Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Biochemistry

تحديد الركيزة الخصوصيات لالليباز وفسفوليباز المرشحين

doi: 10.3791/54613 Published: November 23, 2016

Abstract

الكائنات الحية الدقيقة وتنتج مجموعة واسعة من (الفوسفات) الليباز التي تفرز من أجل جعل ركائز الخارجية المتاحة للكائن الحي. بدلا من ذلك، وغيرها (الفوسفات) يباسيس قد تترافق مع جسديا الكائن إنتاج يسبب دوران من الدهون الذاتية وأفسحت المجال لإعادة تشكيل الأغشية الخلوية في كثير من الأحيان. على الرغم من أن المحتملة (الفوسفات) يباسيس يمكن التنبؤ بها مع عدد من الخوارزميات عندما تسلسل الجين / بروتين متاح، وكثيرا ما لم يتم الحصول على دليل تجريبي من الأنشطة الإنزيمية والخصوصيات الركيزة، والوظائف الفسيولوجية المحتملة. توضح هذه المخطوطة وتعظيم الاستفادة من الظروف فحص لالمحتملين (الفوسفات) يباسيس مع خصوصيات الركيزة غير معروفة وكيفية توظيف هذه الظروف الأمثل في البحث عن الركيزة الطبيعية من (الفوسفات) الليباز منها. استخدام ركائز اللونية الاصطناعية، مثل المشتقات ص -nitrophenyl، قد تساعد على كشف قاصرالنشاط الأنزيمي لتوقع (الفوسفات) الليباز في ظل ظروف قياسية. وبعد أن واجه مثل هذه النشاط الأنزيمي البسيط و المعلمات متميزة لفحص انزيم يمكن أن تختلف من أجل الحصول على التحلل أكثر كفاءة من الركيزة الاصطناعية. بعد أن تحدد الظروف التي انزيم يعمل بشكل جيد، يجب أن يعاير مجموعة متنوعة من ركائز الطبيعية المحتملة لتدهورها، وهي العملية التي يمكن اتباعها توظيف أساليب الكروماتوغرافي متميزة. تعريف خصوصيات الركيزة للإنزيمات جديدة، غالبا ما يقدم فرضيات لدور الفسيولوجية المحتمل لهذه الإنزيمات، التي ثم يمكن اختبارها تجريبيا. وعقب هذه المبادئ التوجيهية، كنا قادرين على تحديد فسفوليباز C (SMc00171) التي تحط فسفاتيديل إلى phosphocholine ومادة ال diacylglycerol، في خطوة حاسمة لإعادة تشكيل الأغشية الموجودة في بكتيريا Sinorhizobium meliloti على شروط تحد من الفوسفور للنمو. لمدة توقع patatin-مثل فوسفوليباز (SMc00930 وSMc01003) من نفس الحي، ونحن يمكن إعادة تعريف خصوصيات الركيزة وتوضيح أن SMc01003 هو الليباز مادة ال diacylglycerol.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

الدهون القائم على الجلسرين مثل triacylglycerols و(glycero) الفوسفورية تشكل مهمة وربما الطبقات الشحمية الأكثر شهرة 1. Triacylglycerols (العلامات) هي الدهون أو الزيوت، والتي تعمل عادة على نسبة الدهون في التخزين، وبالتالي كمصادر الطاقة والكربون المحتملة. الكلمات يمكن أن يتحلل من الليباز، والتي كثيرا ما يفرز من قبل الكائن الحي إنتاج الهضم الكلمات الخارجية وجعلها متاحة كمصدر للكربون. أيضا، يباسيس وقد درس على نطاق واسع خلال السنوات نظرا لتطبيقات التكنولوجيا الحيوية الهامة. 2.

نظرا لطبيعة محبة للجهتين وشكلها شبه اسطواني، (glycero) الفوسفورية خواص تشكيل غشاء وتشكل عادة مكونات شحمي الرئيسية للغشاء bilayered 3. في الكائنات الحية الدقيقة بسيطة، مثل البكتيريا القولونية، فقط ثلاثة متغيرات رئيس مجموعة كبيرة، phosphatidylglycerol (PG)، كارديوليين (CL)، وphosphatidواجهت ylethanolamine (PE)، على الرغم من واحد يجب أن يكون على علم بأن كل واحد منهم يمكن أن تكون بديلا مع عدد كبير من مختلف سلاسل أسيل الدهنية في التعطيل -1 أو -2 موقف SN مما أدى إلى عدد كبير من مختلف الأنواع الجزيئية 4 . قد يكون بكتيريا أخرى الفوسفورية أخرى بالإضافة أو بدلا من ذلك. على سبيل المثال، Sinorhizobium meliloti، بكتيريا التربة، والتي هي قادرة على تشكيل جذور العقيدات التعايش المثبتة للنيتروجين مع البرسيم البقوليات (الحجازي)، ويتضمن بالإضافة إلى المؤسسة العامة ثان فوسفورية zwitterionic، فسفاتيديل (PC) 5. أيضا، والدهون لا تحتوي على الفوسفور أو الجلسرين قد تكون محبة للجهتين وتشكل جزءا من الغشاء الخلوي. على سبيل المثال، على ظروف النمو، يحد من الفوسفور، في س. meliloti، يتم استبدال (glycero) الفوسفاتية إلى حد كبير من نسبة الدهون في غشاء التي لا تحتوي على الفوسفور، أي sulfolipids، والدهون الأورنيثين، وdiacylglyceryl trimethylhomoserine (DGTS) 6. في البكتيريا، ويتم تشكيل DGTS من مادة ال diacylglycerol (داج) في مسار من خطوتين 7 ولكن كان مصدر لتوليد داج غير واضح. وتشير التجارب نبض مطاردة الكمبيوتر قد تكون مقدمة لDGTS 8 و باستخدام المنهجية الموصوفة في هذه المخطوطة استطعنا تحديد فسفوليباز C (PlcP، SMc00171) التي يتم تشكيلها بموجب شروط تحد من الفوسفور والتي يمكن تحويل الكمبيوتر إلى داج وphosphocholine 8.

وفي دراسة منفصلة، اكتشفنا أن مخلقة أسيل، لجنة الزراعة (FadD) متحولة -deficient س meliloti أو من الإشريكية القولونية تراكم الأحماض الدهنية الحرة عند دخول مرحلة ثابتة من 9 النمو. على الرغم من أن هذه الأحماض الدهنية يبدو أن تستمد من الدهون غشاء، المصدر الدقيق للأحماض الدهنية الحرة أو الانزيم (ق) تحريرهم لم تكن معروفة. مرة أخرى، وتوظيف الاستراتيجية الواردة في هذه المخطوطة، وهما 10 (الفوسفات) يباسيس مثل patatin (SMc00930 وSMc01003) التي ساهمت في تكوين الأحماض الدهنية الحرة في س. وتوقع meliloti 11. والمثير للدهشة، وتستخدم SMc01003 همرشولد الركيزة تحويله إلى monoacylglycerol وأخيرا الجلسرين والأحماض الدهنية الحرة 11. لذلك، SMc01003 هو الليباز داغ (DglA).

ورغم أن عددا من الخوارزميات وجود للتنبؤ المحتملين (الفوسفات) يباسيس 12،13، وظيفتها دقيقة وغير معروفة عادة دور الفسيولوجية. نحن هنا الخطوط العريضة لبروتوكول، لاستنساخ وبإفراط توقع أو المحتملة (الفوسفات) الليباز. توضح هذه المخطوطة كيف المقايسات الإنزيم يمكن تطوير وتحسين ل(الفوسفات) الليباز overexpressed باستخدام ركائز اللونية الاصطناعية. نحن نقدم أمثلة كيف مع فحص انزيم الأمثل الحقيقية (الفوسفات) الليباز الركيزة يمكن أن يكون مصادفة، وكيف يمكن أن تثري هذه النتائج فهمنا للعلم وظائف الأعضاء الميكروبية.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. استنساخ وبإفراط الهيكلية الجيني لالليباز وتوقع

  1. باستخدام تفاعل البلمرة المتسلسل (PCR) 14 وأليغنوكليوتيد محددة (الجدول 1) 15، تضخيم الجين (smc01003، smc00930، أو smc00171)، يتوقع أن رمز لالليباز أو فسفوليباز، من الحمض النووي الجيني للكائن الحي المضيف (أي ، جرثومة S. meliloti).
    1. إدخال تقييد مواقع محددة (مع تسلسل مصممة للأليغنوكليوتيد]). هضم جزء تضخيم الحمض النووي مع إنزيمات تقييد المقابلة واستنساخ ذلك إلى ناقلات التعبير مثل البلازميدات من سلسلة الحيوانات الأليفة (16).
    2. بعد التأكد من تسلسل الحمض النووي الصحيح لهذا الجين المستنسخة، وتحويل ناقلات لسلالة التعبير مثل الإشريكية القولونية BL21 (DE3) pLysS 16.
  2. إعداد ما قبل الثقافة بين عشية وضحاها من المضيف التعبير E. القولونية BL21 (DE3) ررYSS، إيواء ناقلات الحيوانات الأليفة منها مع الجينات المستنسخة أو ناقلات فارغة، في 100 مل قوارير الثقافة التي تحتوي على 20 مل من لوريا Bertani مرق (LB) 17 بالإضافة إلى المضادات الحيوية اللازمة. ثقافة الخلايا عند 30 درجة مئوية (أو في درجة حرارة النمو المعتادة من البكتيريا التي الليباز ينبع).
    1. باستخدام بين عشية وضحاها الثقافات مسبقا، تطعيم 500 مل من المتوسط LB prewarmed (بالإضافة إلى المضادات الحيوية المطلوبة) في 2 قوارير ثقافة L للحصول على الكثافة البصرية الأولية في 620 نانومتر (OD 620) = 0.05. اتبع نمو الثقافات وفي لOD 620 = 0.3، إضافة الآيزوبروبيل-β-D-thiogalactoside (IPTG) إلى تركيز النهائي من 100 ميكرومتر، واحتضان في إطار التحريض على 30 درجة مئوية لمدة 4 ساعات.
    2. في نهاية فترة الحضانة، ونقل كل ثقافة إلى أنبوب الطرد المركزي 500 مل وأجهزة الطرد المركزي في 5000 x ج في 4 درجة مئوية لمدة 30 دقيقة. و resuspend الكريات الخلية البكتيرية في 5 مل من العازلة تعليق (على سبيل المثال، SMc00930- وSMc01003، معربا عن الخلايا في 50 ملي تريس، حمض الهيدروكلوريك 8.0 درجة الحموضة والخلايا SMc00171، معربا في 50 ملي ايتانول أمين، حمض الهيدروكلوريك درجة الحموضة 9.8). تخزين تعليق خلية في -80 درجة مئوية حتى الاستخدام.

2. إعداد مقتطفات البروتين الخالية من خلية وتحديد كثافة البروتين

  1. تذويب الايقاف الخلية البكتيرية وتخزينها على الجليد. تمرير تعليق خلية ثلاث مرات من خلال خلية الضغط الباردة في 20،000 رطل لكل في 2. إزالة خلايا سليمة والحطام الخلية بواسطة الطرد المركزي في 5000 x ج لمدة 30 دقيقة على 4 درجات مئوية.
  2. بعد الطرد المركزي، وإعداد aliquots من 100 و 500 ميكرولتر من طاف لتحليلها لاحقا وتخزينها في -80 درجة مئوية حتى الاستخدام.
  3. استخدم إحدى قسامة 100 ميكرولتر لتحديد تركيز البروتين مقتطفات خالية من الخلايا متميزة على طريقة الاختيار أو كما هو موضح 18.

3. استخدام ركائز الاصطناعي لتحسين أنزيمأنشطة (الفوسفات) يباسيس

  1. للحصول على تغطية الأولية من الأنشطة الإنزيمية متميزة، واستخدام ركائز المصطنعة التي تسفر عن المنتجات الملونة على التحلل، مثل ص -nitrophenol -NP).
    1. لفحوصات انزيم الأمثل بالفعل مع ركائز ص -nitrophenyl استر الاصطناعية (المبين لفسفوليباز C PlcP (SMc00171)، وكذلك لفوسفوليباز مثل patatin توقع SMc00930 وSMc01003)، وخطط pipetting لاستخدام وصفت في الجدول 2.
    2. عندما استكشاف المحتملين (الفوسفات) الليباز الجديد، وإعداد أول فحص انزيم القياسية التي تحتوي على 50 ملي تريس، حمض الهيدروكلوريك، ودرجة الحموضة 8.5، 100 مم كلوريد الصوديوم، 0.05٪ تريتون X-100، 0.5 مم ص مركب يحتوي على -nitrophenyl -nitrophenyl الفوسفات ، bis- ص -nitrophenyl الفوسفات، ص -nitrophenyl ديكانوات، أو ص -nitrophenyl بالميتات)، وخالية من الخلايا استخراج البروتين (راجع 1، 3، 10، 30، 100، 300، و 1،000 ميكروغرام) في إجمالي حجم 1 مل في 1 مل CUVE البلاستيكttes.
      ملاحظة: استخدام درجة الحموضة القلوية (الشكل 1) عند اتباع ص -nitrophenyl المائي استر في الفحص المستمر. بدلا من ذلك، استخدم واحد المقايسات الوقت نقطة لمجموعة من القيم ودرجة الحموضة، إضافة هيدروكسيد الصوديوم في نهاية فترة الحضانة لإنهاء رد فعل الانزيم، والتأكد من أن جميع ص -NP موجود في شكل فينولات.
    3. متابعة سير الوقت لزيادة الامتصاصية في 405 نانومتر، ويرجع ذلك إلى تشكيل ص -NP، في معمل عند 30 درجة مئوية على فترة 5 دقائق. تحديد تشكيل الخطي في البداية من ص -NP من خلال تحديد المنحدر الأولي من زيادة الامتصاصية في الوقت.
    4. حساب التغير في تركيز (Δc) لص -NP باستخدام قانون لامبرت-البيرة (ΔA = ε Δc د) 1.
      ملاحظة: ΔA هو التغيير خطية من الامتصاصية العزم، ε هو معامل الانقراض المولي في طول موجة كل منها (في وحدات من M -1 -1)، د هو طول مسار الضوء (1 سم)، وΔc هو تغيير تركيز (في وحدات M) يحدد لاحقا.
      1. وبالنظر إلى أن حجم الاختبار هو 1 مل، وحساب كمية ص -NP تشكيلها.
        ملاحظة: المبلغ = تركيز حجم س.
      2. حساب نشاط انزيم بقسمة مبلغ ص -NP التي شكلتها في الوقت الذي تتشكل. تحديد نشاط انزيم معين بقسمة نشاط انزيم من كمية البروتين (في ملغ) الذي كان مسؤولا عن توليد هذا النشاط.
    5. مقارنة التغيرات الامتصاصية التي أثارتها مقتطفات من البروتين الذي قد أعرب عن الجينات المرشحة (smc00171، smc00930، أو smc01003) مع مقتطفات التي تؤوي سوى ناقلات فارغة.
      ملاحظة: من أجل متابعة الخطوات التالية، يجب أن تكون أنشطة محددة، والناجمة عن مقتطفات من البروتين الذي قد أعرب عن الجينات المرشحة، على الأقل مرتين أو مخام من القيم التي تم الحصول عليها لأنشطة محددة الناجمة عن مقتطفات من البروتين التي تؤوي سوى ناقلات فارغة.
    6. لمزيد من التجارب، حدد تلك الظروف التي التحلل من مركب يحتوي على -nitrophenyl ف هو الحد الأدنى مع مقتطفات خالية من الخلايا (أي ناقلات فارغة) والذي تشكيل أكثر وضوحا من ص -NP وأنيون ص -nitrophenolate (الشكل 1) يمكن ملاحظتها عندما تستخدم مستخلصات البروتين، والذي كان قد أعرب عن الجينات المرشحة.
  2. بعد تحديد نشاط انزيم الأولي في 3.1، وتحسين الظروف فحص للانزيم منها من خلال تغيير درجة الحموضة، نوع من العازلة، العازلة قوة، وتركيزات كلوريد الصوديوم، المنظفات مثل تريتون X-100، وغياب أو وجود الكاتيونات الثنائي التكافؤ مختلفة.
    1. لتركيزات مختلفة من كل متغير، وتحديد نشاط انزيم معين (انظر 3.1.4.2) (أعلى رقم تم الحصول عليها يحدد حالةمن نشاط انزيم القصوى). استخدام مزيج من الظروف المثلى اجه لكل متغير لتعريف فحص انزيم الأمثل فيها كل متغير موجود في تركيز الأمثل.

شكل 1
الشكل 1. ص استرات -Nitrophenyl ركائز الاصطناعية لل(الفوسفات) الليباز في الفحص الطيفي. وعند التحلل من استرات ص -nitrophenyl، تتشكل من الأحماض (R-OH) وص -nitrophenol -NP). ويرجع ذلك إلى PK ل= 7.2 لتفارق من الفينول H + من ص -NP، في الرقم الهيدروجيني> 9.2 أكثر من 99٪ في شكل ص -nitrophenolate أصفر مشرق ومعامل الانقراض المولي من 18،000 م -1 سم - 1 يمكن استخدامها في طول الموجة من 405 نانومتر لتقدير حجم الحرة ص -nitrophenolate 22. عندما استخدمت مخازن مع الرقم الهيدروجيني 8.5، تم تحديد الامتصاصية في 400 نانومتر، ومعامل الانقراض المولي من 14،500 م -1 سم -1 كان يعمل 23. يرجى النقر هنا لمشاهدة نسخة أكبر من هذا الرقم.

ملاحظة: بعد أن حددت الظروف المثلى لنشاط الإنزيم من الفائدة، والشروع في البحث عن الركيزة الحقيقية / الفسيولوجية من هذا الليباز. من حيث المبدأ، واتخاذ اثنين، وغالبا ما متكاملين، لتحقيق هذا الهدف، وهو في نهج الجسم الحي أو نهج في المختبر.

4. في فيفو التعرف على الفسيولوجية الركيزة لالليباز

ove_content "> ملاحظة: في هذا النهج في الجسم الحي، والتعبير عن الليباز الاهتمام كائن المضيف 8،11 لتسجيل مرور الوقت ما إذا كانت تعبيرا عن الليباز يغير الشخصي host's الدهون في نهج آخر في الجسم الحي، تولد متحولة ناقصة من الجينات في المصالح 8،11 ودراسة ما إذا كانت الدهون لها يختلف عن النوع البري نسخة 6،8،11. ومن أجل الحصول على التقييم الكمي من الدهون الكائن الحي، ويتكون طريقة بسيطة في radiolabeling المركبات الخلوية ، واستخراج الدهون، وفصل لهم من قبل اللوني، وقياس نسبة الدهون في فصل المسمى بالإشعاع.

  1. Radiolabeling من الدهون.
    1. إعداد ما قبل الثقافة بين عشية وضحاها من كائن حي من الفائدة (إي كولاي أو جرثومة S. meliloti) في 5 مل من مستنبت المطلوب (المتوسطة معقدة أو تعريف الحد الأدنى من المتوسط) وينمو بمعدل 30 درجة مئوية.
    2. من قبل الثقافة، تطعيم في 20 مل من سالي متوسطة جديدة في قارورة الثقافة 100 مل للحصول على OD الأولي 620 = 0.3 للثقافة.
    3. يأخذ قسامة (1 مل) من الثقافة تحت ظروف معقمة ونقل إلى البوليسترين 14 مل العقيمة أنبوب جولة القاع.
    4. إضافة 1 μCi من [1- 14 C] خلات (60 زارة التجارة والصناعة في ملمول) للثقافة 1 مل.
    5. احتضان ثقافة السائل في إطار التحريض على 30 درجة مئوية لمدة 24 ساعة.
    6. في نهاية فترة الحضانة، ونقل الثقافة إلى أنبوب microcentrifuge 1.5 مل وأجهزة الطرد المركزي في 12000 x ج في درجة حرارة الغرفة لمدة 5 دقائق.
    7. Resuspend وبيليه في 100 ميكرولتر من المياه. في هذه المرحلة، وتخزين تعليق خلية في -20 درجة مئوية أو مباشرة الاستمرار في استخراج الدهون القطبية (القسم 4.2).
  2. استخراج الدهون القطبية.
    ملاحظة: الطريقة الموضحة هنا أساسا يتبع الإجراء ذكرت بليغ وداير (19).
    1. إلى 100 ميكرولتر من المعل خلية مائيension، إضافة 375 ميكرولتر من الميثانول: حل الكلوروفورم (2: 1؛ المجلد / المجلد).
    2. دوامة لمدة 30 ثانية، واحتضان لمدة 5 دقائق في درجة حرارة الغرفة.
    3. الطرد المركزي 5 دقائق في 12000 x ج في درجة حرارة الغرفة.
    4. طاف لنقل 1.5 مل أنبوب microcentrifuge جديد.
    5. إضافة 125 ميكرولتر من كلوروفورم و 125 ميكرولتر من المياه، دوامة 30 ثانية.
    6. الطرد المركزي 1 دقيقة في 12000 x ج في درجة حرارة الغرفة.
    7. نقل المرحلة الكلوروفورم السفلى لأنبوب جديد والجافة مع تيار من غاز النيتروجين.
    8. حل الدهون المجففة في 100 ميكرولتر من كلوروفورم: حل الميثانول (1: 1؛ المجلد / المجلد).
      ملاحظة: عند هذه النقطة، قسامة من 5 ميكرولتر من محلول الدهون يمكن قياسها عن طريق عد التلألؤ السائل.
    9. لتحليل طبقة رقيقة الكروماتوغرافي (TLC)، تجف أسفل 95 ميكرولتر المتبقية مع تيار من غاز النيتروجين وتنحل الدهون المجففة في 20 ميكرولتر من كلوروفورم: حل الميثانول (1: 1؛ المجلد / المجلد). استخدام قسامة 3 ميكرولترلتحليل TLC.
  3. فصل الدهون القطبية التي اللوني طبقة رقيقة (TLC).
    ملاحظة: اعتمادا على الطبقات الدهون ليتم تحليلها، يمكن أن تستخدم تركيبات مختلفة من مراحل الصلبة والمتنقلة للانفصال. هنا فصل نموذجي عن الدهون اتهم القطبية وأخرى، أكثر ملاءمة لالدهون القطبية محايدة، وذلك باستخدام عالية الأداء طبقة رقيقة اللوني (HPTLC) ورقة هلام السيليكا الألومنيوم كمرحلة الصلبة، وترد.
    1. فصل الدهون القطبية التي يتقاضاها ثنائي الأبعاد TLC (2D-TLC).
      1. تطبيق قسامة 3 ميكرولتر من عينة الدهون في زاوية واحدة من ورقة HPTLC هلام السيليكا الألومنيوم (10 × 10 سم)، 2 سم من حافة صفيحة.
      2. إعداد وتخلط الطور المتحرك (140 مل الكلوروفورم، 60 مل الميثانول، و 10 مل من الماء) للفصل في البعد الأول.
      3. معطف غرفة تطوير TLC داخليا مع ورقة اللوني.
        ملاحظة: هذا هو لضمان أن المرحلة الغاز من الغرفةسيتم المشبعة بسرعة (في غضون 30 دقيقة) بعد المرحلة المتنقلة للالبعد الأول قد أضيفت إلى الغرفة وتم إغلاق الغرفة مع لوحة من الزجاج.
      4. إعداد وتخلط الطور المتحرك (130 مل الكلوروفورم، 50 مل الميثانول، و 20 مل الجليدية حمض الخليك) للفصل في البعد الثاني ونقل إلى غرفة TLC الثانية تطوير المغلفة داخليا مع ورقة اللوني والسماح للتشبع الغرفة.
      5. نقل بعناية ورقة هلام السيليكا الألومنيوم HPTLC مع عينة الدهون المجففة إلى الغرفة الأولى وتطوير (أي أداء اللوني) لوحة لمدة 60 دقيقة في غرفة مغلقة في البعد الأول 5.
      6. إزالة لوحة من الغرفة وترك المذيبات الجافة قبالة في غطاء تدفق لمدة 30 دقيقة.
      7. بعد تحويل لوحة بمقدار 90 درجة فيما يتعلق اللوني السابق، ونقل ورقة الألومنيوم هلام السيليكا HPTLC، الذي يكون قد تم فصل الدهون في بعد واحد، إلى سكوند الغرفة وتطوير لوحة لمدة 60 دقيقة في البعد الثاني 5.
      8. إزالة ورقة من غرفة والسماح للمذيبات تجف قبالة في غطاء تدفق لا يقل عن 2 ساعة.
    2. فصل الدهون القطبية محايدة.
      1. تطبيق 3 مكل من عينات الدهون على ورقة هلام السيليكا الألومنيوم HPTLC ابتداء 2 سم من حواف اللوحة. إذا تم تحليل عينات متعددة في اللوني ذات بعد واحد، والحفاظ على مسافة 1.5 سم على الأقل بين مختلف البقع تطبيق نموذج.
      2. إعداد وتخلط الطور المتحرك (140 مل الهكسان، 60 مل ثنائي إيثيل الإيثر، و 8 مل حامض الخليك) ونقل إلى غرفة تطوير TLC المغلفة داخليا مع ورقة اللوني ومغطاة بصفيحة زجاجية للسماح للتشبع الغرفة (30 دقيقة).
      3. نقل ورقة الألومنيوم هلام السيليكا HPTLC مع عينات الدهون المجففة إلى الغرفة وتطوير لوحة لمدة 30 دقيقة في غرفة مغلقة.
      4. إزالة لوحة من الغرفةوالسماح للمذيبات تجف قبالة في غطاء تدفق لمدة 2 ساعة.
  4. الكمي والتصور من الدهون القطبية فصل.
    1. مرة واحدة ورقة TLC المتقدمة جافة، واحتضان مع شاشة التلألؤ photostimulable (البولندي) في شريط مغلق لمدة 3 أيام.
    2. فضح الشاشة المحتضنة لماسح ضوئي البولندي والحصول على صورة افتراضية من الدهون رديولبلد فصل.
    3. أداء الكمي باستخدام برنامج البولندي 20.
  5. التصور وعزل الطبقات الدهون القطبية الفردية.
    1. احتضان ورقة TLC المتقدمة لمدة 10 دقيقة في غرفة اللوني في وجود من 1 غرام من بلورات اليود.
      ملاحظة: مطلق المركبات شحمي حل اليود وتظهر على شكل بقع بنية اللون.
    2. دائرة البقع مع قلم رصاص، مقارنتها مع الحراك النسبي (R و) من المركبات القياسية (أي 1،2-dipalmitoyl- التعطيل -glycerol، dipalmitoyl-L-α-فوسphatidylcholine، DL-α-monopalmitin، أو حمض البالمتيك)، وتحديد إلى أي فئة الدهون لأنها قد تنتمي.
    3. في غطاء الدخان، والسماح للاليود تتبخر من ورقة TLC.
    4. مع مساعدة من ملعقة، تتخلص من هلام السيليكا التي تحتوي على مركب من الاهتمام من ورقة، واستخراج المركب من هلام السيليكا مع مزيج من 100 ميكرولتر من الماء و 375 ميكرولتر من الميثانول: حل الكلوروفورم (2: 1؛ المجلد / المجلد).
    5. تواصل مع استخراج وفقا لبليغ وداير على النحو المبين (4.2.2 فصاعدا).
    6. متجر تنقية الطبقة الشحمية في 100 ميكرولتر من كلوروفورم: حل الميثانول (1: 1؛ المجلد / المجلد) عند درجة حرارة -20 درجة مئوية حتى الاستخدام.

5. في المختبر التعرف على الفسيولوجية الركيزة لالليباز

ملاحظة: في هذا النهج في المختبر، ودراسة ما إذا كان الليباز من الفائدة يمكن تحويل خليط من الدهون معزولة أو الدهون نقية الفردية إلى هيدرول المقابلةمنتجات يسيس وفقا للشروط المحددة بالشكل الأمثل في 3.2.

  1. استخدام أنظمة pipetting للفحوصات انزيم كما في الجدول رقم 3 للكمبيوتر محددة فسفوليباز C SMc00171 (انظر 5.2)، فسفوليباز و(انظر 5.3)، ومديرية الشؤون الجغرافية الليباز SMc01003 (انظر 5.4) النشاط.
  2. تقرير النشاط فسفوليباز C PC-معين (الجدول 3).
    1. إلى أنبوب microcentrifuge 1.5 مل، إضافة 5000 التهم لكل دقيقة (CPM) من إجمالي 14 PC-المسمى C وحل تريتون X-100.
    2. مزيج الجافة تحت تيار من النيتروجين.
    3. إضافة ايتانول أمين، حمض الهيدروكلوريك، ودرجة الحموضة 9.8 العازلة، وكذلك كلوريد الصوديوم وMnCl 2 الحلول والمياه bidistilled للحصول على الحجم النهائي من 99.5 ميكرولتر. دوامة لمدة 5 ثوان.
    4. إضافة 0.5 ميكرولتر من انزيم (5 البروتين ميكروغرام) (أي استخراج خالية من الخلايا التي overexpressed SMc00171 موجود) لبدء التفاعل. مزيج لفترة وجيزة.
    5. احتضان عند 30 درجة مئوية لمدة 4 ساعات.
    6. وقف رد فعل من قبلإضافة 250 ميكرولتر من الميثانول و 125 ميكرولتر من كلوروفورم.
    7. استخراج الدهون كما هو موضح سابقا (انظر 4.2).
    8. الدهون منفصلة أحادية البعد (1D) -TLC (انظر 4.3.2 و 4.4)، وتحليلها بواسطة التصوير البولندي.
  3. تقرير النشاط فسفوليباز ألف (الجدول 3).
    1. إلى أنبوب microcentrifuge 1.5 مل، إضافة 5000 نسخة في الدقيقة 14 من إجمالي الدهون الفوسفاتية المسمى C وحل تريتون X-100.
    2. مزيج الجافة تحت تيار من النيتروجين.
    3. لالنهائي فحص 100 ميكرولتر، إضافة تريس، حمض الهيدروكلوريك، ودرجة الحموضة 8.5 العازلة، حل كلوريد الصوديوم والماء. دوامة لمدة 5 ثوان.
    4. إضافة 5 ميكرولتر من انزيم (50 ميكروغرام البروتين) (أي استخراج خالية من الخلايا التي overexpressed SMc00930 أو SMc01003 موجود).
    5. احتضان عند 30 درجة مئوية لمدة 5 ساعة.
    6. وقف رد الفعل من خلال إضافة 250 ميكرولتر من الميثانول و 125 ميكرولتر من كلوروفورم.
    7. استخراج الدهون كما هو موضح سابقا (انظر 4.2)، منفصلةلهم من قبل 1D-TLC باستخدام 130 مل الكلوروفورم، 50 مل الميثانول، وحمض الخليك 20 مل الجليدية كمرحلة النقالة، وتحليلها بواسطة التصوير البولندي.
  4. تقرير من مادة ال diacylglycerol (داج) النشاط الليباز.
    1. إعداد داغ المسمى C-14.
      1. Radiolabel س. الثقافات meliloti (انظر 4.1) واستخراج الدهون القطبية (انظر 4.2) كما هو موضح. منفصل س. meliloti إجمالي مقتطفات من المادة الدهنية التي كتبها 1D-TLC في الكلوروفورم: الميثانول: حمض الخليك (130: 50: 20؛ المجلد / المجلد) باستخدام الشروط الموضحة للفصل في البعد الثاني في 4.3.1.
      2. تصور جهاز الكمبيوتر عن طريق تلطيخ اليود واستخدام قلم رصاص بمناسبة توطين فسفاتيديل (PC).
      3. عزل PC رديولبلد كما هو موضح في 4.5.
      4. تحديد PC المستخرج من التلألؤ العد.
        ملاحظة: من المتوقع عن 320،000 جهاز كمبيوتر التدوير.
      5. علاج PC (250،000 نسخة في الدقيقة) مع 0.1 U من فسفوليباز C من المطثية الحاطمة في 50 ملي تريس، حمض الهيدروكلوريك، ودرجة الحموضة 7.2، 0.5٪ تريتون X-100 و 10 ملم CaCl 2 لمدة 2 ساعة في إجمالي حجم 100 ميكرولتر ووقف رد الفعل من خلال إضافة 250 ميكرولتر من الميثانول و 125 ميكرولتر من كلوروفورم.
      6. استخراج الدهون كما هو موضح سابقا ومنفصلة بها من قبل 1D-TLC (انظر 4.3.2).
      7. عزل مادة ال diacylglycerol من لوحة السيليكا وقياس من قبل عد التلألؤ (كما هو موضح في 4.2)
    2. مادة ال diacylglycerol الليباز فحص (الجدول 3).
      1. إلى أنبوب microcentrifuge 1.5 مل، إضافة 5000 نسخة في الدقيقة 14 وصفت C-داج وحل تريتون X-100.
      2. مزيج الجافة تحت تيار من النيتروجين.
      3. لالنهائي فحص 100 ميكرولتر، إضافة تريس، حمض الهيدروكلوريك (الرقم الهيدروجيني 9.0) العازلة، حل كلوريد الصوديوم والماء bidistilled. دوامة لمدة 5 ثوان.
      4. بدء رد فعل عن طريق إضافة 5 ميكرولتر من انزيم (50 ميكروغرام البروتين المستخلص الخالي من الخلايا).
      5. احتضان عند 30 درجة مئوية لمدة 4 ساعات.
      6. وقف رد الفعل من خلال إضافة 250 ميكرولتر من الميثانولد 125 ميكرولتر من نسبة الدهون في الكلوروفورم واستخراج كما هو موضح سابقا (انظر 4.2).
      7. تحليل الدهون القطبية المحايدة التي كتبها 1D-TLC (انظر 4.1.3.2) والتصوير البولندي لاحق.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

آخر من أجهزة الكمبيوتر الخاصة فسفوليباز C SMc00171 مع Bis- ص -nitrophenyl الفوسفات

مقتطفات خالية من الخلايا التي تم الحصول عليها من E. القولونية BL21 (DE3) × pLysS، التي أعربت عن smc00171، درست لقدرتها على يتحلل bis- ص استرات -nitrophenyl الفوسفات، وذلك باستخدام الفحص الانزيمي الطيفي، وقياس -NP ص تشكيلها. لم يكن النشاط حلمهي الحالي في مقتطفات خالية من الخلايا التي تم الحصول عليها من E. القولونية BL21 (DE3) س pLysS إيواء متجه pET9a فارغة (لا تظهر البيانات) عندما كان يعمل ع -nitrophenyl الفوسفات كما الركيزة bis-.

وتشير دوام ل-NP ص شكلت أن هناك اعتمادا قويا على كمية من مستخلص خالية من الخلايا (من كولاي BL21 (DE3) × pLysS، الذي كان SMوأعرب c00171) إضافة إلى فحص (الشكل 2A). إذا كانت كمية المنتج ص -NP شكلت سيعتمد فقط على تركيز الانزيم، وجود علاقة خطية بين الانزيم (البروتين) تركيز المستخدمة والمنتجات التي تشكلت بعد فترة زمنية معينة ينبغي مراعاتها. ومن الواضح أن هذا ليس هو الحال لمقتطفات خالية من الخلايا التي تم الحصول عليها من E. القولونية BL21 (DE3) × pLysS، الذي smc00171 أعرب (الشكل 2B). على الرغم من أن قد يكون هناك عدة أسباب لالاعتماد الهائل من نشاط انزيم على تركيز البروتين 21، سبب كثرة هو أن على التخفيف من استخراج البروتين التي تحتوي على انزيم، والمكونات الأخرى في انتزاع التي يمكن أن تحد للنشاط الإنزيم، أي العوامل المساعدة المحتملة ، وتضعف أيضا. في مثل هذه الحالات، تم تسجيلها في الأنشطة الإنزيمية منخفضة بشكل غير متوقع مع مقتطفات خالية من الخلايا المخفف. من قبل بما في ذلك تركيز تشبع من 3 ملي MnCl 2 في فحص انزيم، ع وأضاف المنتج -NP تشكلت بعد وقت معين يعتمد فقط على كمية الانزيم (لا تظهر البيانات) مما يدل على أن MnCl 2 كان العنصر المحدد لنشاط SMc00171 في مقتطفات خالية من الخلايا من E. القولونية.

الشكل 2
وهو موضح الشكل 2. تحديد SMc00171 (فسفوليباز) النشاط باستخدام الركيزة الاصطناعية bis- ص -nitrophenyl الفوسفات. وبطبيعة الحال من الوقت لتشكيل ص -NP توظيف خالية من الخلايا البروتينات مقتطفات (● 10 ميكروغرام / مل، ■ 15 ميكروغرام / مل، ▲ 20 ميكروغرام / مل) التي SMc00171 أعرب عنها (A) ص -NP تشكلت بعد 40 دقيقة من الحضانة مع كميات مختلفة من خالية من الخلايا البروتينات مقتطفات التي أعرب عنها SMc00171 (B). أشرطة الخطأ تشير إلى الانحراف المعياري..jove.com / ملفات / ftp_upload / 54613 / 54613fig2large.jpg "الهدف =" _ فارغة "> الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

أنشطة توقع Patatin مثل فوسفوليباز SMc00930 وSMc01003 مع ع -Nitrophenyl أسيل استرات أطوال سلاسل مختلفة

بعد التعبير عن smc00930 أو smc01003 في E. القولونية BL21 (DE3) × pLysS، تم الحصول على مقتطفات خالية من الخلايا ودرس لقدرتها على يتحلل ص -nitrophenyl استرات أسيل الدهنية. خلال الفحص الانزيمي، تم تحديد -NP ص شكلت في معمل. وكانت أنشطة حلمهي بسيطة موجودة في مقتطفات خالية من الخلايا التي تم الحصول عليها من E. القولونية BL21 (DE3) × pLysS مع ناقلات pET17b فارغة (الجدول 4) عندما استرات ص -nitrophenyl أسيل من احكانوا يعملون الإقليم الشمالي سلسلة أطوال بمثابة ركائز. عندما أعرب عن smc01003 وأظهرت مقتطفات حصلت زيادة التحلل من استرات ص -nitrophenyl من أطوال سلسلة مختلفة. تدهورت SMc01003 والمتوسطة سلسلة ع -nitrophenyl ديكانوات فضلا عن سلسلة طويلة ف -nitrophenyl بالميتات وص -nitrophenyl ستيرات (الجدول 4). كما SMc01003 هو المساهم الرئيسي لتشكيل سلسلة طويلة من الأحماض الدهنية الحرة في س. meliloti خلال مرحلة ثابتة 11، كان من المدهش أن SMc01003 بدا للعمل بنفس الكفاءة في المتوسطة سلسلة من التركيز على سلسلة طويلة استرات ص -nitrophenyl أسيل (الجدول 4). بشكل غير متوقع، SMc01003 يعمل أيضا على ركائز قصيرة السلسلة مثل الزبدات ص -nitrophenyl أو أوكتانوات ص -nitrophenyl (لا تظهر البيانات). ومع ذلك، تدهورت هذه ركائز الأخيرة أيضا الأنشطة الحالية في مقتطفات خالية من الخلايا من E. القولونية (أي إيواء vect فارغةأو pET17b) دون إبداء أي جين اضافية ومع ركائز قصيرة السلسلة (C4)، ويتحلل نصف الركيزة بالفعل E. الانزيمات الجوهرية القولونية (لا تظهر البيانات). بوضوح، يحتاج SMc01003 أن تنقيته من أجل توضيح ما إذا كانت SMc01003 تعمل بصورة جيدة أيضا على ركائز قصيرة ومتوسطة وطويلة السلسلة. بشكل عام، استرات ص -nitrophenyl أسيل لا يبدو أن تكون ركائز جيدة للSMc01003 التي قد تكون مفهومة مع العلم أن SMc01003 هي في الواقع الليباز داج 11. مقتطفات خالية من الخلايا، التي أعرب عنها smc00930، وتبين الأنشطة الإنزيمية أعلى من ذلك بكثير مع استرات ص -nitrophenyl (الجدول 4). أيضا، SMc00930 غير قادرة على يتحلل استرات ص -nitrophenyl أسيل من أطوال سلسلة مختلفة (C10، C12، C14، C16 و C18)، على الرغم من ع -nitrophenyl بالميتات (نشاط معين 5.5 مليمول NP دقيقة - بروتين 1 ملغ - 1) ومن الواضح أن أفضل الركيزة لSMc00930. حتى الآن، physioloولا يعرف gical الركيزة لSMc00930.

استكشاف سواء القطبية الدهون يمكن أن تعمل بمثابة ركائز للتوقع (الفوسفات) يباسيس

مرة واحدة وقد تم تحسين و(الفوسفات) فحص الليباز الأنزيمية مع ركائز اصطناعية، خليط الدهن أو رديولبلد الدهون نقية يمكن اختبارها بمثابة ركائز المحتملة.

عندما يعاير SMc00171 التي تحتوي على مقتطفات خالية من الخلايا مع 14 جهاز كمبيوتر المسمى مئوية تحت الظروف الأمثل، ونحن يمكن أن تظهر أن SMc00171 يحط الكمبيوتر إلى داج، نتيجة لذلك ما أكدته دراسات لقياس الطيف الكتلوي 8. كما يحط SMc00171 32 جهاز كمبيوتر ف المسمى إلى phosphocholine وبالتالي بمثابة PC-محددة فسفوليباز C (PlcP) وهذا هو يسببها تحت ظروف تحد من الفوسفور للنمو.

متىيعاير SMc00930- أو SMc01003 التي تحتوي على مقتطفات خالية من الخلايا مع 14 ج أو 32 إجمالي الدهون القطبية ف المسمى في ظل ظروف الأمثل، ونحن يمكن أن تظهر أن أيا من الدهون الفوسفاتية وتتحلل من قبل SMc00930 أو SMc01003 في ظل الظروف التي كانت تعمل استرات ص -nitrophenyl أسيل كما ركائز 11. في المقابل، كان فسفوليباز التجاري A 2 من سم الأفعى قادرة على تتحلل مثل خليط من الدهون الفوسفاتية 11. وكانت هذه النتائج مثيرة للدهشة وغير متوقعة على حد سواء، وتوقع SMc00930 وSMc01003، إلى أن فوسفوليباز مثل patatin.

عندما يعاير SMc00930- أو SMc01003 التي تحتوي على مقتطفات خالية من الخلايا مع 14 ج المسمى مادة ال diacylglycerol (داج) في ظل الظروف الأمثل، ونحن يمكن أن تظهر أن داج لا تدهورت بفعل SMc00930 أو مقتطفات خالية من الخلايا من E. القولونية، في حين SMc01003 يحط داج وتشكل المركبات التي تهاجر مثل الأحماض الدهنية الحرة (الشكل 3). مؤخرا أننا يمكن أن تظهر أن SMc01003 بمثابة الليباز داج التي يمكن أن تتحلل داغ أو monoacylglycerol إلى الجلسرين والأحماض الدهنية الحرة 11 (الشكل 4).

الشكل (3)
الشكل 3. SMc01003 يحط مادة ال diacylglycerol. مقتطفات خالية من الخلايا من E. حضنت القولونية BL21 (DE3) × pLysS معربا عن SMc01003، SMc00930 أو التي تحتوي على ناقل pET17b فارغة، أو عازلة مع 14 C-داغ (تم الحصول عليها من جرثومة S. meliloti) لمدة 24 ساعة. في نهاية فترات الحضانة منها، تم استخراج الدهون رديولبلد ومفصولة 1D-TLC باستخدام الطور المتحرك لفصل الدهون القطبية محايدة (انظر 4.3.2). اتحاد كرة القدم، والأحماض الدهنية. داج، مادة ال diacylglycerol. تم تعديل هذا الرقم من [Sahonero-Canavesi وآخرون. 2015] 11.3large.jpg "الهدف =" _ فارغة "> الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

الشكل (4)
الشكل 4. الأنزيمية وظيفة من مادة ال diacylglycerol الليباز DglA (SMc01003). مادة ال diacylglycerol (داج) الليباز SMc01003 يحط همرشولد monoacylglycerol والأحماض الدهنية واحدة، ومن ثم يحط monoacylglycerol أيضا على الجلسرين والأحماض الدهنية آخر. يرجى النقر هنا لمشاهدة نسخة أكبر من هذا الشكل.

النوكليوتيد
اسم
تسلسل
(5'-3 ')
جينة
من اهتمام
تقييد انزيم
وأضاف الموقع
ناقلات
للتعبير
oLOP149 AGGAATA CATATG CTGAACTGGACATTCACG smc01003 تجربة الاقتراب من الموت أنا pET17b
oLOP150 ACGG CTCGAG TCAACGGGACAGCGGTTC smc01003 Xho أنا pET17b
oLOP151 AGGAATA CATATG ACGGAGGTGGCGATGG smc00930 تجربة الاقتراب من الموت أنا pET17b
oLOP152 AAA GGATCC TTATATCCCTTTCCTCCACC smc00930 بام مرحبا pET17b
cgpho171u AGCT CATATG GCGGCGGCATCGGCACCCCACAG smc00171 تجربة الاقتراب من الموت أنا pET9a
cgpho171d ACGT GGATCC TCAGGCGGCCTGCGGTGCGAACC smc00171 بام مرحبا pET9a
رسائل بالخط العريض تشير إلى مواقع تقييد.

الجدول 1. [أليغنوكليوتيد تستخدم لتضخيم واستنساخ توقعت الفوسفات (الليباز) الجينات إلى pET17b أو pET9a النواقل. وقد تم تصميم [أليغنوكليوتيد التمهيدي باستخدام البرنامج الموضحة 15.

فحص لSMc00171 فحص لSMc01003 فحص لSMc00930
مخزون مكون
تريس، حمض الهيدروكلوريك، ودرجة الحموضة 8.5 25 ميكرولتر
2 M تريس، حمض الهيدروكلوريك، ودرجة الحموضة 9.0 25 ميكرولتر
1 M ايتانول أمين، حمض الهيدروكلوريك، ودرجة الحموضة 9.8 50 ميكرولتر
1 M كلوريد الصوديوم 40 ميكرولتر 150 ميكرولتر 150 ميكرولتر
تريتون X-100 200 ميكرولتر 200 ميكرولتر
50 ملي P-nitrophenyl بالميتات 12.5 ميكرولتر 12.5 ميكرولتر
200 ملي bis- P-فوسفات nitrophenyl 2.5 ميكرولتر
خالية من الخلايا استخراج (1 ملغ proteiن / مل) مع الجينات مرشح أعرب 20 ميكرولتر 100 ميكرولتر 1 ميكرولتر
المياه bidistilled 887.5 ميكرولتر 512.5 ميكرولتر 611.5 ميكرولتر
الحجم النهائي 1 مل 1 مل 1 مل

الجدول 2. مخططات pipetting للفحوصات انزيم الأمثل مع بواب ركائز -nitrophenyl استر.

فحص لsmc00171 -encoded فسفوليباز C فحص لsmc01003 - المشفرة داغ الليباز الفحص الأمثل لفسفوليباز والنشاط
مخزون مكون
2 M تريس، حمض الهيدروكلوريك درجة الحموضة 8.5 2.5 ميكرولتر
2 M تريس، حمض الهيدروكلوريك درجة الحموضة 9.0 2.5 ميكرولتر
100 ملي MnCl 2 3 ميكرولتر
1 M ايتانول أمين، حمض الهيدروكلوريك درجة الحموضة 9.8 5 ميكرولتر
1 M كلوريد الصوديوم 4 ميكرولتر 15 ميكرولتر 15 ميكرولتر
تريتون X-100 2 ميكرولتر 20 ميكرولتر 20 ميكرولتر 14-وصفت C الدهون (الدهون الفوسفاتية) 20 ميكرولتر (5000 نسخة في الدقيقة)
14-وصفت C الدهون (PC) 20 ميكرولتر (5000 نسخة في الدقيقة)
14-وصفت C الدهون (داج) 20 ميكرولتر (5000 نسخة في الدقيقة)
10 ملغ / مل استخراج البروتين مع الجينات المرشحة أعرب 0.5 ميكرولتر 5 ميكرولتر 5 ميكرولتر
المياه bidistilled 87.5 ميكرولتر 77.5 ميكرولتر 77.5 ميكرولتر
الحجم النهائي 100 ميكرولتر 100 ميكرولتر 100 ميكرولتر

الطاولة3. مخططات pipetting للفحوصات انزيم الأمثل ل(الفوسفات) يباسيس مع ركائز الدهون رديولبلد.

وتعطى النشاط في وحدات (مكرومول نيتروفينول / ملغم بروتين س دقيقة)
وتشير أرقام جريئة أسيل طول سلسلة من ص -nitrophenyl استر الركيزة 10 12 14 16 18
E. استخراج القولونية (خلفية) 16 ± 0.3 10 ± 1.1 13 ± 0.3 11 ± 0.8 10 ± 0.6
وأعرب SMc00930 في E. استخراج القولونية 1839 ± 283 2873 ± 117 5517 ± 394 3402 ± 65
وأعرب SMc01003 في E. استخراج القولونية 43 ± 2.1 29 ± 2 20 ± 0.7 25 ± 1.5 22 ± 0.9
SMc00930 ناقص الخلفية 1823 ± 283 1829 ± 283 2860 ± 117 5506 ± 394 3392 ± 65
SMc01003 ناقص الخلفية 27 ± 2.1 18 ± 2 7 ± 0.7 14 ± 1.5 12 ± 0.9

الجدول 4. ص استرات -Nitrophenyl أسيل بمثابة ركائز لمثل patatin يباسيس SMc00930 وSMc01003.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

على مدى السنوات ال 20 الماضية، تم التسلسل جينومات العديد من الكائنات الحية وعلى الرغم من ثروة من البيانات تسلسل الجينوم قد ولدت، وتفسير وظيفي لا يزال متخلفا، وبالتالي يعيق فهمنا من وظيفة الجينوم. وغالبا ما تسند وظائف الجينات في الجينوم على أساس التشابه في الجينات وظيفة معروفة أو حدوث الزخارف الحفاظ عليه. ومع ذلك، غالبا ما لا يعرف وظيفة محددة من الجين المعطى. خاصة، وتوقع الجينات الهيكلية للالانزيمات لا يمكن أن يستكشف بسهولة عن طريق تقنيات OMIC يرجع ذلك إلى حقيقة أن معظم الإنزيمات تحفيز التفاعلات المعقدة التي تنطوي على اثنين من ركائز واثنين من المنتجات. في الوقت الحاضر، يبدو أكثر جدوى لاستكشاف خصوصيات الركيزة لمجموعات من الإنزيمات حيث هو ثابت الركيزة واحد على الأقل، وحيث البعض يمكن أن تختلف. على سبيل المثال، في حقيقيات النوى معروفة، وقد رصدت معظم الزخارف الفسفرة في البروتينات الببتيدات توافق في الآراء بشأن تحركات على دعامات قوية من أجل توليد الببتيد عأشعة. باستخدام هذه المصفوفات وATP رديولبلد والخصوصيات الركيزة ومستويات النشاط من تحركات مميزة من كائن حي يمكن تحديد السماح بإنشاء الشخصي kinome وتحديد خصائصها الركيزة 24. هيدروليز يؤلف مجموعة أخرى كبيرة من الإنزيمات التي ركيزة واحدة، المياه، هي ثابتة ولكن التي الطبيعة الدقيقة للالركيزة (أخرى) إلى أن تحلل في كثير من الأحيان غير معروفة. حقيقة أن لأنزيم جديد شروط الفحص الأمثل ليست معروفة سواء، ويحول الكشف عن نشاط الإنزيم الجديد في مشكلة متعددة متغيرة. ولذلك قد يساعد على تكون قادرة على إصلاح الركيزة أن تحلل من أجل تحديد الظروف التي انزيم يعمل على نحو أفضل.

في هذا المخطوط، وصفنا التحسين من الظروف فحص لالمحتملين (الفوسفات) يباسيس مع خصوصيات الركيزة غير معروفة ووضع كيفية توظيف هذه الظروف الأمثل في البحث عن الركيزة الطبيعية للإعادةspective (الفوسفات) الليباز. وتكمن أهمية هذه التقنية الحالية تتكون في حقيقة أن التحلل من ركائز مصطنعة الفلورة أو اللونية، التي تحاكي ركائز الطبيعية إلى حد ما، يمكن أن يتبعه الطيفي 25 وأن هذه المقايسات قابلة للتطبيق بسهولة على نطاق واسع دراسات 26. نظرا لحساسية مثل هذه المقايسات وبساطتها لمراقبة رد فعل، فإنها يمكن أن يكون الأمثل بسهولة لانزيم معين. من الواضح، على ركائز اصطناعية قد يتوقع المرء الثوابت الحركية أقل مواتاة (أي ذات K وانخفاض ك القط) لانزيم معين من لركائز الطبيعية 1،21. في الممارسة العملية، ومع ذلك، فإن توافر سطحي وكشف من ركائز اصطناعية تعمل بمثابة ركائز (سيئة) مجموعات كاملة من الانزيمات في كثير من الأحيان أكثر من تعويض عيوب. مرة واحدة بعد أن واجه الظروف لإنزيم للعمل (مع الركيزة الاصطناعية)، انها لن تفعل ذلك مع الناطورآل / الركيزة الفسيولوجية أيضا. كما إعداد والعزلة من ركائز الدهون المحتملة يمكن أن يكون شاقة وتستغرق وقتا طويلا، فمن المهم أن يكون التأكيد على أن إنزيم على استعداد للعمل عند الجمع بين واحتضان مع ركائز قيمة. الأهم من ذلك أن إجراءات تحسين أولا شروط انزيم للعمل، سوف تسمح لتحديد أسرع من الركيزة الفسيولوجية ل(الفوسفات) الليباز الجديد. كدليل على المفهوم، ونحن قد استخدمت بنجاح هذه الطريقة لتوصيف خصوصيات ركيزة من يباسيس SMc00171، SMc00930، وSMc01003 8،11. في المقابل، عديدة، طرق بديلة التقليدية وضع المقايسات للأنشطة (الفوسفات) الليباز تشمل ردود الفعل حيث الركيزة والمنتج معروفة سابقا.

ومن الواضح أن إدخال تعديلات على فحوصات للكشف عن نشاط انزيم الأمثل يمكن أن تشمل استخدام الفلورة أخرى، مولدات اللون، أو ركائز اصطناعية ملحوظ، والتباينمن انزيم تركيز ونوع وتركيز مخازن، أو غيرها من المواد المضافة (أي منظفات أو الكاتيونات الثنائي التكافؤ). إذا تم الكشف عن أي نشاط الانزيم مع ركائز اصطناعية، الانزيم منها ببساطة قد لا تعمل مع هذه الركيزة، ولكن استكشاف الأخطاء وإصلاحها في مثل هذه الحالات ينبغي أن تشمل بالتأكيد للحصول على تأكيدات أنه قد اتخذت كل الاحتياطات التي قد تكون ضرورية للحفاظ على نشاط انزيم سليمة (أي تخزين مقتطفات خالية من الخلايا في 4 درجات مئوية أو انخفاض درجات الحرارة حتى استخدامها، وإذا لزم الأمر، مضيفا الكوكتيلات مثبطات الأنزيم البروتيني لمقتطفات خالية من الخلايا من أجل تجنب تدهور بروتين انزيم من الفائدة) 27.

ويرجع ذلك إلى حقيقة أن الركيزة الاصطناعية والركيزة الطبيعية تختلف عن بعضها البعض، وبالتالي الطاقة الحيوية للتفاعل المحفز سيكون كذلك 1 القيود المفروضة على تقنية المعروضة في هذه المخطوطة. على قدم المساواة مختلفوينبغي وضع ameters لالظروف المثلى لنشاط انزيم أيضا لالركيزة الطبيعية (من خلال تغيير درجة الحموضة، نوع من العازلة، العازلة قوة، وتركيزات كلوريد الصوديوم والمنظفات مثل تريتون X-100، وغياب أو وجود الكاتيونات الثنائي التكافؤ مختلفة)، لأنها قد تتحول إلى أن تكون مختلفة قليلا عن الظروف المثلى اجه لالركيزة الاصطناعية. الحد آخر مهم هو انه من المحتمل ان لم يكن كلها (الفوسفات) يباسيس يمكن اكتشافها عن طريق استخدام ركائز اللونية الاصطناعية. على سبيل المثال، الاصطناعية بقايا ص -nitrophenyl من ركائز استر ببساطة قد يكون ضخمة جدا، أو يحمل الخواص الكيميائية الأخرى التي تمنع أن مثل هذه الركيزة يمكن الحصول على الوصول إلى موقع نشط من انزيم. ولوحظ أن داج الليباز SMc01003 عرض أنشطة منخفضة مع كل ركائز ص -nitrophenyl استر من أطوال سلسلة مختلفة 11. مع العلم بأن داغ هو الركيزة الطبيعية لSMc01003 والتي همرشولد ليختلطصغيرة atively رئيس مجموعة القطبية، التي تتكون من الجلسرين 11 فقط، بل هو تخيلها بسهولة أن ضخمة ص -nitrophenyl بقايا هو ببساطة كبيرة جدا لسهولة الوصول إلى موقع نشط من SMc01003. ومع ذلك، فإن التفاصيل الجزيئية لماذا ص استرات -nitrophenyl ليست ركائز جيدة للSMc01003 ليست معروفة في هذه المرحلة.

وتشمل الخطوات الحاسمة ضمن بروتوكول جميع الأحكام المتخذة لضمان أن إنزيم درس لديه حق الوصول إلى الركيزة منها. على سبيل المثال، في البحث عن الركيزة الدهون الفسيولوجية، فمن الأهمية بمكان أن يتم توفير الركيزة الدهون في شكل بالفاعلات. ولذلك، عند إعداد هذه المقايسات انزيم (الموصوفة في 5 من البروتوكول)، ركائز شحمي، وحلت عادة في خليط من الميثانول: الكلوروفورم، وينبغي أن تكون مختلطة مع محلول مائي من المنظفات، أي تريتون X-100، قبل تجفيف أسفل الخليط مع غاز النيتروجين. يضمن هذا الإجراء، بعد إضافة إنغري المتبقيةdients للمقايسة، وجزءا لا يتجزأ الركيزة الدهون المحتملة في المذيلات المنظفات وعلى هذا النحو يمكن الوصول للانزيم أثناء الفحص.

في المقام الأول، وينبغي أن تكون هذه التقنية المعروضة هنا ينطبق على نطاق واسع في المستقبل لاكتشاف (الفوسفات) يباسيس جديدة وتعريف ركائز الطبيعية. هذه التقنية قابلة للتوسيع بسهولة لفئات أخرى من هيدروليز، ولكن قد يكون أكثر تعقيدا لتطوير المقايسات مع ركائز اصطناعية لإنزيمات جديدة تتطلب اثنين، عادة معروفة، ركائز لاستكمال دورتهم الحفازة.

لتوقع (الفوسفات) يباسيس أو فوسفاتاز هو معروف لا الركيزة الصحيحة ولا الظروف فحص فيها انزيم يعمل بشكل جيد. لذلك، قد يكون من المفيد دراسة ما إذا كانت بعض مركب من بطارية من المركبات الاصطناعية، مثل ص متميزة المركبات المحتوية على -nitrophenyl -nitrophenyl الفوسفات، bis- ص -nitrophenyl الفوسفات، ص -nitrophenyl بالميتات)، قد تكون بمثابة الركيزة. وقد مهد اكتشاف الأنشطة الإنزيمية الأولية مع ركائز اصطناعية الطريق لحل تلك SMc00171 هو جهاز كمبيوتر معين فسفوليباز C أن SMc01003 هو الليباز داج 11، وساعد على تحديد الظروف التي يعمل SMc00930 كما هيدرولاز 11. ومن الواضح أن الركيزة الطبيعية من SMc00930 في الوقت الحاضر لا يزال غير معروف، والتي لا يزال يتعين حل سياقات الفسيولوجية للSMc00930 وSMc01003. لذلك، فإن مهمة اقتراح وظيفة فسيولوجية لالليباز المتوقعة هي صعبة وليس دائما اجتمع على الفور مع النجاح. باستخدام المسوخ التي تعاني من نقص في الجين الليباز المتوقعة ومقارنتها لنوع منها السلالة البرية قد تعطي الأدلة التجريبية التي الليباز يعمل مع خصوصية في خلفيتها السلالة الأصلية التي تم افتراضه في الجزء 4) من البروتوكول. ومن الواضح أن ادعاء ش النشاط الليباز جديدولد تكون معتمدة من قبل الأدلة في المختبر أن يتم تحويل ركيزة معينة عن طريق التحلل إلى منتجات محددة. في بعض الأحيان وظيفة فسيولوجية افترض قد ملء الفجوات في المسارات الأيضية أو شرح السلوك الفسيولوجي للكائن الحي إنتاج، ولكن في حالات أخرى هناك ببساطة لا يزال قد لا يكون كافيا المعرفة البيوكيميائية لفهم بعض الأنشطة. في سياق دراستنا، حددنا عدة الإنزيمات التي تعمل على الجوهرية الدهون غشاء القطبية من البكتيريا تحقيرهم و، في بعض الحالات، وتحويلها إلى لاعب في دورات الدهون أكثر تعقيدا. على سبيل المثال، والجمع بين المعرفة الجديدة التي SMc00171 هو جهاز كمبيوتر معين فسفوليباز C (PlcP) 8 التي يسببها تحت ظروف تحد من الفوسفور للنمو، مع البيانات الموجودة مسبقا، يمكن للمرء افتراض وداج دورة الرواية التي قد توجد في العديد من متقلبات البيئي و الذي يؤدي إلى تشكيل الدهون غشاء خالية من الفوسفور عندما الفوسفور-الحد من النمو. في مقاولاتAST، عندما إمدادات الفوسفور وفيرة، وrephosphorylated همرشولد حمض الفسفاتيديك تدخل من جديد الحيوي فوسفورية، وبالتالي إغلاق هذه الدورة الدهون وضمان أن أساسا (glycero) الفوسفورية موجودة في الغشاء 8،28.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

الكتاب ليس لديهم ما يكشف.

Acknowledgments

وأيد هذا العمل من المنح المقدمة من المجلس الوطني للعلوم بحوث والتكنولوجيا والمكسيك (CONACYT والمكسيك) (82614، 153998، 253549، و178359 في INVESTIGACION CIENTIFICA باسيكا وكذلك 118 في INVESTIGACION أون Fronteras دي لا Ciencia) ومن المديرية العامة لل Asuntos دي الشخصية Académico-الجامعة الوطنية المستقلة بالمكسيك (DGAPA-UNAM، PAPIIT IN202616، IN203612).

Materials

Name Company Catalog Number Comments
Chloroform JT Baker 9180-03 TLC analysis & Lipid extraction
Methanol JT Baker 9070-03 TLC analysis & Lipid extraction
Acetic Acid JT Baker 9507-05 TLC analysis & Lipid extraction
Hexanes JT Baker 9309-02 TLC analysis & Lipid extraction
Diethylether Sigma 32203 Enzymatic assays
bidistilled water  ANY  NA Enzymatic assays
Tris Base Sigma T-1503 Enzymatic assays
HCl Baker 9535-02 Enzymatic assays
NaCl Baker 3624-01 Enzymatic assays
Triton X-100 Sigma X-100 Enzymatic assays
LB broth ANY NA Bacterial growth, 10 g tryptone + 5 g yeast extract + 10 g NaCl per liter of bidistilled water
tryptone Becton Dickinson and Company 211705 Bacterial growth
yeast extract Becton Dickinson and Company 212750 Bacterial growth
TY broth ANY NA Bacterial growth, 8 g tryptone + 3 g yeast extract + 66 mg CaCl2·2H2O per liter of bidistilled water
CaCl2·2H2O Baker 1332-01 Enzymatic assays
isopropyl-β-D-thiogalactoside (IPTG) Invitrogen 15529-019 Bacterial growth
Diethanolamine Sigma D-8885 Enzymatic assays
MnCl2 Sigma 221279 Enzymatic assays
Phospholipase A2 snake venom Sigma P0790 Enzymatic assays
Phospholipase C Clostridium perfringens Sigma P7633 Enzymatic assays
Bis-p-nitrophenyl phosphate Sigma 07422AH Enzymatic assays
p-nitrophenyl stearate Sigma N3627 Enzymatic assays
p-nitrophenyl dodecanoate Sigma 61716 Enzymatic assays
p-nitrophenyl decanoate Sigma N0252 Enzymatic assays
p-nitrophenyl palmitate Sigma N2752 Enzymatic assays
p-nitrophenyl butyrate Sigma N9876 Enzymatic assays
p-nitrophenyl octanoate Sigma 21742 Enzymatic assays
Acetic Acid, sodium salt [1-14C] Perkin Elmer NEC084 Bacterial growth
dimethylsulfoxide (DMSO) JT Baker 9224-01 Enzymatic assays
Aluminium HPTLC silica gel 60 plates. Silica gel HPTLC plates size 20 x 20 cm, 25 sheets. Merck 105547 TLC analysis & Lipid extraction
Spectrometer UV/VIS Lambda 35 Perkin Elmer NA Enzymatic assays
Storm 820 Phosphorimager Molecular Dynamics NA Photostimulable Luminescence scanner 
Multipurpose Scintillation Counter Beckman Coulter NA Radioactivity Quantification
French Pressure Cell ThermoSpectronic NA  Breakage of cells
chromatography paper 3MM Chr Whatman 3030917 TLC analysis
Sinorhizobium meliloti 1021our reference 11 studied strain
Escherichia coli BL21 (DE3) pLysS Competent cells Novagen 69451 protein expression strain
pET9a vector Novagen 69431 protein expression vector
pET17b vector Novagen 69663 protein expression vector
sterile polystyrene round-bottom tube (14 ml) Falcon Becton Dickinson 352057 radiolabeling of bacterial cultures
polypropylene microcentrifuge tubes (1.5 ml) Eppendorf 30125.15 Enzymatic assays
1,2-dipalmitoyl-sn-glycerol Sigma D9135 lipid standard
L-α-phosphatidylcholine, dipalmitoyl Sigma P6267 lipid standard
DL-α-monopalmitin Sigma M1640 lipid standard
palmitic acid Sigma P0500 lipid standard

DOWNLOAD MATERIALS LIST

References

  1. Nelson, D. L., Cox, M. M. Lehninger, Principles of Biochemistry. W. H. Freeman and Company. New York. (2013).
  2. Jaeger, K. E., Eggert, T. Lipases for biotechnology. Curr. Opin. Biotechnol. 13, (4), 390-397 (2002).
  3. Dowhan, W., Bogdanov, M., Mileykovskaya, E. Functional roles of lipids in membranes. Biochemistry of Lipids, Lipoproteins and Membranes. 5th, Elsevier. Amsterdam, The Netherlands. 1-37 (2008).
  4. Dowhan, W. Molecular basis for membrane phospholipid diversity: why are there so many lipids? Annu. Rev. Biochem. 66, 199-232 (1997).
  5. De Rudder, K. E. E., Thomas-Oates, J. E., Geiger, O. Rhizobium meliloti mutants deficient in phospholipid N-methyltransferase still contain phosphatidylcholine. J. Bacteriol. 179, 6921-6928 (1997).
  6. Geiger, O., Röhrs, V., Weissenmayer, B., Finan, T. M., Thomas-Oates, J. E. The regulator gene phoB mediates phosphate stress-controlled synthesis of the membrane lipid diacylglyceryl-N,N,N-trimethylhomoserine in Rhizobium (Sinorhizobium) meliloti. Mol. Microbiol. 32, (1), 63-73 (1999).
  7. Klug, R. M., Benning, C. Two enzymes of diacylglyceryl-O-4'-(N,N,N,-trimethyl)homoserine biosynthesis are encoded by btaA and btaB in the purple bacterium Rhodobacter sphaeroides. Proc. Natl. Acad. Sci. USA. 98, (10), 5910-5915 (2001).
  8. Zavaleta-Pastor, M., et al. Sinorhizobium meliloti phospholipase C required for lipid remodeling duringphosphorus limitation. Proc. Natl. Acad. Sci. USA. 107, (1), 302-307 (2010).
  9. Pech-Canul, A., et al. FadD is required for utilization of endogenous fatty acids released from membrane lipids. J. Bacteriol. 193, (22), 6295-6304 (2011).
  10. Banerji, S., Flieger, A. Patatin-like proteins: a new family of lipolytic enzymes present in bacteria? Microbiology. 150, (Pt 3), 522-525 (2004).
  11. Sahonero-Canavesi, D. X., et al. Fatty acid-releasing activities in Sinorhizobium meliloti include unusual diacylglycerol lipase. Environ. Microbiol. 17, (9), 3391-3406 (2015).
  12. Fischer, M., Pleiss, J. The Lipase Engineering Database: a navigation and analysis tool for protein families. Nucl. Acid. Res. 31, (1), 319-321 (2003).
  13. Sigrist, C. J. A., et al. New and continuing developments at PROSITE. Nucleic Acids Res. 41, (Database issue), D344-D347 (2013).
  14. Lorenz, T. C. Polymerase Chain Reaction: Basic Protocol Plus Troubleshooting and Optimization Strategies. J. Vis. Exp. (63), e3998 (2012).
  15. Untergasser, A., et al. Primer3 - new capabilities and interfaces. Nucl. Acids Res. 40, (15), e115 (2012).
  16. Studier, F. W., Rosenberg, A. H., Dunn, J. J., Dubendorff, J. W. Use of T7 RNA polymerase to direct expression of cloned genes. Methods Enzymol. 185, 60-89 (1990).
  17. Miller, J. H. Experiments in Molecular Genetics. Cold Spring Harbor Laboratory Press. Plainview, NY, USA. (1972).
  18. Desjardins, P., Hansen, J. B., Allen, M. Microvolume Protein Concentration Determination using the NanoDrop 2000c Spectrophotometer. J. Vis. Exp. (33), e1610 (2009).
  19. Bligh, E. G., Dyer, W. J. A rapid method for total lipid extraction and purification. Can. J. Biochem. Physiol. 37, (8), 911-917 (1959).
  20. Molecular Dynamics. Phosphorimager SI User´s Guide. http://www.camd.lsu.edu/SAXS/Files/PIManual.pdf (1994).
  21. Dixon, M., Webb, E. Enzymes: Third Edition. Longman, USA. (1979).
  22. Rudolph, A. E., et al. Expression, characterization, and mutagenesis of the Yersinia pestis murine toxin, a phospholipase D superfamily member. J. Biol. Chem. 274, (17), 11824-11831 (1999).
  23. Kato, S., Yoshimura, T., Hemmi, H., Moriyama, R. Biochemical analysis of a novel lipolytic enzyme YvdO from Bacillus subtilis. Biosci. Biotechnol. Biochem. 74, (4), 701-706 (2010).
  24. Peppelenbosch, M. P. Kinome profiling. Scientifica (Cairo). Article ID 306798 (2012).
  25. Manafi, M., Kneifel, W., Bascomb, S. Fluorogenic and chromogenic substrates used in bacterial diagnostics. Microbiol. Rev. 55, (3), 335-348 (1991).
  26. Kuznetsova, E., et al. Enzyme genomics: Application of general enzymatic screens to discover new enzymes. FEMS Microbiol. Rev. 29, (2), 263-279 (2005).
  27. Scopes, R. K. Protein Purification, Principles and Practice. Springer. New York. (2010).
  28. Geiger, O., Lopez-Lara, I. M., Sohlenkamp, C. Phosphatidylcholine biosynthesis and function in bacteria. Biochim. Biophys. Acta. 1831, (3), 503-513 (2013).
تحديد الركيزة الخصوصيات لالليباز وفسفوليباز المرشحين
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Sahonero-Canavesi, D. X., Zavaleta-Pastor, M., Martínez-Aguilar, L., López-Lara, I. M., Geiger, O. Defining Substrate Specificities for Lipase and Phospholipase Candidates. J. Vis. Exp. (117), e54613, doi:10.3791/54613 (2016).More

Sahonero-Canavesi, D. X., Zavaleta-Pastor, M., Martínez-Aguilar, L., López-Lara, I. M., Geiger, O. Defining Substrate Specificities for Lipase and Phospholipase Candidates. J. Vis. Exp. (117), e54613, doi:10.3791/54613 (2016).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter