para amplificar selectivamente las secuencias vDNA integrados de la primera rodadaproductos und PCR. Para determinar los ADNv integrados número de copias, generar una curva estándar mediante el uso de 10x diluciones seriadas de número de copias conocidos (por ejemplo, 10 0 - 10 8) del clon molecular del VIH-1.
    1. Montar la mezcla de segunda ronda qPCR como se describe en la Tabla 5. Montar una mezcla maestra de todos los componentes excluyendo el ADN molde, cuidadosamente dispensar 25 alícuotas en el número apropiado de pozos en un pozo de 96 placa de reacción de PCR, y luego añadir 5 l de la no purificado de primera ronda de los productos de PCR o agua libre de nucleasa (controlar). Llevar a cabo todas las reacciones de qPCR por triplicado.
    2. Cargar la placa de PCR en tiempo real instrumento de PCR y qPCR realizar utilizando las condiciones de los ciclos recomendados en la Tabla 6.
    3. Analizar los datos utilizando un software adecuado.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Aislamiento de VIH-1 PICs

Un esquema del protocolo utilizado para el aislamiento de VIH-1 fotografías de células Sup-T1 infectadas de forma aguda se representa en la Figura 1. Este protocolo se deriva de los métodos descritos por Engelman et al. 19, 20. VIH-1 PICs son complejos de nucleoproteína que se ensamblan en las células infectadas y se componen de la vDNA a transcripción inversa, proteínas virales, y los factores celulares 19, 20. El método descrito en este informe utiliza los extractos citoplasmáticos de células infectadas por VIH-1 como fuente de actividad de integración PIC-asociado.

En la actividad in vitro de la integración del VIH-1 PICs

Figura 2. Este método utiliza una estrategia basada en PCR cuantitativa anidada para medir la actividad IVI PIC-asociado, y los procedimientos se adaptan, con modificaciones, a partir de los protocolos publicados por el laboratorio Engelman 19, 20, 21. En este método, la actividad de integración PIC-asociado se inicia proporcionando una diana de ADN heterólogo lineal 21, y los productos de ADN resultantes de esta reacción integración se purifican y se utilizan como material de partida para la cuantificación basada en la PCR subsiguiente. En la primera ronda de PCR convencional, los cruces de ADN viral diana se amplifica usando cebadores apropiados. En la segunda ronda qPCR, cebadores LTR-específicos se utilizan para enriquecer específicamente a la población a partir de los vDNA primera ronda productos de PCR. Por favor, véase el protocolo sreflexión para una descripción detallada de este método.

Los resultados representativos de un ensayo IVI realizaron con VIH-1 PICs se muestran en la Figura 3. Células SUP-T1 (80 x 10 6 células / infección) se spinoculated con 30 ml de DNasa 1 tratado con VIH-1 (~ 50 mg de equivalente de p24) en ausencia o presencia de 1 M de VIH-1 EN inhibidor de raltegravir en 480 xg y 25 ° C durante 2 h. Las células se cultivaron posteriormente durante 5 horas a 37 ° C y 5% de CO 2. PICs se aislaron como se describe en la sección de protocolo. Las reacciones se llevaron a cabo IVI, cada uno usando 200 l de PICs y 600 ng del ADN diana (un fragmento de ADN de 2 kb amplificado a partir de ADN phiX174 por PCR), a 37 ° C durante 45 min. Las reacciones se desproteinizado mediante tratamiento con proteinasa K en presencia de SDS y EDTA a 56 ° CO / N. Los productos de reacción se extrajeron dos veces con fenol, una vez con un fenol: cloroformo (1: 1) mezcla, y una vezcon cloroformo. Posteriormente, el ADN se precipitó con etanol en presencia de sal y el glucógeno co-precipitante, y el sedimento de ADN se lavó una vez con 80% de etanol. El ADN purificado se resuspendió en 50 l de agua libre de nucleasa. Se utilizó una estrategia de qPCR anidada para determinar el número de ADNv integrado en el ADN phiX174. En la primera ronda de PCR convencional, se utilizaron cebadores complementarios a las secuencias en el ADN diana phiX174 y la región LTR viral para amplificar las uniones integradas de ADN viral diana a partir de 5 l de los productos de ADN de la reacción de integración. En la segunda ronda qPCR, cebadores LTR-que abarcan se utilizaron para amplificar exclusivamente las secuencias de ADN específicas para el VIH de 5 l de los productos de la primera ronda de amplicón y de 10 veces diluciones seriadas de número de copias conocidas (8 10 -10 0) del clon molecular del VIH-1 (normas).

Todas las reacciones de qPCR se realizaron por triplicado y los datos were analizó utilizando un software comercial. Los valores derivados de las normas se representaron para generar una curva estándar, a partir de la cual los ADNv integrados número de copias se interpolaron. Las barras de error representan desviaciones estándar. Como se muestra en la Figura 3, los VIH-1 PICs integrar con firmeza la vDNA asociado en el ADN diana (Carril 5). Es importante destacar que la eficiencia de los PIC IVI se redujo en gran medida en las reacciones complementadas con el inhibidor EN raltegravir (carril 6). Este atributos fuertemente la actividad de integración medido en este ensayo para el VIH-1 EN. Además, las reacciones de control que contienen lisados ​​citoplásmicos de células no infectadas (carril 1), PICs solo (carril 2), se dirigen a ADN solo (carril 3), y tampón solo (carril 4) no mostraron ninguna actividad de integración. Además, el control que excluye Taq polimerasa en la primera ronda de PCR (carril 7) no amplificar productos de integración. En particular, los datos de la PIC-Alone control (carril 2) indicaron que la estrategia anidada específi qPCRcamente integrado mide la vDNA pero no el vDNA PIC-asociado. En conjunto, estos datos demuestran la medición de la actividad de integración PIC-asociado.

Figura 1
Figura 1: Representación esquemática del protocolo para la preparación del VIH-1 PIC. Haga clic aquí para ver una versión más grande de esta figura.

extractos citoplásmicos que contienen los PIC son aislados a partir de células Sup-T1 infectadas por VIH-1. Estos PICs se utilizan como la fuente de la actividad de integración en el ensayo de integración in vitro.

Figura 2
Figura 2: Representación esquemática de la in Vitro m> Integración de ensayo de VIH-1 PIC. Haga clic aquí para ver una versión más grande de esta figura.

Ensayos de integración se llevaron a cabo in vitro utilizando el VIH-1 y el objetivo PICs heteróloga de ADN phiX174. El ADN del VIH-1 integrado se midió mediante una estrategia de PCR anidada, en el que la primera ronda de PCR convencional amplifica las uniones de integración de la que las secuencias de ADNv-específicos son preferencialmente amplificados en un qPCR segunda ronda.

figura 3
Figura 3: El VIH-1-PIC asociado vDNA Integración actividad. Haga clic aquí para ver una versión más grande de esta figura.

"Fo: keep-together.within-page =" 1 "> Los resultados representativos del ensayo de actividad de la integración asociada-PIC VIH-1 Las ADNv integrados número de copias se determinaron mediante el trazado de valores derivados de una curva estándar generada utilizando diluciones en serie de 10 veces. números de copias conocidos de un clon molecular del VIH-1. Todas las reacciones se realizaron por triplicado y los datos se analizaron usando el software comercial. las barras de error representan desviaciones estándar.

Componente Valores El volumen final de reacción de 50 l
ADN plásmido phiX174 10 ng / l 5.0 l
tampón de reacción GoTaq 5x 10,0 l
mezcla de nucleótidos dNTP 10 mM de cada uno 1.0 l
phiX174-F imprimación 10 micras 2,5 l
imprimación phiX174-R 10 micras 2,5 l
GoTaq ADN polimerasa (5 U / l) 0,25 l
agua destilada libre de nucleasa - 28.75 l

Tabla 1.

95 ° C = 2 min
Ciclo de 34 repeticiones de:
95 ° C = 30 s
53 ° C = 30 s
72 ° C = 2 min
72 ° C = 10 min
4 ° C = Hold

Tabla 2.

Componente Valores El volumen final de reacción de 50 l
IVI producto de ADN de reacción - 5.0 l
tampón de reacción GoTaq 5x 10,0 l
mezcla de nucleótidos dNTP 10 mM de cada uno 1.0 l
cebador LTR 10 micras 2,5 l
imprimación phiX174 10 micras 2,5 l
GoTaq ADN polimerasa (5 U / l) 0,25 l
agua destilada libre de nucleasa - 28.75 l

Tabla 3.

95 ° C = 5 min
Ciclo de 23 repeticiones de:
94 ° C = 30 s
55 ° C = 30 s
72 ° C = 4 min
72 ° C = 10 min
4 ° C = Hold

Tabla 4.

<td> sonda TaqMan
Componente Valores El volumen final de reacción de 30 l
1 productos de PCR ronda st - 5.0 l
cebador LTR-R 10 micras 0,9 l
cebador LTR-U 10 micras 0,9 l
10 micras 0,3 l
iQ Supermix 2x 15,0 l
agua destilada libre de nucleasa - 7.9 l

Tabla 5.

95 ° C = 3 min
Ciclo de 39 repeticiones de:
94 ° C = 15 s
58 ° C = 30 s
72 ° C = 30 s
Leer la placa

Tabla 6.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Los análisis bioquímicos de los PIC retrovirales han proporcionado ideas fundamentales sobre el mecanismo de integración del ADN retroviral. Medición de la actividad de integración de PICs retrovirales se puede lograr mediante ensayo en placa formación, análisis de transferencia Southern, y anidada qPCR. La estrategia experimental de ensayo de placas es laborioso y utiliza un método indirecto para medir la integración 6, 7, 18. La integración de los ensayos de medida basada en el Southern blot directamente, sino que requieren cantidades relativamente altas de PICs 6, 7, 18.

Este informe detalla una estrategia anidada qPCR para la medición de VIH-1 actividad de integración PIC-asociado in vitro. La principal ventaja y la importancia de este método es el requisito de cantidades relativamente bajas de preparación PIC por reacción 4, 5, 19. Los pasos más críticos de este método son la generación de un virus de alto título para la infección y el manejo de la preparación de PIC. Cabe señalar aquí que la primera ronda de PCR implica la amplificación exponencial de las uniones de integración. En consecuencia, el número de copias de ADNv integrada determinados en la segunda ronda qPCR son semi-cuantitativa y, por lo tanto, tienen la limitación de no dar una medida de copias ADNv PIC-asociado. Sin embargo, el ADNv PIC-asociado puede ser determinada por qPCR del ADN purificado a partir de los PIC con cebadores LTR-específicos. La relación de las ADNv integrados copiar números a la correspondiente ADNv PIC-asociado puede proporcionar información acerca de la eficiencia de la integración de una reacción de integración in vitro. Este método puede ser modificado mediante la incorporación de otro ADN diana heteróloga de elección y otros cebadores para detectar la integración en ambas orientaciones. En resumen, el métododescrito aquí mide la actividad de integración de VIH-1 PICs cuantitativamente y se pueden adoptar para la investigación desarrollar una comprensión de los detalles bioquímicos de la integración retroviral.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Los autores declaran no tener intereses financieros y no financieros en competencia.

Acknowledgments

Este trabajo es apoyado en parte por subvenciones DA024558, DA30896, DA033892, y DA021471 del NIDA / NIH en un CD. También reconocemos la G12MD007586 subvención RCMI, el Vanderbilt CTSA conceder UL1RR024975, el Centro de Investigación traslacional Meharry (MeTRC) CTSA U54 subvención RR026140 de la CNRR / NIH, la MD007593 subvención U54 desde el NIMHD / NIH, y el AI110527 P30 subvención Tennessee CFAR.

Materials

Name Company Catalog Number Comments

Fetal Bovine Serum (FBS)

GIBCO/Invitrogen

10437-028

Heat-inactivated Fetal Bovine Serum (Hi-FBS)

GIBCO/Invitrogen

10438-026

Dulbecco’s modified Eagle’s medium (DMEM)

GIBCO/Invitrogen

11995-065

Roswell Park Memorial Institute (RPMI) 1640 medium

GIBCO/Invitrogen

11875-093

Phosphate-buffered Saline (PBS) (1x)

GIBCO/Invitrogen

20012-027

Trypsin-EDTA (0.25%)

GIBCO/Invitrogen

25200-056

Penicillin-Streptomycin solution (100x)

Cellgro/Mediatech

30-002-CI

HEK293T cells (293T)

American Type Culture Collection (ATCC)

CRL-3216

HIV-1 proviral molecular clone pNL4-3

NIH AIDS Research and Reference Reagent Program

114

PolyFect transfection reagent

Qiagen

301107

DNase 1

Calbiochem/Merckmillipore

260913

Sup-T1 cells

American Type Culture Collection (ATCC)

CRL-1942

HEPES pH 7.2 - 7.5

(ready-to-use solution)

GIBCO/Invitrogen

15630-080

Potassium chloride (KCl) solution

Sigma-Aldrich

60142

Magnesium chloride (MgCl2) solution

Sigma-Aldrich

M1028

Dithiothreitol (DTT)

Sigma-Aldrich

43815

Aprotinin

Sigma-Aldrich

A6106

Digitonin

Sigma-Aldrich

D141

RNase A

Invitrogen

12091-021

Sucrose

Sigma-Aldrich

S0389

phiX174 Replicative Form 1 DNA

Promega

D1531

PhiX174-F primer:

5’-CGCTTCCATGACGCAGAAGTT-3’

PhiX174-R primer:

5’-CACTGACCCTCAGCAATCTTA-3’

Invitrogen and/or IDT-DNA

dNTP mix

Promega

U1515

Go Taq DNA Polymerase

Promega

M3005

Qiaquick gel extraction kit

Qiagen

28706

Ultrapure distilled water

Invitrogen

10977-015

Tris-EDTA (TE) buffer (100x)

Sigma-Aldrich

T9285

Sodium Dodecyl Sulphate (SDS)

Sigma-Aldrich

L3771

Ethylenediamine tetraacetic acid, disodium salt (EDTA) solution, 0.5 M, pH 8.0

Sigma-Aldrich

E7889

Proteinase K (20 mg/mL ready-to-use solution)

Qiagen

19131

Phenol (equilibrated with 10 mM Tris HCl, pH 8.0 and 1 mM EDTA)

Sigma-Aldrich

P4557

Chloroform

Sigma-Aldrich

288306

Glycogen (5 mg/mL solution)

Ambion/Invitrogen

AM9510

Sodium acetate (3 M, pH 5.2)

Sigma-Aldrich

S7899

Ethanol

Sigma-Aldrich

E7023

First round LTR primer:

5’-GTGCGCGCTTCAGCAAG-3’

First round phiX174 primer:

5’-CACTGACCCTCAGCAATCTTA-3’

Invitrogen and/or IDT-DNA

---

Second round LTR-R primer:

5’-TCTGGCTAACTAGGGAACCCA-3’

Second round LTR-U primer:

5’-CTGACTAAAAGGGTCTGAGG-3’

Second round Taqman probe:

 5’-6- FAM/TTAAGCCTCAATAAAGCTTGC

CTTGAGTGC/6-TAMRA/-3’

Invitrogen and/or IDT-DNA

---

iQ Supermix

Bio-Rad

170-8862

DOWNLOAD MATERIALS LIST

References

  1. Sattentau, Q. J., Weiss, R. A. The CD4 antigen: physiological ligand and HIV receptor. Cell. 52, (5), 631-633 (1988).
  2. Wilen, C. B., Tilton, J. C., Doms, R. W. Molecular mechanisms of HIV entry. Adv Exp Med Biol. 726, 223-242 (2012).
  3. Bowerman, B., Brown, P. O., Bishop, J. M., Varmus, H. E. A nucleoprotein complex mediates the integration of retroviral DNA. Genes Dev. 3, (4), 469-478 (1989).
  4. Bukrinsky, M. I., Sharova, N., Dempsey, M. P., et al. Active nuclear import of human immunodeficiency virus type 1 preintegration complexes. Proc Natl Acad Sci. 9, (14), 6580-6584 (1992).
  5. Hansen, M. S., Smith, G. J. 3rd, Kafri, T., Molteni, V., Siegel, J. S., Bushman, F. D. Integration complexes derived from HIV vectors for rapid assays in vitro. Nature biotechnol. 17, (6), 578-582 (1999).
  6. Farnet, C. M., Haseltine, W. A. Integration of human immunodeficiency virus type 1 DNA in vitro. Proc Natl Acad Sci. 87, (11), 4164-4168 (1990).
  7. Fujiwara, T., Mizuuchi, K. Retroviral DNA integration: structure of an integration intermediate. Cell. 54, (4), 497-504 (1988).
  8. Brown, P. O., Bowerman, B., Varmus, H. E., Bishop, J. M. Correct integration of retroviral DNA in vitro. Cell. 49, (3), 347-356 (1987).
  9. Lewinski, M. K., Bushman, F. D. Retroviral DNA integration--mechanism and consequences. Adv Genet. 55, 147-181 (2005).
  10. Engelman, A., Mizuuchi, K., Craigie, R. HIV-1 DNA integration: mechanism of viral DNA cleavage and DNA strand transfer. Cell. 67, (6), 1211-1221 (1991).
  11. Goff, S. P. Genetics of retroviral integration. Ann rev gen. 26, 527-544 (1992).
  12. Panganiban, A. T., Temin, H. M. The terminal nucleotides of retrovirus DNA are required for integration but not virus production. Nature. 306, (5939), 155-160 (1983).
  13. Bieniasz, P. D. The cell biology of HIV-1 virion genesis. Cell host microbe. 5, (6), 550-558 (2009).
  14. Sherman, P. A., Fyfe, J. A. Human immunodeficiency virus integration protein expressed in Escherichia coli possesses selective DNA cleaving activity. Proc Natl Acad Sci. 87, (13), 5119-5123 (1990).
  15. Katzman, M., Katz, R. A., Skalka, A. M., Leis, J. The avian retroviral integration protein cleaves the terminal sequences of linear viral DNA at the in vivo sites of integration. J Virol. 63, (12), 5319-5327 (1989).
  16. Craigie, R., Mizuuchi, K., Bushman, F. D., Engelman, A. A rapid in vitro assay for HIV DNA integration. Nucl acid res. 19, (10), 2729-2734 (1991).
  17. Bushman, F. D., Craigie, R. Activities of human immunodeficiency virus (HIV) integration protein in vitro: specific cleavage and integration of HIV DNA. Proc Natl Acad Sci. 88, (4), 1339-1343 (1991).
  18. Pauza, C. D. Two bases are deleted from the termini of HIV-1 linear DNA during integrative recombination. Virology. 179, (2), 886-889 (1990).
  19. Engelman, A. Isolation and analysis of HIV-1 preintegration complexes. Meth Mol Biol. 485, 135-149 (2009).
  20. Engelman, A., Oztop, I., Vandegraaff, N., Raghavendra, N. K. Quantitative analysis of HIV-1 preintegration complexes. Methods. 47, (4), 283-290 (2009).
  21. Addai, A. B., Pandhare, J., Paromov, V., Mantri, C. K., Pratap, S., Dash, C. Cocaine modulates HIV-1 integration in primary CD4+ T cells: implications in HIV-1 pathogenesis in drug-abusing patients. J Leuk Biol. 97, (4), 779-790 (2015).
  22. Wehrly, K., Chesebro, B. p24 antigen capture assay for quantification of human immunodeficiency virus using readily available inexpensive reagents. Methods. 12, (4), 288-293 (1997).
Medida de<em&gt; In Vitro</em&gt; Integración Actividad del VIH-1 preintegration Complejos
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Balasubramaniam, M., Davids, B., Addai, A. B., Pandhare, J., Dash, C. Measurement of In Vitro Integration Activity of HIV-1 Preintegration Complexes. J. Vis. Exp. (120), e54581, doi:10.3791/54581 (2017).More

Balasubramaniam, M., Davids, B., Addai, A. B., Pandhare, J., Dash, C. Measurement of In Vitro Integration Activity of HIV-1 Preintegration Complexes. J. Vis. Exp. (120), e54581, doi:10.3791/54581 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter