Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Biochemistry

Definiera substratspecificiteter för lipas och fosfolipas kandidater

doi: 10.3791/54613 Published: November 23, 2016

Abstract

Mikroorganismer producerar ett brett spektrum av (fosfo) lipaser som utsöndras, för att göra externa substrat tillgängligt för organismen. Alternativt kan andra (fosfo) lipaser fysiskt i samband med den producerande organism som orsakar en omsättning på inneboende lipider och ofta ger upphov till en ombyggnad av cellmembran. Även potentiella (fosfo) lipaser kan förutsägas med ett antal algoritmer när genen / proteinsekvensen är tillgänglig, experimentellt bevis på enzymaktiviteter, substrat särdrag och potentiella fysiologiska funktioner har ofta inte uppnåtts. Detta manuskript beskriver optimering av analysbetingelser för blivande (fosfo) lipaser med okända substrat särdrag och hur man kan använda dessa optimerade betingelser i sökandet efter det naturliga substratet av en respektive (fosfo) lipas. Med hjälp av artificiell kromogena substrat, såsom p-nitrofenyl-derivat, kan bidra till att upptäcka en mindreenzymatisk aktivitet för en förutsagd (fosfo) lipas under standardbetingelser. Efter att ha stött på en sådan mindre enzymatisk aktivitet, kan de distinkta parametrar för en enzymanalys varieras i syfte att erhålla en mer effektiv hydrolys av det artificiella substratet. Efter att ha fastställt de villkor som ett enzym fungerar väl, bör en mängd potentiella naturliga substrat analyseras för deras nedbrytning, en process som kan följas med användning av olika kromatografiska metoder. Definitionen av substratspecificiteter för nya enzymer, ger ofta hypoteser för en potentiell fysiologiska rollen för dessa enzymer, som sedan kan testas experimentellt. Efter dessa riktlinjer, kunde vi identifiera en fosfolipas C (SMc00171) som försämrar fosfatidylkolin att fosfokolin och diacylglycerol, i ett avgörande steg för ombyggnaden av membran i bakterien Sinorhizobium meliloti på fosfor begränsande förutsättningarna för tillväxt. För två förutsagda patatin-som fosfolipaser (SMc00930 och SMc01003) av samma organism, kan vi omdefiniera sina substratspecificiteter och klargöra att SMc01003 är en diacylglycerol lipas.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Glycerol baserade lipider såsom triacylglyceroler och (glycero) fosfolipider utgör viktiga och förmodligen den mest kända lipid klasser 1. Triacylglyceroler (taggar) är fetter eller oljor, som vanligtvis fungerar som förvarings lipider, och därmed som potentiell energi och kolkällor. TAG kan brytas ned av lipaser, som ofta utsöndras av den producerande organismen att smälta externa taggar och göra dem tillgängliga som kolkällor. Dessutom har lipaser studerats ingående under årens lopp på grund av deras viktiga biotekniska tillämpningar 2.

På grund av sin amfifila karaktär och deras nära cylindrisk form, (glycero) fosfolipider uppvisar membranbildande egenskaper och oftast utgör de viktigaste lipida komponenterna i en tvåskiktad membran 3. I enkla mikroorganismer, såsom bakterien Escherichia coli, endast tre stora huvudgrupp-varianter, fosfatidylglycerol (PG), kardiolipin (CL), och fosfatidylethanolamine (PE) påträffas, men man bör vara medveten om att var och en av dem kan ersättas med ett stort antal olika fettacylkedjor vid sn-1- eller sn-2 positionen som ger upphov till ett stort antal olika molekylslag 4 . Andra bakterier kan ha andra fosfolipider förutom eller i stället. Exempelvis Sinorhizobium meliloti, en jordbakterie, som är i stånd att bilda en kvävefixerande root knuta symbios med baljväxter alfalfa (Medicago sativa), innehåller förutom till PE en andra zwitterjonisk fosfolipid, fosfatidylkolin (PC) 5. Också, lipider som inte innehåller fosfor eller glycerol kan vara amfifil och utgör en del av det cellulära membranet. Till exempel, vid fosfor-begränsande tillväxtbetingelser, i S. meliloti, (glycero) fosfolipider är till stor del ersatts av membranlipider som inte innehåller fosfor, dvs, sulfolipider, ornitin lipider, och diacylglyceryl trimethylhomoserine (DGTS) 6. I bakterier, är DGTS bildas från diacylglycerol (DAG) i en tvåstegs vägen 7 men källan för DAG generationen var inte klart. Puls-chase experiment antydde att PC kan vara en föregångare för DGTS 8 och använda den metod som beskrivs i detta manuskript vi kunde identifiera en fosfolipas C (PLCP, SMc00171) som bildas under fosforbegränsande förhållanden och som kan omvandla PC till DAG och fosfokolin 8.

I en separat studie, upptäckte vi att en acyl-CoA-syntetas (FADD) med brist på mutant av S. meliloti eller av Escherichia coli ackumulerade fria fettsyror vid inträde stationära tillväxtfasen 9. Även om dessa fettsyror tycktes vara härledda från membranlipider, var den exakta källan för de fria fettsyrorna eller enzymet (enzymerna) befriande dem inte känd. Återigen, som använder den strategi som beskrivs i detta manuskript, två patatin liknande 10 (fosfo) lipaser (SMc00930 och SMc01003) som bidrog till bildandet av fria fettsyror i S. meliloti 11 förutsågs. Överraskande, används SMc01003 DAG som substrat omvandla den till monoacylglycerol och slutligen glycerol och fria fettsyror 11. Därför är SMc01003 en DAG lipas (DGLA).

Även om ett antal algoritmer finns för att förutsäga potentiell (fosfo) lipaser 12,13, deras exakta funktion och fysiologiska roll är oftast inte känt. Här redogör vi ett protokoll för att klona och överuttrycker förutsagda eller potentiella (fosfo) lipaser. Detta manuskript förklarar hur enzymanalyser kan utvecklas och optimeras för överuttryckt (fosfo) lipas med hjälp av artificiella kromogena substrat. Vi ger exempel på hur med en optimerad enzymanalys den verkliga (fosfo) lipassubstrat kan inträffa och hur dessa resultat kan berika vår förståelse av mikrobiell fysiologi.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Clone och överuttrycker strukturgenen för Förut lipas

  1. Användning av polymeraskedjereaktion (PCR) 14 och specifika oligonukleotider (tabell 1) 15, amplifiera genen av intresse (smc01003, smc00930 eller smc00171), förutspås koda för ett lipas eller fosfolipas, från det genomiska DNA: t i värdorganismen (dvs. , S. meliloti).
    1. Införa särskilda restriktionsställen (med den designade sekvensen av oligonukleotider). Smälta den amplifierade DNA-fragmentet med motsvarande restriktionsenzymer och klona den till en expressionsvektor såsom plasmider av pET-serien 16.
    2. Efter att ha kontrollerat den korrekta DNA-sekvensen för den klonade genen, transformera vektorn till en uttrycksstam såsom Escherichia coli BL21 (DE3) pLysS 16.
  2. Förbered en övernattning förodling av uttrycksvärden E. coli BL21 (DE3) pLYSS, härbärgerande respektive pET vektorn med den klonade genen eller tom vektor, i 100 ml odlingskolvar innehållande 20 ml av Luria Bertani buljong (LB) 17 plus de nödvändiga antibiotika. Kultur cellerna vid 30 ° C (eller på den vanliga tillväxttemperatur av bakterien från vilken lipas härrör).
    1. Använda natten pre-kulturer, ympa 500 ml förvärmt LB-medium (plus de nödvändiga antibiotika) i 2 L odlingsflaskor för att erhålla en initial optisk densitet vid 620 nm (OD 620) = 0,05. Följa tillväxten av kulturer och vid en OD 620 = 0,3, tillsätt isopropyl-β-D-tiogalaktosid (IPTG) till en slutlig koncentration av 100 | iM, och inkubera under omrörning vid 30 ° C under en period av 4 timmar.
    2. Vid slutet av inkubationsperioden, överför varje kultur till en 500 ml centrifugrör och centrifugera vid 5000 xg vid 4 ° C under 30 min. Resuspendera bakteriella cellpellets i 5 ml suspensionsbuffert (t.ex. SMc00930- och SMc01003-uttryckande celler i 50 mM Tris-HCl pH 8,0 och SMc00171-uttryckande celler i 50 mM dietanolamin-HCl pH 9,8). Lagra cellsuspensioner vid -80 ° C fram till användning.

2. Förbered Cellfria proteinextrakt och Bestäm Proteinkoncentration

  1. Tina bakteriella cellsuspensioner och förvara på is. Pass cellsuspensioner tre gånger genom en kall tryckcell vid 20.000 pund per i två. Avlägsna intakta celler och cellrester genom centrifugering vid 5000 xg under 30 min vid 4 ° C.
  2. Efter centrifugering, framställning av alikvoter av 100 och 500 pl från supernatanten för efterföljande analys och förvara dem vid -80 ° C fram till användning.
  3. Använda en av de 100 | j, l alikvot för att bestämma proteinkoncentration av distinkta cellfria extrakt genom ett förfarande för val eller såsom beskrivs 18.

3. Använd artificiella substrat för att optimera enzymVerksamhet (fosfo) lipaser

  1. För en inledande täckning av distinkt enzymaktiviteter, använder artificiella substrat som ger en färgad produkt vid hydrolys, såsom p-nitrofenol (p -NP).
    1. För enzymanalyser redan optimerade med konstgjorda p-nitrofenylester substrat (anges för fosfolipas C PLCP (SMc00171), liksom för de förutsagda patatin liknande fosfolipaser SMc00930 och SMc01003), pipetteringssystem användning som beskrivs i tabell 2.
    2. När utforska en ny potentiell (fosfo) lipas, förbereda en första standarden enzymanalys innehållande 50 mM Tris-HCl, pH 8,5, 100 mM NaCl, 0,05% Triton X-100, 0,5 mM p-nitrofenyl-innehållande förening (p-nitrofenylfosfat , bis-p-nitrofenylfosfat, p-nitrofenyl dekanoat, eller p-nitrofenyl-palmitat), och cellfria proteinextrakt (kontrollera en, 3, 10, 30, 100, 300, och 1000 | j, g) i en total volym av 1 ml i 1 ml plast cuvettes.
      NOTERA: Använd alkaliskt pH (Figur 1) när man följer p-nitrofenyl esterhydrolys i en kontinuerlig analys. Alternativt, använda enstaka tidspunkts analyser för ett intervall av pH-värden, tillsättning av NaOH, vid slutet av inkubationsperioden för att avsluta enzymreaktionen och för att säkerställa att all p -NP är närvarande i fenolat form.
    3. Följa tidsförloppet för en ökning av absorbans vid 405 nm, beroende på bildningen av p -NP, i en spektrofotometer vid 30 ° C under en 5-minutersperiod. Kvantifiera den initialt linjära bildandet av p -NP genom att bestämma den initiala lutningen av ökningen av absorbans per tidsenhet.
    4. Beräkna förändringen av koncentration (AC) för p -NP använda lagen om Lambert-Beer (AA = ε AC d) ett.
      OBS: AA är den linjära förändringen av absorbans bestäms är ε den molära extinktionskoefficienten vid respektive våglängd (i enheter av M -1 -1), d är längden för ljusbanan (1 cm), och AC är förändringen av koncentration (i enheter av M) som skall bestämmas.
      1. Med tanke på att analysvolymen är 1 ml, beräkna mängden av p -NP bildas.
        OBS: Mängd = koncentration x volym.
      2. Beräkna enzymaktiviteten genom att dividera mängden av p -NP bildas av den tid under vilken den bildas. Bestämma den specifika enzymaktiviteten genom att dividera enzymaktivitet av mängden protein (i mg) som var ansvarig för att generera denna aktivitet.
    5. Jämför absorbansförändringar provocerade av proteinextrakt i vilket en kandidatgen (smc00171, smc00930 eller smc01003) hade uttryckts med extrakt som hyser endast en tom vektor.
      OBS: För att kunna fortsätta med följande steg, bör särskilda åtgärder, som orsakas av proteinextrakt i vilket en kandidatgen hade uttryckts, vara minst dubbelt eller mmalm än värdena för de specifika aktiviteter som orsakas av proteinextrakt som hyser endast en tom vektor.
    6. För ytterligare experiment, välja de tillstånd i vilka hydrolys av p-nitrofenyl-innehållande föreningen är minimal med cellfria extrakt (dvs tom vektor) och för vilka den mest uttalade bildningen av p -NP och p -nitrophenolate anjonen (Figur 1) kan observeras när proteinextrakt användes, i vilken en kandidatgen hade uttryckts.
  2. Efter bestämning av initial enzymaktivitet i 3,1, optimera analysbetingelserna för respektive enzym genom att variera pH, typ av buffert, buffert styrka, koncentrationer av NaCl, detergenter såsom Triton X-100, och frånvaro eller närvaro av olika tvåvärda katjoner.
    1. För olika koncentrationer av varje variabel, bestämma den specifika enzymaktiviteten (se 3.1.4.2) (det högsta värde som erhålls definierar villkoretav maximal enzymaktivitet). Använda kombinationen av de optimala förhållanden som förekommer för varje variabel för att definiera en optimerad enzymanalys i vilken varje variabel är närvarande i dess optimala koncentration.

Figur 1
Figur 1. p-nitrofenyl-estrar som artificiella substrat för (fosfo) lipaser i en spektrofotometrisk analys. Vid hydrolys av p-nitrofenyl-estrar, är en syra (R-OH) och p-nitrofenol (p -NP) bildas. På grund av den pK ^ = 7,2 för dissociationen av den fenoliska H + från p -NP, vid ett pH> 9,2 mer än 99% är i den ljusa gula p -nitrophenolate form och en molär extinktionskoefficient av 18.000 M -1 cm - 1 kan användas vid en våglängd av 405 nm för kvantifiering av fri p -nitrophenolate 22. När buffertar med ett pH-värde av 8,5 användes, var absorbansen bestämdes vid 400 nm och en molar extinktionskoefficient av 14.500 M -1 cm -1 användes 23. Klicka här för att se en större version av denna siffra.

OBS: Efter att ha definierat de optimala förutsättningarna för aktiviteten hos enzymet av intresse, inleda sökandet efter den verkliga / fysiologiska substrat av detta lipas. I princip ta två, ofta kompletterande metoder för att uppnå detta mål, en in vivo metod eller en in vitro metod.

4. In vivo Identifiering av Physiological Substrat av en Lipas

ove_content "> OBS:. I en in vivo metod, uttrycka lipas av intresse i en värdorganism 8,11 för att registrera tiden om uttryck av lipas ändrar host's lipidprofilen I en annan in vivo tillvägagångssätt, generera en mutant brist av genen av intresse 8,11 och undersöka om dess lipidprofilen skiljer sig från vildtypen version 6,8,11. för att få en kvantitativ bedömning av en organisms lipidprofilen, en enkel metod består i radiomärkning cellulära föreningar , extrahera lipider, separera dem genom kromatografi, och kvantifiera radioaktivt märkta separerade lipider.

  1. Radiomärkning av lipider.
    1. Förbered en övernattning förodling av en organism av intresse (E. coli eller S. meliloti) i 5 ml av den önskade odlingsmedium (komplext medium eller definierat minimalt medium) och växa vid 30 ° C.
    2. Från pre-kultur, ympa in 20 ml av samig färskt medium i en 100 ml odlingskolv för att erhålla en initial OD 620 = 0,3 för odlingen.
    3. Tag en alikvot (1 ml) av kulturen under sterila betingelser och överför till en 14 ml steril polystyren rundbottnad röret.
    4. Tillsätt 1 pCi av [1- 14 C] acetat (60 mCi per mmol) till en ml kultur.
    5. Inkubera det flytande odlings under omröring vid 30 ° C under en period av 24 h.
    6. Vid slutet av inkubationsperioden, överföra kulturen till ett 1,5 ml mikrocentrifugrör och centrifugera vid 12000 xg vid rumstemperatur under 5 min.
    7. Återsuspendera pelleten i 100 pl vatten. Vid denna punkt, lagra cellsuspensionen vid -20 ° C eller omedelbart fortsätta med utvinning av polära lipider (avsnitt 4.2).
  2. Extraktion av polära lipider.
    OBS: Den metod som beskrivs här väsentligen följer det förfarande som rapporteras av Bligh och Dyer 19.
    1. Till 100 pl vattencell suspension, tillsätt 375 | il metanol: kloroform-lösning (2: 1; vol / vol).
    2. Vortex under 30 s och inkubera i 5 min vid rumstemperatur.
    3. Centrifugera 5 minuter vid 12.000 xg vid rumstemperatur.
    4. Överför supernatanten till ett nytt 1,5 ml mikrocentrifugrör.
    5. Lägg 125 ul kloroform och 125 pl vatten, virvel 30 sek.
    6. Centrifugera 1 min vid 12.000 xg vid rumstemperatur.
    7. Överföra den undre kloroformfasen till ett nytt rör och torka med en ström av kvävgas.
    8. Lös upp torkade lipider i 100 ul av kloroform: metanol-lösning (1: 1; vol / vol).
      OBS: Vid denna punkt kan en alikvot av 5 | il av lipidlösningen kvantifieras genom vätskescintillationsräkning.
    9. För tunnskiktskromatografisk (TLC) -analys, torka ner de kvarvarande 95 | il med en ström av kvävgas och återupplösa torkade lipiderna i 20 pl kloroform: metanol-lösning (1: 1; vol / vol). Använd en 3 l alikvotför TLC-analys.
  3. Separation av polära lipider från tunnskiktskromatografi (TLC).
    OBS! Beroende på de lipidklasser som skall analyseras, kan olika kombinationer av fasta och rörliga faser användas för separation. Här en typisk separation för laddade polära lipider och en annan, mer lämpade för neutrala polära lipider, med hjälp av högpresterande tunnskiktskromatografi (HPTLC) silikagel aluminiumplåtar som den fasta fasen, beskrivs.
    1. Separation av laddade polära lipider genom tvådimensionell TLC (2D-TLC).
      1. Tillämpa en 3 | il alikvot av lipid prov i ett hörn av en HPTLC silikagel aluminiumplåt (10 x 10 cm), 2 cm från kanten av plattan.
      2. Förbereda och blanda den mobila fasen (140 ml kloroform, 60 ml metanol och 10 ml vatten) för separation i den första dimensionen.
      3. Coat en TLC framkallningskammaren internt med kromatografi papper.
        OBS: Detta är för att säkerställa att gasfasen av kammarenkommer vara mättad snabbt (inom 30 min) efter den mobila fasen för den första dimensionen har lagts till kammaren och kammaren har stängts med en glasplatta.
      4. Förbereda och blanda den mobila fasen (130 ml kloroform, 50 ml metanol och 20 ml isättika) för separation i den andra dimensionen och överföring till en andra TLC framkallningskammaren invändigt belagd med kromatografi papper och låt kammaren mättad.
      5. Noggrant överföra HPTLC kiselgel aluminiumplåt med lipid prov torkat till den första kammaren och utveckla (dvs. utför kromatografi) plattan i 60 minuter i den slutna kammaren i den första dimensionen 5.
      6. Avlägsna plattan från kammaren och låt lösningsmedel torka i en flöde huva i 30 min.
      7. Efter vridning av plattan med 90 grader med avseende på den föregående kromatografi, överföra HPTLC silikagel aluminiumplåt, på vilken lipiderna har separerats i en dimension, till second kammaren och framkallas plattan under 60 minuter i den andra dimensionen 5.
      8. Avlägsna arket från kammaren och låta lösningsmedlen torka i ett flöde huva i minst 2 timmar.
    2. Separation av neutrala polära lipider.
      1. Applicera 3 il alikvoter av lipid prover på en HPTLC silikagel aluminiumplåt med start 2 cm från kanterna på plattan. Om flera prover analyseras i en endimensionell kromatografi hålla ett avstånd på minst 1,5 cm mellan de olika provapplikations fläckar.
      2. Förbered och blanda den mobila fasen (140 ml hexan, 60 ml dietyleter, och 8 ml ättiksyra) och överför till en TLC framkallningskammaren internt belagda med kromatografi papper och täckt med en glasplatta för att låta kammaren mättad (30 min).
      3. Överföra HPTLC silikagel aluminiumplåt med de torkade lipid-proven till kammaren och utveckla plattan under 30 minuter i den stängda kammaren.
      4. Avlägsna plattan från kammarenoch låta lösningsmedlen torka i ett flöde huva under 2 h.
  4. Kvantifiering och visualisering av separerade polära lipider.
    1. När den utvecklade TLC arket är torrt, inkubera den med en fotostimulerbara luminescens (PSL) sikt i en sluten kassett i 3 dagar.
    2. Exponera den inkuberade skärmen till en PSL scanner och förvärva en virtuell bild av de separerade radiomärkta lipider.
    3. Utföra kvantifiering med användning av PSL programvara 20.
  5. Visualisering och isolering av individuella polära lipider klasser.
    1. Inkubera utvecklade TLC blad för 10 min i en kromatografi kammare i närvaro av 1 g jodkristaller.
      OBS: Separerad lipida föreningar löser jod och visas som brunaktiga fläckar.
    2. Cirkel fläckarna med en penna, jämföra dem med den relativa rörlighet (Rf) av standardföreningar (dvs 1,2-dipalmitoyl-sn-glycerol, dipalmitoyl-L-α-phosphatidylcholine, DL-α-monopalmitin eller palmitinsyra), och identifiera vilken lipid klass de skulle tillhöra.
    3. I ett dragskåp, låt jod avdunsta från TLC arket.
    4. Med hjälp av en spatel, skrapa silikagelen innehållande föreningen av intresse från arket och extrahera föreningen från kiselgelen med en blandning av 100 | il vatten och 375 | il metanol: kloroform-lösning (2: 1; vol / vol).
    5. Fortsätt med utvinning enligt Bligh och Dyer som beskrivs (4.2.2 och framåt).
    6. Store renad lipid klass i 100 pl kloroform: metanol-lösning (1: 1; vol / vol) vid -20 ° C fram till användning.

5. In vitro Identifiering av Physiological Substrat av en Lipas

OBS: I en in vitro metod, studera om lipaset av intresse kan omvandla en blandning av isolerade lipider eller enskilda rena lipider till motsvarande hydrollys produkter enligt de villkor som anges som optimalt 3,2.

  1. Använd pipettering system för enzymanalyser enligt tabell 3 för PC-specifika fosfolipas C SMc00171 (se 5.2), fosfolipas A (se 5.3), och DAG lipas SMc01003 (se 5.4) aktivitet.
  2. Fastställande av PC-specifika fosfolipas C-aktivitet (tabell 3).
    1. Till en 1,5 ml mikrocentrifugrör, tillsätt 5,000 räkningar per minut (cpm) av det totala 14 C-märkt PC och en lösning av Triton X-100.
    2. Blanda och torka under en ström av kväve.
    3. Lägg dietanolamin-HCI, pH 9,8 buffert, liksom NaCl och MnCl2 lösningar och dubbeldestillerat vatten för att erhålla en slutlig volym på 99,5 l. Vortex i 5 sek.
    4. Tillsätt 0,5 | il enzym (5 | j, g protein) (dvs., ett cellfritt extrakt i vilket överuttryckt SMc00171 är närvarande) för att initiera reaktionen. Blanda kort.
    5. Inkubera vid 30 ° C under 4 h.
    6. Stoppa reaktionen genom att dentillsats av 250 | il metanol och 125 jil kloroform.
    7. Utdrag lipider som beskrivits tidigare (se 4.2).
    8. Separata lipider med endimensionella (1D) -TLC (se 4.3.2 och 4.4), och analysera dem genom PSL avbildning.
  3. Fastställande av fosfolipas A-aktivitet (tabell 3).
    1. Till en 1,5 ml mikrocentrifugrör, tillsätt 5000 cpm av den totala 14 C-märkt fosfolipider och en lösning av Triton X-100.
    2. Blanda och torka under en ström av kväve.
    3. För en slutlig 100 ul assay, tillsätt Tris-HCl, pH 8,5-buffert, NaCl-lösning och vatten. Vortex i 5 sek.
    4. Tillsätt 5 | il enzym (50 | j, g protein) (dvs., ett cellfritt extrakt i vilket överuttryckt SMc00930 eller SMc01003 är närvarande).
    5. Inkubera vid 30 ° C under 5 h.
    6. Stoppa reaktionen genom tillsats av 250 | il metanol och 125 jil kloroform.
    7. Utdrag lipider som beskrivits tidigare (se 4.2), separatadem genom 1D-TLC med användning av 130 ml kloroform, 50 ml metanol och 20 ml isättika som mobil fas, och analysera dem genom PSL avbildning.
  4. Fastställande av diacylglycerol (DAG) lipasaktivitet.
    1. Framställning av 14 C-märkt DAG.
      1. Radiomarkör S. meliloti kulturer (se 4.1) och extrahera polära lipider (se 4.2) som beskrivs. Separat S. meliloti totala lipid extrakt av 1D-TLC i kloroform: metanol: ättiksyra (130: 50: 20; vol / vol) med användning av betingelser som beskrivits för separation i andra dimensionen i 4.3.1.
      2. Visualisera PC med jod färgning och använda en penna för att markera lokaliseringen av fosfatidylkolin (PC).
      3. Isolera radiomärkt PC som beskrivs i 4.5.
      4. Kvantifiera extraherade dator genom scintillationsräkning.
        OBS: Om 320.000 cpm PC förväntas.
      5. Behandla PC (250.000 cpm) med 0,1 U av fosfolipas C från Clostridium perfringens i 50 mM Tris-HCl, pH 7,2, 0,5% Triton X-100 och 10 mM CaCl2 under 2 timmar i en total volym av 100 | j, l och stoppa reaktionen genom tillsats av 250 | il metanol och 125 jil kloroform.
      6. Utdrag lipider som tidigare och separat beskrivs av dem 1D-TLC (se 4.3.2).
      7. Isolera diacylglycerol från kiselplattan och kvantifiera genom scintillationsräkning (som beskrivs i punkt 4.2)
    2. Diacylglycerol lipasanalys (tabell 3).
      1. Till en 1,5 ml mikrocentrifugrör, tillsätt 5000 cpm av 14 C-märkt DAG och en lösning av Triton X-100.
      2. Blanda och torka under en ström av kväve.
      3. För en slutlig 100 ul assay, tillsätt Tris-HCl (pH 9,0) buffert, en NaCl-lösning och dubbeldestillerat vatten. Vortex i 5 sek.
      4. Initiera reaktionen genom tillsats av 5 | il enzym (50 | j, g protein av cellfritt extrakt).
      5. Inkubera vid 30 ° C under 4 h.
      6. Stoppa reaktionen genom tillsats av 250 pl metanol end 125 | il kloroform och extrahera lipider som beskrivits tidigare (se 4,2).
      7. Analysera neutrala polära lipider av 1D-TLC (se 4.1.3.2) och efterföljande PSL avbildning.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Aktiviteten för PC-specifika fosfolipas C SMc00171 med bis- p-nitrofenylfosfat

Cellfria extrakt som erhållits från E. coli BL21 (DE3) x pLysS, som hade smc00171 uttryckas, studerades med avseende på deras förmåga att hydrolysera bis- p-nitrofenyl fosfatestrar, under användning av en spektrofotometrisk enzymatisk analys, mätning av p -NP bildas. Ingen hydrolytisk aktivitet var närvarande i cellfria extrakt som erhållits från E. coli BL21 (DE3) x pLysS som bar en tom pET9a-vektorn (data ej visade) när bis-p-nitrofenylfosfat användes som substrat.

Tidsförlopp för p -NP bildas indikerar att det finns ett starkt beroende på mängden av cellfritt extrakt (från E. coli BL21 (DE3) x pLysS, som hade smc00171 uttryckt) sattes till analysen (Figur 2A). Om mängden av p -NP bildad produkt skulle bero enbart på enzymkoncentrationen, ska observeras en linjär korrelation mellan enzym (protein) koncentration som användes och produkten som bildas efter en viss tid. Detta är naturligtvis inte fallet för cellfria extrakt som erhållits från E. coli BL21 (DE3) x pLysS, som hade smc00171 uttryckt (Figur 2B). Även om det kan finnas flera orsaker till en exponentiell beroende av enzymaktivitet på proteinkoncentration 21, är en vanlig orsak till att vid spädning av ett enzyminnehållande proteinextrakt, andra komponenter i extraktet som kan vara begränsande för enzymaktivitet, dvs potentiella kofaktorer , späds också. I sådana fall är oväntat låga enzymaktiviteter registreras med utspädda cellfria extrakt. Genom att inkludera en mättande koncentration av 3 mM MnCl2 i enzymanalysen, p -NP Produkt som bildas efter en viss tid beror enbart på mängden tillsatt enzym (data ej visade) vilket indikerar att MnCl2 var en begränsande komponent för SMc00171 aktivitet i cellfria extrakt av E. coli.

figur 2
Figur 2. Fastställande av SMc00171 (fosfolipas) aktivitet med hjälp av artificiellt substrat bis-p-nitrofenylfosfat. Tidsförloppet för p -NP bildning visas användning av cellfria proteiner extrakt (● 10 mikrogram / ml, ■ 15 mikrogram / ml, ▲ 20 | ig / ml), i vilken SMc00171 hade uttryckts (A). p -NP bildas efter 40 min av inkubation med olika mängder av cellfria proteiner extrakt i vilka SMc00171 hade uttryckts (B). Felstaplar indikerar standardavvikelsen..jove.com / filer / ftp_upload / 54.613 / 54613fig2large.jpg "target =" _ blank "> Klicka här för att se en större version av denna siffra.

Aktiviteter av förväntat patatin liknande fosfolipaser SMc00930 och SMc01003 med p-nitrofenyl acylestrar med olika kedjelängder

Efter expression av smc00930 eller smc01003 i E. coli BL21 (DE3) x pLysS, cellfria extrakt erhölls och studerades med avseende på deras förmåga att hydrolysera p-nitrofenyl-fettsyra acylestrar. Under enzymatisk analys, var p -NP bildade bestämdes i en spektrofotometer. Smärre hydrolytiska aktiviteter var närvarande i cellfria extrakt som erhållits från E. coli BL21 (DE3) x pLysS med en tom pET17b vector (tabell 4), när p-nitrofenyl acylestrar av different kedjelängder användes som substrat. När smc01003 uttrycktes, extrakten erhållna visade en ökad hydrolys av p-nitrofenyl-estrar av olika kedjelängder. SMc01003 degraderas med medellånga kedjor p-nitrofenyl dekanoat samt den långkedjiga p-nitrofenyl-palmitat och p-nitrofenyl-stearat (tabell 4). Som SMc01003 är en viktig bidragsgivare för bildandet av långkedjiga fria fettsyror i S. meliloti under stationär fas 11, var det överraskande att SMc01003 tycktes verka lika bra på medellång kedja än på långkedjiga p-nitrofenyl acylestrar (tabell 4). Oväntat agerar SMc01003 också på kortkedjiga substrat såsom p-nitrofenyl butyrat eller p-nitrofenyl-oktanoat (data ej visade). Men dessa senare substrat också ned av aktiviteter som finns i cellfria extrakt av E. coli (dvs., hysande den tomma vecteller pET17b) utan att uttrycka någon extra gen och med kortkedjiga substrat (C4), hälften av substratet redan ned av E. coli inneboende enzymer (data visas ej). Uppenbarligen behöver SMc01003 renas i syfte att klargöra huruvida SMc01003 fungerar lika bra på kort, medellång och lång kedja substrat. I allmänhet, p-nitrofenyl acylestrar verkar inte vara goda substrat för SMc01003 som kan vara förståeligt att veta att SMc01003 är i själva verket en DAG lipas 11. Cellfria extrakt, i vilka smc00930 hade uttryckts, visar mycket högre enzymaktiviteter med p-nitrofenyl-estrar (tabell 4). Dessutom är SMc00930 kunna hydrolysera p-nitrofenyl acylestrar med olika kedjelängder (C10, C12, C14, C16 och C18), även om p-nitrofenyl-palmitat (specifik aktivitet 5,5 mmol NP min - 1 mg protein - 1) är helt klart den bästa substrat för SMc00930. Hittills physiologiska substrat för SMc00930 är inte känd.

Undersöka om Polar Lipids kan fungera som substrat för förmodas (fosfo) lipaser

När en (fosfo) lipas enzymatisk analys har optimerats med artificiella substrat, radiomärkta lipid blandningar eller rena lipider kan testas som potentiella substrat.

När analys SMc00171-innehållande cellfria extrakt med 14 C-märkt PC under optimerade förhållanden kan vi visa att SMc00171 degraderar PC till DAG, ett resultat som bekräftades av masspektrometriska undersökningar 8. SMc00171 försämrar också 32 P-märkt dator till fosfokolin och därför fungerar som en PC-specifikt fosfolipas C (PLCP) 8, som induceras i fosfor begränsande förutsättningarna för tillväxt.

Näranalys SMc00930- eller SMc01003-innehållande cellfria extrakt med 14 C- eller 32 P-märkta totala polära lipider under optimerade förhållanden, kunde vi visa att ingen av de fosfolipider bryts ned av SMc00930 eller SMc01003 under betingelser där p-nitrofenyl acylestrar funge som substrat 11. I kontrast, en kommersiell fosfolipas A2 från ormgift kunde bryta ned en sådan blandning av fosfolipider 11. Dessa resultat var överraskande och oväntat eftersom både SMc00930 och SMc01003, förutsågs att patatin liknande fosfolipaser.

Vid analys av SMc00930- eller SMc01003-innehållande cellfria extrakt med 14 C- märkt diacylglycerol (DAG) under optimerade betingelser, kunde vi visa att DAG inte bryts ned av SMc00930 eller genom cellfria extrakt av E. coli, medan SMc01003 degraderar DAG och bildar föreningar som migrerar som fria fettsyror (figur 3). Nyligen kunde vi visa att SMc01003 fungerar som en DAG lipas som kan försämra DAG eller monoacylglycerol till glycerol och fria fettsyror 11 (Figur 4).

Figur 3
Figur 3. SMc01003 försämrar diacylglycerol. Cellfria extrakt av E. coli BL21 (DE3) × pLysS som uttrycker SMc01003, SMc00930 eller innehåller den tomma pET17b vektorn, eller buffert inkuberades med 14 C-DAG (erhållen från S. meliloti) under 24 timmar. Vid slutet av de respektive inkubationsperioder, var radiomärkta lipider extraherades och separerades genom 1D-TLC med användning av den mobila fasen för att separera neutrala polära lipider (se 4.3.2). FA, fettsyror; DAG, diacylglycerol. Denna siffra har modifierats [Sahonero-Canavesi et al. 2015] 11.3large.jpg "target =" _ blank "> Klicka här för att se en större version av denna siffra.

figur 4
Figur 4. Enzymatisk funktion av diacylglycerol lipas DGLA (SMc01003). Diacylglycerol (DAG) lipas SMc01003 degraderar DAG att monoacylglycerol och en fettsyra, och sedan degraderar monoacylglycerol vidare till glycerol och en annan fettsyra. Klicka här för att se en större version av denna figur.

oligonukleotid
namn
Sekvens
(5'-3 ')
Gen
av intresse
enzymrestriktions
ställe tillsatt
Vektor
för expression
oLOP149 AGGAATA CATATG CTGAACTGGACATTCACG smc01003 Ndel pET17b
oLOP150 ACGG CTCGAG TCAACGGGACAGCGGTTC smc01003 Xho I pET17b
oLOP151 AGGAATA CATATG ACGGAGGTGGCGATGG smc00930 Ndel pET17b
oLOP152 AAA GGATCC TTATATCCCTTTCCTCCACC smc00930 BamHI pET17b
cgpho171u AGCT CATATG GCGGCGGCATCGGCACCCCACAG smc00171 Ndel pET9a
cgpho171d ACGT GGATCC TCAGGCGGCCTGCGGTGCGAACC smc00171 BamHI pET9a
Bokstäver i fetstil indikerar restriktionsställen.

Tabell 1. Oligonukleotider som används för att förstärka och klon förutspådde fosfo (lipas) gener i pET17b eller pET9a vektor. Primer oligonukleotider utformades med hjälp av den beskrivna programvaran 15.

Analys för SMc00171 Analys för SMc01003 Analys för SMc00930
Stock Komponent
Tris-HCl, pH 8,5 25 ^
2 M Tris-HCl, pH 9,0 25 ^
1 M dietanolamin-HCI, pH 9,8 50 ^
1 M NaCl 40 ^ 150 ^ 150 ^
1% Triton X-100 200 ^ 200 ^
50 mM p- nitrofenyl palmitat 12,5 | il 12,5 | il
200 mM bis- p- nitrofenylfosfat 2.5 | j, l
cellfritt extrakt (1 mg protein / ml) med kandidatgen uttryckt 20 ^ 100 ^ 1 pl
dubbeldestillerat vatten 887.5 | il 512,5 | j, l 611,5 | j, l
slutlig Volym 1 ml 1 ml 1 ml

Tabell 2. Pipetterings system för optimerad enzymanalyser med artificiell p-nitrofenylester substrat.

Analys för smc00171 kodat Fosfolipas C Analys för smc01003 - kodad DAG lipas Optimerad analys för fosfolipas A-aktivitet
Stock Komponent
2 M Tris-HCl pH 8,5 2.5 | j, l
2 M Tris-HCl pH 9,0 2.5 | j, l
100 mM MnCl2 3 pl
1 M Dietanolamin-HCl pH 9,8 5 pl
1 M NaCl 4 | j, l 15 ^ il 15 ^ il
1% Triton X-100 2 ^ 20 ^ 20 ^ 14 C-märkt lipid (fosfolipider) 20 ^ (5000 cpm)
14 C-märkt lipid (PC) 20 ^ (5000 cpm)
14 C-märkt lipid (DAG) 20 ^ (5000 cpm)
10 mg / ml Proteinextrakt med uttryckta gener 0,5 ^ 5 pl 5 pl
dubbeldestillerat vatten 87,5 | il 77,5 | il 77,5 | il
slutlig volym 100 ^ 100 ^ 100 ^

Tabell3. Pipetterings system för optimerad enzymanalyser för (fosfo) lipaser med radiomärkta lipidsubstrat.

aktivitet ges i enheter (imol nitrofenol / mg protein x min)
Fetstil siffror indikerar acyl kedjelängd av p-nitrofenyl-ester-substrat 10 12 14 16 18
E. coli-extrakt (bakgrund) 16 ± 0,3 10 ± 1,1 13 ± 0,3 11 ± 0,8 10 ± 0,6
SMc00930 uttryckt i E. coli-extrakt 1839 ± 283 2873 ± 117 5517 ± 394 3402 ± 65
SMc01003 uttryckt i E. coli-extrakt 43 ± 2,1 29 ± 2 20 ± 0,7 25 ± 1,5 22 ± 0,9
SMc00930 minus bakgrund 1823 ± 283 1829 ± 283 2860 ± 117 5506 ± 394 3392 ± 65
SMc01003 minus bakgrund 27 ± 2,1 18 ± 2 7 ± 0,7 14 ± 1,5 12 ± 0,9

Tabell 4. p-nitrofenyl acylestrar som substrat för patatin liknande lipaser SMc00930 och SMc01003.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Under de senaste 20 åren, har genomen hos många organismer sekvenserats och även en mängd genomsekvensdata har genererats, är funktionell tolkning släpar efter och hindrar därför vår förståelse av genomet funktion. Genfunktioner i genomen ofta tilldelas baserat på likhet med gener med känd funktion eller förekomst av bevarade motiv. Emellertid är den exakta funktionen av en given gen ofta inte känd. Speciellt förutspådde strukturella gener för enzymer kan inte vara lätt att utforskas med miska tekniker på grund av det faktum att de flesta enzymer katalyserar komplexa reaktioner som involverar två substrat och två produkter. För närvarande verkar det mer möjligt att utforska substrat särdrag för grupper av enzymer där åtminstone ett substrat är fastsatt och där den andra kan varieras. Till exempel, i eukaryoter flesta fosforylering motiv i proteiner är kända och konsensus peptider för kinaser har setts på fasta bärare för att generera peptid arstrålar. Med användning av sådana matriser och radiomärkt ATP, substrat särdrag och aktivitetsnivåer olika kinaser av en organism kan bestämmas medger inrättandet av en kinome profil och definiera substratspecificiteter 24. Hydro komponera en annan stor grupp av enzymer som ett substrat, vatten, är fast men som den exakta arten av den (andra) substrat som skall hydrolyseras är ofta inte känd. Det faktum att för ett nytt enzym de optimala analysförhållanden inte är kända antingen omvandlar detekteringen av en ny enzymaktivitet i en multivariabel problem. Det kan därför bidra till att kunna fastställa det substrat som hydrolyseras för att fastställa på vilka villkor enzymet fungerar bäst.

I föreliggande manuskript, beskriver vi optimering av analysbetingelser för blivande (fosfo) lipaser med okända substrat särdrag och utarbeta hur man använder dessa optimerade betingelser i sökandet efter det naturliga substratet av återperspektiv (fosfo) lipas. Betydelsen av föreliggande teknik består i det faktum att hydrolysen av fluorogena eller kromogena, artificiella substrat, som efterliknar naturliga substrat i viss utsträckning, kan följas av spektrofotometri 25 och att dessa analyser är lätt att tillämpa för storskalig Studier 26. På grund av känsligheten hos sådana analyser och deras enkelhet att övervaka reaktionen, kan de lätt optimeras för ett givet enzym. Uppenbarligen, för artificiella substrat man kan förvänta sig mindre fördelaktiga kinetiska konstanter (dvs hög K M, låg kcat) för ett specifikt enzym än för naturliga substrat 1,21. I praktiken är emellertid den enkla tillgängligheten och detekterbarheten av artificiella substrat som fungerar som (dåliga) substrat för hela grupper av enzymer ofta mer än kompensera nackdelarna. När har stött villkoren för ett enzym för att arbeta (med artificiellt substrat), kommer det att göra det med natural / fysiologiska substrat också. Eftersom framställning och isolering av potentiella lipidsubstrat kan vara mödosamt och tidskrävande, är det viktigt att ha en försäkran om att ett enzym är redo att arbeta när man kombinerar och inkuberar den värdefulla substrat. Viktigt är förfarandet i första optimera förutsättningarna för ett enzym för att arbeta, kommer att möjliggöra en snabbare identifiering av fysiologiska substrat för en ny (fosfo) lipas. Som ett proof of concept, har vi med framgång den här metoden för karakterisering av substrat särdrag lipaser SMc00171, SMc00930 och SMc01003 8,11. I kontrast, många traditionella, alternativa metoder för upprättandet av analyser för (fosfo) lipasaktiviteter involverar reaktioner där substrat och produkt är tidigare kända.

Självklart, att ändringar av analyser upptäcka optimal enzymaktivitet kan omfatta användning av andra fluorogent, kromogent eller på annat sätt markerade artificiella substrat, variationav enzymkoncentration, typ och koncentration av buffertämnen eller andra tillsatsmedel (dvs, detergenter eller bivalenta katjoner). Om ingen enzymaktivitet detekteras med artificiella substrat, respektive enzymet helt enkelt inte kan fungera med detta substrat, men felsökning i sådana fall bör definitivt omfatta att ha en försäkran om att alla försiktighetsåtgärder har vidtagits som kan ha varit nödvändig för att upprätthålla enzymaktiviteten intakt (dvs, lagring cellfria extrakt vid 4 ° C eller lägre temperaturer fram till användning och, om det behövs, lägga cocktails av proteashämmare till cellfria extrakt för att undvika proteolytisk nedbrytning av enzymet av intresse) 27.

Begränsningar med den teknik som presenteras i detta manuskript är beror på det faktum att den artificiella substratet och det naturliga substratet är olika från varandra och följaktligen de bioenergetik för den katalyserade reaktionen kommer att vara såväl ett. De olika parameters för optimala förhållanden för enzymaktivitet bör fastställas även för det naturliga substratet (genom att variera pH, typ av buffert, buffertstyrka, koncentrationer av NaCl och detergenter såsom Triton X-100, frånvaro eller närvaro av olika tvåvärda katjoner), eftersom de kan visa sig vara lite annorlunda från de optimala förhållanden som råder för den konstgjorda underlaget. En annan viktig begränsning är att förmodligen inte alla (fosfo) lipaser är detekterbara genom användning av artificiella kromogena substrat. Till exempel, den konstgjorda p-nitrofenyl rester av estersubstrat helt enkelt kan vara för skrymmande, eller uppvisar andra kemiska egenskaper som förhindrar att ett sådant substrat kan få tillgång till det aktiva stället i ett enzym. Det konstaterades att den DAG lipas SMc01003 visade låga aktiviteter med alla p-nitrofenylester substrat av olika kedjelängder 11. Med vetskapen om att DAG är det naturliga substratet för SMc01003 och att DAG har en reldevis liten polära huvudgruppen, som består av glycerol enbart 11, är det lätt att tänka sig att den skrymmande p-nitrofenyl-resten är helt enkelt för stor för en enkel tillgång till det aktiva stället i SMc01003. Men de molekylära detaljerna varför p-nitrofenyl-estrar är inte bra substrat för SMc01003 inte känt vid denna tidpunkt.

Kritiska steg i protokollet omfattar alla åtgärder som har vidtagits för att säkerställa att enzymet studeras har tillgång till den aktuella underlaget. Till exempel, i sökandet efter den fysiologiska lipid substratet, är det kritiskt att lipidsubstrat tillhandahålls i en solubiliserad form. Därför när man inrättar sådana enzymanalyser (beskriven i 5 i protokollet), lipida substrat, vanligtvis upplösta i blandningar av metanol: kloroform, bör blandas med en vattenlösning av en detergent, dvs Triton X-100, före torkning ner blandningen med kvävgas. Detta förfarande säkerställer att efter tillsats av de återstående Ingredienser för analysen, är den potentiella lipidsubstrat inbäddad i detergentmiceller och som sådana tillgängliga för enzymet under analysen.

Principiellt bör tekniken presenteras här vara allmänt tillämpas i framtiden för upptäckten av nya (fosfo) lipaser och för fastställandet av sina naturliga substrat. Tekniken är lätt att bygga ut för andra grupper av hydrolaser, men det kan vara mer komplicerat att utveckla analyser med artificiella substrat för nya enzymer som kräver två, vanligen okända, substrat för att slutföra sin katalytiska cykeln.

För förmodas (fosfo) lipaser eller fosfataser varken rätt substrat är känd eller analys förhållanden under vilka enzymet fungerar bra. Därför kan det vara användbart att studera om någon förening från ett batteri av artificiella föreningar, såsom distinkta p-nitrofenyl-innehållande föreningar (p-nitrofenyl fosfat, bis-p-nitrofenylfosfat, p-nitrofenyl palmitat), kan fungera som substrat. Upptäckten av initiala enzymaktiviteter med artificiella substrat har banat väg för att lösa att SMc00171 är ett PC-specifika fosfolipas C 8, att SMc01003 är en DAG lipas 11, och bidragit till att definiera de villkor under vilka SMc00930 fungerar som ett hydrolas 11. Självklart är för närvarande fortfarande okänd det naturliga substratet av SMc00930 och fysiologiska sammanhang av SMc00930 och SMc01003 fortfarande lösas. Därför är uppgiften att föreslå en fysiologisk funktion för en förutsedd lipas utmanande och inte alltid omedelbart varit framgångsrika. Använda mutanter brist av den förutspådda lipasgenen och jämföra dem till respektive vilda stammen kan ge experimentella bevis för att lipas agerar med specificiteten i dess ursprungliga stammen bakgrund som har antagits i del 4) i protokollet. Tydligt, påståendet om en ny lipasaktivitet should stödjas av in vitro-bevis för att en viss substrat omvandlas genom hydrolys till definierade produkter. Ibland postulerade fysiologiska funktionen kan fylla luckor i metaboliska vägar eller förklara fysiologiska beteende producerande organismen, men i andra fall finns helt enkelt fortfarande kanske inte tillräckligt biokemiska kunskaper för att förstå vissa aktiviteter. Under loppet av våra studier identifierade vi flera enzymer som verkar på inneboende polära membranlipider av bakterier nedbrytande dem och, i vissa fall, att omvandla dem till en spelare i mer komplexa lipid cykler. Till exempel, att kombinera ny kunskap som SMc00171 är ett PC-specifika fosfolipas C (PLCP) 8 som induceras i fosfor begränsande förutsättningarna för tillväxt, med redan existerande uppgifter, kan man postulera en ny DAG cykel som kan finnas i många miljö Proteobacteria och vilket ger upphov till bildningen av fosforfria membranlipider när fosfor är tillväxtbegränsande. i contrast, när fosformaterial är riklig, är DAG refosforyleras till fosfatidinsyra in de novo fosfolipid biosyntes och därigenom stänga denna lipid cykel och se till att huvudsakligen (glycero) fosfolipider förekommer i membranet 8,28.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Författarna har ingenting att lämna ut.

Acknowledgments

Detta arbete har finansierats med bidrag från Consejo Nacional de Ciencias y Tecnología-Mexiko (CONACYT-Mexiko) (82.614, 153.998, 253.549 och 178.359 i Investigación Científica Básica samt 118 i Investigación en Front de la Ciencia) och från Dirección General de Asuntos de personliga Académico-Universidad Nacional Autónoma de México (DGAPA-UNAM, PAPIIT IN202616, IN203612).

Materials

Name Company Catalog Number Comments
Chloroform JT Baker 9180-03 TLC analysis & Lipid extraction
Methanol JT Baker 9070-03 TLC analysis & Lipid extraction
Acetic Acid JT Baker 9507-05 TLC analysis & Lipid extraction
Hexanes JT Baker 9309-02 TLC analysis & Lipid extraction
Diethylether Sigma 32203 Enzymatic assays
bidistilled water  ANY  NA Enzymatic assays
Tris Base Sigma T-1503 Enzymatic assays
HCl Baker 9535-02 Enzymatic assays
NaCl Baker 3624-01 Enzymatic assays
Triton X-100 Sigma X-100 Enzymatic assays
LB broth ANY NA Bacterial growth, 10 g tryptone + 5 g yeast extract + 10 g NaCl per liter of bidistilled water
tryptone Becton Dickinson and Company 211705 Bacterial growth
yeast extract Becton Dickinson and Company 212750 Bacterial growth
TY broth ANY NA Bacterial growth, 8 g tryptone + 3 g yeast extract + 66 mg CaCl2·2H2O per liter of bidistilled water
CaCl2·2H2O Baker 1332-01 Enzymatic assays
isopropyl-β-D-thiogalactoside (IPTG) Invitrogen 15529-019 Bacterial growth
Diethanolamine Sigma D-8885 Enzymatic assays
MnCl2 Sigma 221279 Enzymatic assays
Phospholipase A2 snake venom Sigma P0790 Enzymatic assays
Phospholipase C Clostridium perfringens Sigma P7633 Enzymatic assays
Bis-p-nitrophenyl phosphate Sigma 07422AH Enzymatic assays
p-nitrophenyl stearate Sigma N3627 Enzymatic assays
p-nitrophenyl dodecanoate Sigma 61716 Enzymatic assays
p-nitrophenyl decanoate Sigma N0252 Enzymatic assays
p-nitrophenyl palmitate Sigma N2752 Enzymatic assays
p-nitrophenyl butyrate Sigma N9876 Enzymatic assays
p-nitrophenyl octanoate Sigma 21742 Enzymatic assays
Acetic Acid, sodium salt [1-14C] Perkin Elmer NEC084 Bacterial growth
dimethylsulfoxide (DMSO) JT Baker 9224-01 Enzymatic assays
Aluminium HPTLC silica gel 60 plates. Silica gel HPTLC plates size 20 x 20 cm, 25 sheets. Merck 105547 TLC analysis & Lipid extraction
Spectrometer UV/VIS Lambda 35 Perkin Elmer NA Enzymatic assays
Storm 820 Phosphorimager Molecular Dynamics NA Photostimulable Luminescence scanner 
Multipurpose Scintillation Counter Beckman Coulter NA Radioactivity Quantification
French Pressure Cell ThermoSpectronic NA  Breakage of cells
chromatography paper 3MM Chr Whatman 3030917 TLC analysis
Sinorhizobium meliloti 1021our reference 11 studied strain
Escherichia coli BL21 (DE3) pLysS Competent cells Novagen 69451 protein expression strain
pET9a vector Novagen 69431 protein expression vector
pET17b vector Novagen 69663 protein expression vector
sterile polystyrene round-bottom tube (14 ml) Falcon Becton Dickinson 352057 radiolabeling of bacterial cultures
polypropylene microcentrifuge tubes (1.5 ml) Eppendorf 30125.15 Enzymatic assays
1,2-dipalmitoyl-sn-glycerol Sigma D9135 lipid standard
L-α-phosphatidylcholine, dipalmitoyl Sigma P6267 lipid standard
DL-α-monopalmitin Sigma M1640 lipid standard
palmitic acid Sigma P0500 lipid standard

DOWNLOAD MATERIALS LIST

References

  1. Nelson, D. L., Cox, M. M. Lehninger, Principles of Biochemistry. W. H. Freeman and Company. New York. (2013).
  2. Jaeger, K. E., Eggert, T. Lipases for biotechnology. Curr. Opin. Biotechnol. 13, (4), 390-397 (2002).
  3. Dowhan, W., Bogdanov, M., Mileykovskaya, E. Functional roles of lipids in membranes. Biochemistry of Lipids, Lipoproteins and Membranes. 5th, Elsevier. Amsterdam, The Netherlands. 1-37 (2008).
  4. Dowhan, W. Molecular basis for membrane phospholipid diversity: why are there so many lipids? Annu. Rev. Biochem. 66, 199-232 (1997).
  5. De Rudder, K. E. E., Thomas-Oates, J. E., Geiger, O. Rhizobium meliloti mutants deficient in phospholipid N-methyltransferase still contain phosphatidylcholine. J. Bacteriol. 179, 6921-6928 (1997).
  6. Geiger, O., Röhrs, V., Weissenmayer, B., Finan, T. M., Thomas-Oates, J. E. The regulator gene phoB mediates phosphate stress-controlled synthesis of the membrane lipid diacylglyceryl-N,N,N-trimethylhomoserine in Rhizobium (Sinorhizobium) meliloti. Mol. Microbiol. 32, (1), 63-73 (1999).
  7. Klug, R. M., Benning, C. Two enzymes of diacylglyceryl-O-4'-(N,N,N,-trimethyl)homoserine biosynthesis are encoded by btaA and btaB in the purple bacterium Rhodobacter sphaeroides. Proc. Natl. Acad. Sci. USA. 98, (10), 5910-5915 (2001).
  8. Zavaleta-Pastor, M., et al. Sinorhizobium meliloti phospholipase C required for lipid remodeling duringphosphorus limitation. Proc. Natl. Acad. Sci. USA. 107, (1), 302-307 (2010).
  9. Pech-Canul, A., et al. FadD is required for utilization of endogenous fatty acids released from membrane lipids. J. Bacteriol. 193, (22), 6295-6304 (2011).
  10. Banerji, S., Flieger, A. Patatin-like proteins: a new family of lipolytic enzymes present in bacteria? Microbiology. 150, (Pt 3), 522-525 (2004).
  11. Sahonero-Canavesi, D. X., et al. Fatty acid-releasing activities in Sinorhizobium meliloti include unusual diacylglycerol lipase. Environ. Microbiol. 17, (9), 3391-3406 (2015).
  12. Fischer, M., Pleiss, J. The Lipase Engineering Database: a navigation and analysis tool for protein families. Nucl. Acid. Res. 31, (1), 319-321 (2003).
  13. Sigrist, C. J. A., et al. New and continuing developments at PROSITE. Nucleic Acids Res. 41, (Database issue), D344-D347 (2013).
  14. Lorenz, T. C. Polymerase Chain Reaction: Basic Protocol Plus Troubleshooting and Optimization Strategies. J. Vis. Exp. (63), e3998 (2012).
  15. Untergasser, A., et al. Primer3 - new capabilities and interfaces. Nucl. Acids Res. 40, (15), e115 (2012).
  16. Studier, F. W., Rosenberg, A. H., Dunn, J. J., Dubendorff, J. W. Use of T7 RNA polymerase to direct expression of cloned genes. Methods Enzymol. 185, 60-89 (1990).
  17. Miller, J. H. Experiments in Molecular Genetics. Cold Spring Harbor Laboratory Press. Plainview, NY, USA. (1972).
  18. Desjardins, P., Hansen, J. B., Allen, M. Microvolume Protein Concentration Determination using the NanoDrop 2000c Spectrophotometer. J. Vis. Exp. (33), e1610 (2009).
  19. Bligh, E. G., Dyer, W. J. A rapid method for total lipid extraction and purification. Can. J. Biochem. Physiol. 37, (8), 911-917 (1959).
  20. Molecular Dynamics. Phosphorimager SI User´s Guide. http://www.camd.lsu.edu/SAXS/Files/PIManual.pdf (1994).
  21. Dixon, M., Webb, E. Enzymes: Third Edition. Longman, USA. (1979).
  22. Rudolph, A. E., et al. Expression, characterization, and mutagenesis of the Yersinia pestis murine toxin, a phospholipase D superfamily member. J. Biol. Chem. 274, (17), 11824-11831 (1999).
  23. Kato, S., Yoshimura, T., Hemmi, H., Moriyama, R. Biochemical analysis of a novel lipolytic enzyme YvdO from Bacillus subtilis. Biosci. Biotechnol. Biochem. 74, (4), 701-706 (2010).
  24. Peppelenbosch, M. P. Kinome profiling. Scientifica (Cairo). Article ID 306798 (2012).
  25. Manafi, M., Kneifel, W., Bascomb, S. Fluorogenic and chromogenic substrates used in bacterial diagnostics. Microbiol. Rev. 55, (3), 335-348 (1991).
  26. Kuznetsova, E., et al. Enzyme genomics: Application of general enzymatic screens to discover new enzymes. FEMS Microbiol. Rev. 29, (2), 263-279 (2005).
  27. Scopes, R. K. Protein Purification, Principles and Practice. Springer. New York. (2010).
  28. Geiger, O., Lopez-Lara, I. M., Sohlenkamp, C. Phosphatidylcholine biosynthesis and function in bacteria. Biochim. Biophys. Acta. 1831, (3), 503-513 (2013).
Definiera substratspecificiteter för lipas och fosfolipas kandidater
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Sahonero-Canavesi, D. X., Zavaleta-Pastor, M., Martínez-Aguilar, L., López-Lara, I. M., Geiger, O. Defining Substrate Specificities for Lipase and Phospholipase Candidates. J. Vis. Exp. (117), e54613, doi:10.3791/54613 (2016).More

Sahonero-Canavesi, D. X., Zavaleta-Pastor, M., Martínez-Aguilar, L., López-Lara, I. M., Geiger, O. Defining Substrate Specificities for Lipase and Phospholipase Candidates. J. Vis. Exp. (117), e54613, doi:10.3791/54613 (2016).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter