Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Developmental Biology

L'induction de mésenchymateuses-épithélial Transitions dans les cellules Sarcome

doi: 10.3791/55520 Published: April 7, 2017

ERRATUM NOTICE

Summary

Nous présentons ici une méthode de culture cellulaire pour induire des transitions mésenchymateuses-épithéliale (MET) dans les cellules de sarcome basées sur l'expression ectopique combinée de microARN-200 membres de la famille et comme grainyhead 2 (GRHL2). Cette méthode est adaptée pour mieux comprendre l'impact biologique de la plasticité phénotypique sur l'agressivité du cancer et des traitements.

Abstract

La plasticité phénotypique se réfère à un phénomène dans lequel les cellules acquièrent transitoirement les traits d'une autre lignée. Au cours de la progression du cancer, la plasticité phénotypique conduit l'invasion, la diffusion et les métastases. En effet, alors que la plupart des études de la plasticité phénotypique ont été dans le contexte des cancers épithéliaux, il se trouve sarcomes, qui sont mésenchymateuses d'origine, présentent également la plasticité phénotypique, avec un sous-ensemble de sarcomes subissant un phénomène qui ressemble à un mesenchymal- transition épithéliale (MET). Ici, nous avons développé un procédé comprenant le miR-200 et la famille grainyhead-like 2 (GRHL2) pour simuler ce phénomène MET-comme observé chez les patients du sarcome samples.We expriment séquentiellement GRHL2 et la famille miR-200 en utilisant la transduction et de transfection cellulaire, respectivement , pour mieux comprendre les fondements moléculaires de ces transitions phénotypiques dans les cellules de sarcome. les cellules exprimant Sarcome miR-200s et GRHL2 ont démontré une meilleure épithéliale caractéristique etics dans la morphologie des cellules et l'altération des marqueurs biologiques épithéliales et mésenchymateuses. Les études futures utilisant ces méthodes peuvent être utilisées pour mieux comprendre les conséquences phénotypiques des processus MET-comme sur les cellules de sarcomes, tels que la migration, l'invasion, la propension métastatique, et une résistance au traitement.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

plasticité phénotypique se réfère à une transition réversible entre les phénotypes cellulaires, et est généralement divisé en deux types, les transitions épithéliale-mésenchymateuse (EMT) et les transitions mésenchymateuses-à-épithéliale (MET). Cette plasticité phénotypique joue un rôle important dans les processus normaux d'organismes multicellulaires, tels que le développement et la cicatrisation des plaies 1; cependant, ces mêmes voies et les programmes d'expression génique peuvent également conduire à des maladies, telles que la fibrose (revue dans 2, 3, 4) et les métastases de carcinome (revue dans les références 5, 6, 7, 8). Au cours de métastases, par exemple, EMT perturbe la polarité cellulaire, les interactions entre cellules et favorise l' invasion 9, 10. Ensemble, EMT contribuents à un état phénotypiques qui facilite la diffusion des cellules cancéreuses. En outre, EMT conduit également à une foule d'autres modifications phénotypiques qui entraînent un phénotype agressif, y compris la dérégulation du métabolisme des cellules cancéreuses 6, le développement de la résistance aux médicaments 11, 12, une augmentation de la capacité d'initiation de la tumeur 13, 14 et l' hôte évasion immunitaire 15.

La plasticité phénotypique a été bien étudiée dans la progression du cancer; cependant, les sarcomes présentent également la plasticité phénotypique. Fait intéressant, il semble que certains des mêmes facteurs de plasticité phénotypique dans les cancers contribuent également à la plasticité du sarcome et l'agressivité. Par exemple, les cellules tumorales circulantes (CTC) provenant de patients atteints de sarcome ont été montrés pour exprimer EpCAM, une protéine de surface cellulaire qui se trouve généralement sur les cellules epitheliales 16. Addinellement, 250 échantillons de sarcomes des tissus mous ont été classés comme epithelial ou mésenchymateuses comme basé sur l'expression des gènes. Les patients dans la signature des marqueurs biologiques epithelial avaient un meilleur pronostic que les patients avec la signature de marqueurs biologiques mésenchymateuses comme 17. Ceci est en accord avec de nombreux cancers, où les patients ayant plus carcinomes epithelial ont de meilleurs résultats par rapport aux patients avec plus de tumeurs mésenchymateuses comme 18.

Alors que certains sarcomes affichent des biomarqueurs et des voies d'expression des gènes compatibles avec MET, restent mal compris les fondements moléculaires de cette plasticité phénotypique. Pour étudier les mécanismes et les conducteurs de MET sarcomes, nous avons développé un modèle d'induction MET en utilisant deux facteurs spécifiques à l'épithélium, la microARN (miR) -200 famille et comme grainyhead 2 (GRHL2). Les miR-200 sont une famille de petits ARN non codants qui régulent l'expression des gènes en se liant à la 3' UTR de MessenGer ARN et en empêchant la traduction en protéine. La famille miR-200 se compose de deux sous-groupes - contenant une miR-141 et miR-200a, et l'autre comprenant miR-200b, miR-200c, et miR-429. Les membres de la famille miR-200 sont enrichis dans les tissus épithéliaux, et la perte de miR-200s est associée à des métastases dans les cancers 19. La famille miR-200 est également downregulated dans les sarcomes des tissus mous par rapport aux tissus normaux 20. Tout comme les miR-200s, GRHL2 est un régulateur clé qui est important pour le développement de l' épithélium 21. Le facteur de transcription GRHL2 agit de deux manières de réguler à la hausse des gènes épithéliaux, tels que la E-cadhérine: 1) Dans les cellules epitheliales, GRHL2 refoule directement le régulateur maître EMT, ZEB1 22; et 2) GRHL2 active directement la transcription de gènes 23 epitheliales. Nos enquêtes précédentes ont montré que l'expression combinée de miR-200s et GRHL2 dans les cellules de sarcomeinduit un phénotype de type 24 MET. Nous présentons ici un protocole détaillé pour créer un modèle in vitro d'induction MET dans les cellules de sarcome en utilisant l' expression ectopique de miR-200s et GRHL2.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Préparation des réactifs

  1. Préparer DMEM pour la culture cellulaire en ajoutant 50 ml de sérum bovin fœtal (FBS) et 5 ml de pénicilline-streptomycine (5000 U / ml) à 500 ml de DMEM. Ce milieu peut être conservé à 4 ° C pendant jusqu'à six mois.
  2. Remettre en suspension les amorces lyophilisées dans de l'eau sans nuclease à une concentration finale de 10 uM. amorces remises en suspension à -20 ° C.
  3. Préparer test de radio-immunoprécipitation (RIPA) du tampon (150 mM NaCl, 0,5% de désoxycholate de sodium, 0,1% de SDS, Tris 50 mM, pH 8,0). Supplément avec un cocktail d'inhibiteur de protéase avant de les utiliser et de conserver un tampon sur de la glace lors de son utilisation. Conserver à 4 ° C.
  4. Préparer 10 mg / ml de polybrène (bromure d'hexadiméthrine) dans de l'eau et filtrer pour stériliser la seringue en utilisant un filtre de polyéthersulfone de 0,45 pm. La solution peut être conservé à 4 ° C pendant jusqu'à six mois.
  5. Préparer une solution de chlorure de nitro bleu de tétrazolium de travail 1 mg / ml par dissolution de 10 mg dans 10 ml de PBS. Conserver à 4 ° C.

2. Lentiviral Transduction de GRHL2

jour 1

  1. Planche 3 x 10 5 cellules HEK293T par puits d'une plaque à 6 puits dans 2 ml de DMEM complété. Quantifier les cellules en utilisant un compteur de cellules automatisé. Les cellules doivent être 40 - confluentes à 60% après une culture pendant une nuit à 37 ° C avec 5% de CO 2.

Jour 2

  1. Diluer 2 ug de vecteur vide (pCMV-UBC-EGFP) ou 2 pg de pCMV-GRHL2-UBC-EGFP 24, 25 dans 200 ul de milieu sans sérum avec 1,8 pg de pΔ8.9 et 0,2 ug de pCMV-VSV plasmides auxiliaires -G. Dans un tube séparé, on dilue 4 ul d'un réactif de transfection à base de lipides dans 200 ul de milieu exempt de sérum par transfection (8 ul dans 400 ul de deux échantillons). Ajouter 200 pi de mélange de réactif de transfection pour chaque solution de plasmide et incuber pendant 20 min à température ambiante.
  2. Au cours de la incubestion, lavage des cellules HEK293T par élimination du milieu par aspiration et les cellules de rinçage avec 1 ml de PBS. Remplacer le PBS avec 800 ul de milieu exempt de sérum. Après 20 min, ajouter 200 ul de réactif de transfection: mélange plasmide de l' étape 2.2 goutte à goutte à chaque puits et incuber les cellules pendant 2 h à 37 ° C dans 5% de CO 2.
  3. Retirer délicatement milieu de transfection par aspiration sous vide et la remplacer par 2 ml de DMEM complété. Remettre les cellules à l'incubateur pour la culture du jour au lendemain.
    REMARQUE: les cellules HEK293T sont faiblement adhérentes. le remplacement des médias doit être effectuée avec précaution afin de limiter l'élimination des cellules du fond du plat ou un flacon.

jour 3

  1. Actualiser multimédia sur des cellules HEK293T transfectées et la plaque 3 x 10 5 cellules RD par puits d'une plaque à 6 puits dans 2 ml de DMEM complété. les cellules de culture durant la nuit. cellules RD sont une lignée cellulaire de rhabdomyosarcome humain disponible dans le commerce.

jour 4

  • Recueillir les médias viral à partir de cellules HEK293T. Pipeter les médias DMEM des cellules HEK293T et le placer dans un nouveau 15 ml conique. Remettez soigneusement avec les nouveaux médias de DMEM et placer des cellules HEK293T dans l'incubateur pour le lendemain.
  • Ajouter 2 ul de 10 mg / mL de polybrène par ml de milieu virales en deux nouveaux tubes coniques de 50 ml (une pour la transfection du vecteur vide et l'autre pour la transfection GRHL2). filtre à seringue de support viral en retirant le piston d'une seringue de 3 ml et fixer un filtre de 0,45 um de polyéthersulfone à la pointe.
    1. Ajouter les supports viraux collectés à l'étape 2.6 dans le cylindre de la seringue, et de plonger des supports dans les nouveaux tubes coniques de 50 ml contenant du polybrène. Retirez le support de cellules RD par aspiration et ajouter du contenu multimédia viral filtré aux cellules RD.
  • jour 5

    1. Jour 4. Répéter les cellules HEK293T peuvent être mis au rebut après que les médias du virus a été recueilli.

    jour 7

    1. Laver les cellules RD avec 1 ml de PBS et ajouter 200 ul de 0,05% de trypsine par puits. Incuber à 37 ° C pendant 5 min, ajouter 2 ml de milieu complété, et déplacer la suspension cellulaire à un nouveau 15 ml conique. Centrifuger les cellules à 250 xg pendant 5 min à la température ambiante et des supports d'aspiration. Remettre en suspension dans 1 ml de DMEM (supplémenté avec 5% de FBS et 1% de pénicilline-streptomycine).
      REMARQUE: L'utilisation d'un pourcentage plus élevé de FBS peut provoquer le colmatage lors de cytométrie en flux
      1. les cellules de filtre pour la cytométrie de flux. Utiliser une pipette pour appliquer le 1 mL de suspension de cellules RD à travers un filtre de 30 um dans des tubes de cytométrie en flux et des tubes à placer sur la glace.
      2. Trier les cellules EGFP + 26 dans 1,5 ml contenant des tubes de microcentrifugation de 0,5 ml de DMEM additionné de 10% de FBS et 1% de pénicilline-streptomycine et placer sur de la glace. Plate EGFP + cellules triées au total de 1 ml de DMEM supplémenté en un seul puits d'une plaque à 12 puits et placer dans l'incubateur pour culture.
        ; NOTE: Le rendement des cellules EGFP + de cytométrie en flux après cette transduction est généralement faible (50,000-100,000 cellules). Les cellules peuvent avoir besoin d'être cultivées pendant 10 - 14 jours avant de passer à l'étape 3.

    3. inverse Transfection de miR-200s

    1. Préparer 50 uM stocks de miR-200 en utilisant imite les actions H 2 O. aliquotes sans nuclease et stocker à -20 ° C pour éviter les cycles de congélation / décongélation répétés.
    2. Ajouter 3 pi de chaque 50 uM miR-200 mimic (miR-200a, miR-200b, et miR-200c) à 300 ul de milieu exempt de sérum ou 9 ul de 50 uM miARN témoin négatif à 300 uL de milieu sans sérum.
    3. Ajouter 6 ul de réactif de transfection spécifique de siRNA de 600 ul de milieu exempt de sérum et de diviser 300 ul de ce mélange dans deux tubes, l'un pour chacun des deux mélanges miR de l'étape 3.2. On combine les 300 pi de chaque mélange de l'étape miR 3,2 avec un mélange de 300 ul de réactif de transfection. Incuber pendant 20 min à la salle température.
    4. Alors que l'incubation, préparer une suspension cellulaire de 600.000 cellules EGFP + RD exprimant EV ou GRHL2 créé dans la section 2 dans 2,4 ml (250 cellules / ul) de milieu exempt de sérum par traitement.
    5. Dans une plaque à 24 puits, ajouter 100 ul par puits de mélange miR-200 ou un mélange témoin négatif provenant de l'étape 3.3 dans six puits, puis ajouter 400 ul de chaque suspension cellulaire dans trois puits de chaque mélange miR.
    6. Incuber les cellules à 37 ° C dans 5% de CO2 pendant une nuit et changer de support à tout complété DMEM le jour suivant. Recueillir les cellules 2 jours plus tard pour l'analyse en utilisant le tampon approprié (voir ci-dessous). imagerie time-lapse des cellules de sarcome RD en cours de MET est disponible en tant que matériau supplémentaire. Image chaque puits toutes les 2 h avec un objectif 10X au moyen d' un imageur de cellules vivantes automatisé 27.

    4. Extraction de l'ARN, la transcription inverse, et qPCR

    1. Extrait d'ARN selon les instructions du fabricant en utilisant un ARN normekit d'extraction 24. L'ARN extrait peut être stocké à -80 ° C.
    2. Quantifier la concentration d'ARN. Décongeler et travailler avec l'ARN sur la glace. Pour quantifier les concentrations d'ARN, mesurer l'absorbance UV à 260 nm avec un spectrophotomètre lecteur de plaque selon le protocole du fabricant. Diluer tous les échantillons à la plus faible concentration d'eau sans nucléase.
    3. Effectuer la transcription inverse de l'ARN total en ADN complémentaire (ADNc). Moissonneuse pas moins de 100 ng d'ARN total avec du tampon de PCR, un mélange de dNTP (100 mM), des amorces hexamères aléatoires, la transcriptase inverse et de l' eau exempte de nuclease dans un volume réactionnel de 20 ul 24. Exécuter des cycles RT conformément au protocole du fabricant. ADNc peut être stocké à long terme à -20 ° C.
    4. Diluer 20 ul de réactions à 100 ul avec 80 ul de H sans nucléase 2 O.
    5. Mélanger 5 ul d'un colorant d'intercalation à base de fluorescence 2x mélange maître qPCR, 0,06 ul de chaque amorce 10 uM, unnd 2 ul de la réaction RT dilué par échantillon.
    6. Exécutez qPCR selon le protocole du fabricant pour le mélange maître à base de fluorescence.
    7. Quantifier les quantités relatives d'ARNm par la méthode delta CT et normaliser de GAPDH. Tracer l'expression d'ARNm moyen de répétitions biologiques ± écart-type pour chaque groupe de traitement.
      NOTE: Il convient de prendre des précautions particulières lorsque l'on travaille avec de l'ARN pour éviter tout contact avec RNases, comme l'utilisation des plastiques et des réactifs sans RNase. matériel non jetable doit être traitée avant d'utiliser pour enlever RNases.

    5. Immunofluorescence Staining

    1. Suite à l'étape 3.6, les médias aspirés par aspiration sous vide à partir des cellules RD au format 24 puits.
    2. Fixer les cellules par addition de 500 pi de paraformaldehyde à 4% (PFA) par puits et incuber pendant 15 min à température ambiante (RT). Après fixation, les cellules de lieu dans une solution saline tamponnée au phosphate (PBS) et stocker à 4 ° C pendant une nuit, si nécessaire.
    3. perméabiliserles cellules en ajoutant 500 pi de PBS + 0,2% de Triton-X100 et incuber 30 min à température ambiante. Par aspiration sous vide, éliminer le tampon de perméabilisation et laver trois fois avec du PBS.
    4. Bloc dans 500 ul d'albumine de sérum bovin à 5% (BSA) / PBS et incuber les cellules pendant 30 min à température ambiante. Les cellules peuvent être stockées pendant la nuit si nécessaire à 4 ° C.
    5. Préparer une dilution d'anticorps primaire. Pipeter 200 ul de 5% de BSA / PBS par puits dans un 15 ml conique (12 puits = 2,4 ml) et ajouter 1 pi de l'anticorps primaire par ml de 5% de BSA / PBS nécessaire. Retirer le tampon de blocage par aspiration et distribuer 200 ul d'anticorps primaire dilué dans chaque puits.
      1. Incuber les cellules à 1: 1000 des anticorps primaires dilués dans 5% de BSA / PBS pendant 1 h à la température ambiante ou une nuit à 4 ° C. Après incubation, les cellules laver deux fois avec du PBS.
    6. Préparer la dilution d'anticorps secondaire dans le même volume de 5% de BSA / PBS comme ci-dessus. Ajouter l'anticorps secondaire conjugué à un colorant rouge lointain en utilisant une dilution à 1: 2000. En outre ajouter1 pg / ml de colorant Hoechst au mélange. Retirez le PBS et ajouter 200 ul du mélange à chaque puits.
      1. Incuber à température ambiante pendant 1 h dans l'obscurité. Laver 3 fois avec du PBS, laisser les cellules dans du PBS, et de protéger les cellules de la lumière en utilisant une feuille. Les cellules peuvent être stockées à 4 ° C si nécessaire.
    7. des cellules d'image à grossissement total 400x sur un microscope inversé à épifluorescence avec une longueur d'onde d'excitation de 594 à 650 nm.

    6. Western Blot

    1. Laver les cellules deux fois de 3,6 avec du PBS glacé. Sur de la glace, les cellules lysent avec du tampon 50 ul de 1 x RIPA additionné de cocktail d'inhibiteurs de protease 1x.
    2. lysats de roche à 4 ° C pendant 15 min, recueillir les lysats dans des tubes de 1,5 ml, et on centrifuge à grande vitesse (20 000 x g) pendant 5 min afin de clarifier les échantillons. Les lysats cellulaires peuvent être stockés à long terme à -80 ° C si nécessaire.
    3. Quantifier la protéine totale en utilisant un dosage de Bradford et aliquoter une quantité égale de protéine dans de nouveaux tubes de microcentrifugation de 1,5 ml. Brinles échantillons G à l'aide d'un volume égal du tampon RIPA et le tampon de charge de Laemmli 3x additionné de 2-mercaptoéthanol.
    4. Incuber les échantillons dans un tampon de charge d'échantillon Laemmli 1x pendant 5 min à 95 ° C et exécuter SDS-PAGE en utilisant un gel Tris-glycine 4-12% à 200 V pendant 45 min. La quantité de plages chargé de protéines en fonction de la lignée cellulaire. Dans certains cas, 50 à 100 ug de protéine totale est nécessaire pour détecter la E-cadhérine dans des lignées de cellules mésenchymateuses.
    5. les protéines de transfert sur une membrane de nitrocellulose pendant 2 heures à 50 V dans un tampon de transfert Tris-glycine 1x.
    6. Bloc membrane pendant 1 h à la température ambiante ou une nuit à 4 ° C dans un tampon de blocage à base de BSA.
    7. Diluer anticorps primaires à 1: 1 000 concentration dans 5 ml de tampon de blocage, ajouter dilution à la membrane, et mettre en incubation avec doux balancement pendant 1 h à la température ambiante ou une nuit à 4 ° C. Laver la membrane 3 fois dans du PBS avec 0,05% de Tween-20.
    8. Incuber les membranes pendant 1 h à température ambiante avec SECONDAIRE couplé fluorescente infrarougey anticorps à 1: 20 000 dilution dans du tampon de blocage comme ci-dessus.
    9. Laver deux fois la membrane dans du PBS avec 0,05% de Tween-20, puis une fois dans du PBS.
    10. membrane image en utilisant la détection par fluorescence infrarouge standard.

    7. Les essais de croissance indépendante de l'ancrage

    NOTE: Pour un protocole d'essai agar mou détaillée, voir 28.

    1. Chaud médias 2x DMEM stérile à 42 ° C dans un bain d'eau chaude. Pendant ce temps, la chaleur pré-1% d'agarose autoclavé au micro-ondes pendant 3 min. Micro-ondes pendant 30 s supplémentaires à la fois au besoin ou jusqu'à complètement fondu. Déplacer agarose dans un bain-marie à 42 ° C.
    2. Placer un tube conique de 50 ml dans un bêcher avec 42 ° C l'eau dans une hotte stérile et mélanger agarose à 1% et 2 x milieu DMEM dans un mélange 1: 1 de comptabilité de rapport pour 1,5 mL de mélange par puits dans une plaque à 6 puits. Toujours préparer supplémentaire DMEM / agarose pour tenir compte des erreurs de pipetage et d'éviter les bulles.
    3. Ajouter au mélangeparois du puits, en veillant à l'absence de bulles se forment et laisser reposer pendant 30 minutes à température ambiante.
    4. Bien que la couche inférieure est solidification, préparer chaque groupe de cellules RD transfectées à l'étape 3 par aspiration médias et un lavage une fois avec 1 ml de PBS. PBS Aspirer et ajouter 0,2 ml de trypsine à 0,05% et incuber à 37 ° C pendant 5 min.
    5. Neutraliser la trypsine dans 0,8 ml de milieu et les cellules Broyez pour former une suspension à cellule unique. Transférer la suspension cellulaire à un tube conique de 15 ml.
    6. Compter les cellules et calculer le volume de la suspension cellulaire nécessaire pour 10.000 cellules par puits.
    7. Chauffer 0,6% d'agarose dans le micro-ondes pendant 3 min, suivie de 30 s à la fois jusqu'à complètement fondu. Déplacer agarose à 42 ° C bain d'eau.
    8. Placer un tube conique de 50 ml dans un bêcher avec de l'eau 42 ° C dans une hotte stérile. Mélanger 0,6% d'agarose et la suspension cellulaire diluée dans un rapport 1: 1 pour préparer 1,5 ml de mélange par puits dans une plaque à 6 puits. Toujours préparer la suspension cellulaire supplémentaire / mix agarose pour tenir compte des erreurs de pipetage etpour éviter les bulles.
      NOTE: Il est important de travailler à 42 ° C ici. Si la température est trop faible, le mélange se solidifie avant le placage, et des températures supérieures à 42 ° C aura une incidence sur la viabilité cellulaire.
    9. Bien mélanger les cellules par trituration à plusieurs reprises et ajouter le mélange de cellules dans les puits, en veillant à aucune forme de bulles, et laisser se solidifier pendant 20 minutes à température ambiante.
    10. Ajouter 2 ml de milieux supplémentés à chaque puits et déplacer des plaques dans l'incubateur.
      1. Changer les médias une fois par semaine pendant 3-4 semaines ou jusqu'à ce que les colonies multicellulaires forment. Veillez à ne pas toucher la gélose lors du retrait des médias par aspiration. En variante, utiliser un P1000 pour enlever la couche supérieure du milieu liquide.
      2. Colorer des plaques de gélose molle en ajoutant 200 ul de solution de chlorure de Nitro Bleu de tétrazolium (1 mg / mL dans du PBS) et incuber la plaque pendant une nuit à 37 ° C. Remplacer les médias le lendemain avec PBS pour l'imagerie.
      3. puits d'image au grossissement 40X totale sur un microscope inversé.
      4. Effectuer l'analyse sur ImageJ pour la zone de la colonie et le nombre. Terrain nombre moyen de colonies de réplicats biologiques ± écart-type.

    Subscription Required. Please recommend JoVE to your librarian.

    Representative Results

    or Start trial to access full content. Learn more about your institution’s access to JoVE content here

    Schéma pour l'induction MET dans les cellules de sarcome

    Un calendrier général pour l'induction de changements MET-comme dans les cellules de sarcome est représenté sur la Figure 1. Le protocole commence par transduction GRHL2 (figure 1A), suivie par la transfection de la famille miR-200 (figure 1B). GRHL2 ou membres de la famille miR-200 ne sont pas en mesure d'influer sur l'apparition de cellules RD lorsqu'elle est exprimée seule, mais l'expression ectopique de GRHL2 et miR-200s ensemble entraîne des changements morphologiques epithelial dans les cellules RD. Les cellules transition d'une forme en forme de fuseau à un aspect plus arrondi avec un contact accru de cellule à cellule (Figure 1C).

    L'induction de changements MET-comme dans les cellules de sarcome

    Le changement morphologique dans des cellules RD sur GRHL2 et miR-200surexpression était accompagné par une régulation positive du marqueur épithélial E-cadhérine (figure 2A). Ajout de miR-200s E-cadhérine upregulated seul, mais combiné miR-200s et GRHL2 surexpression synergétique expression accrue E-cadhérine (Figure 2A, non échelle logarithmique). En outre, il y a eu une augmentation au niveau des jonctions cellule-cellule de molécules d'adhésion épithéliale, EpCAM et TJP1, des flèches blanches (également connu sous le zona occludens 1, ZO-1) (Figure 2B).

    induction MET diminue la capacité de formation de colonies de cellules de sarcome

    La régulation positive des protéines épithéliales a été accompagnée par une régulation négative des gènes mésenchymateuses ZEB1 et Notch1 (figure 3A), qui sont des cibles connue pour miR-200. L' induction de MET réduit la croissance indépendante de l' ancrage des cellules RD , telle que mesurée par le nombre de colonies (figure 3B). cette growth inhibition a été alimentée par miR-200 seul; que la surexpression de GRHL2 a conduit à une augmentation de la croissance indépendante de l' ancrage (figure 3). Cela est conforme aux précédents rapports montrant l' expression GRHL2 induit la croissance indépendante de l' ancrage 22.

    Figure 1
    Figure 1: Chronologie du MET avec induction GRHL2 Surexpression et miR-200 Transfection. (A) Montage de ectopique sur-expression de GRHL2 dans les cellules cibles. (B) Chronologie de l' induction par MET transfection inverse de membres de la famille miR-200 dans des cellules cibles. (C) GRHL2 et miR-200 sur l' expression conduit à des changements dans la morphologie des cellules cibles compatibles avec MET. Barre d'échelle = 75 um S'il vous plaît cliquez icipour voir une version plus grande de ce chiffre.

    Figure 2
    Figure 2: En même temps surexpression de GRHL2 et miR-200s conduit à MET dans les cellules cibles. (A) L' expression de miR-200 conduit à expression élevée E-cadhérine tandis que l' expression combinée de GRHL2 et miR-200 a produit un effet synergique sur l' expression de la E-cadhérine à la fois l'ARNm (valeurs moyennes ± écart - type) et les taux de protéine. (B) de l' expression combinée de GRHL2 et miR-200 conduit à une expression accrue de EpCAM et TJP1 à contacts cellule-cellule (flèches). Barre d'échelle = 20 pm. * Indique p <0,05 en utilisant ANOVA avec analysé le chiffre post-hoc de Tukey correction.This a été modifié de référence 24. Copyright © American Society for Microbiology, biologie cellulaire et moléculaire, le volume 36, numéro 19, 2503-2513, 2016. S'il vous plaît cliquer ici pour voir une version plus grande de ce chiffre.

    figure 3
    Figure 3: Expression de miR-200s Supprime les marqueurs mésenchymateuses et diminutions de croissance indépendante de l' ancrage dans des cellules de sarcome. (A) sur - expression de miR-200s mais pas GRHL2 inhibé l' expression de l' ARNm ZEB1 et Notch1 (valeurs moyennes ± écart - type). (B) La surexpression de miR-200 , mais pas de résistance GRHL2 anoikis inhibée dans des cellules de sarcome. Des images représentatives de colonies colorées (bar Echelle = 200 um) et de quantification de nombre de colonies (valeurs moyennes ± écart-type) sont présentés. * Indique p <0,05 analysée à l'aide avec le chiffre ANOVA post-hoc de Tukey correction.This a été modifié de reference 24. Copyright © American Society for Microbiology, biologie cellulaire et moléculaire, le volume 36, numéro 19, 2503-2513, 2016. S'il vous plaît cliquer ici pour voir une version plus grande de ce chiffre.

    figure 3
    Vidéo supplémentaire: les cellules exprimant vecteur vide RD et miARN de contrôle négatif. Les vidéos ont été compilées à partir d'images de cellules RD transfectées avec un vecteur vide et miARN de contrôle négatif acquis toutes les deux heures en utilisant un imageur de cellules vivantes automatisé. S'il vous plaît cliquer ici pour voir cette vidéo. (Faites un clic droit pour télécharger.)

    figure 3 />
    Vidéo supplémentaire 2: Cellules RD Exprimant GRHL2-EGFP et miARN de contrôle négatif. Les vidéos ont été compilées à partir d'images de cellules transfectées avec RD GRHL2-EGFP et miARN de contrôle négatif acquis toutes les deux heures en utilisant un imageur de cellules vivantes automatisé. S'il vous plaît cliquer ici pour voir cette vidéo. (Faites un clic droit pour télécharger.)

    figure 3
    Vidéo supplémentaire 3: Cellules RD Exprimant vecteur vide et miR200 miARN. Les vidéos ont été compilées à partir d'images de cellules RD transfectées avec un vecteur vide et miR200 miARN acquis toutes les deux heures en utilisant un imageur de cellules vivantes automatisé. S'il vous plaît cliquer ici pour voir cette vidéo. (Faites un clic droit pour télécharger.)

    nt » fo: keep-together.within page = "1"> figure 3
    Vidéo supplémentaire 4: Cellules RD Exprimant GRHL2-EGFP et miR200 miARN. Des vidéos ont été compilées à partir d'images de cellules transfectées avec RD GRHL2-EGFP et miR200 miARN acquis toutes les deux heures en utilisant un imageur de cellules vivantes automatisé. S'il vous plaît cliquer ici pour voir cette vidéo. (Faites un clic droit pour télécharger.)

    Subscription Required. Please recommend JoVE to your librarian.

    Discussion

    or Start trial to access full content. Learn more about your institution’s access to JoVE content here

    Les sarcomes sont des cancers rares, mais très agressifs d'une lignée mésenchymateuses. En dépit de leur lignée mésenchymateuses, un sous-ensemble de sarcomes semble subir une transition phénotypiques à un état plus de type épithélial. Ce commutateur MET semblable a un intérêt pronostique, comme les patients ayant plus de tumeurs épithéliales ressemblant sont moins agressifs 24. En dépit de leur pertinence clinique, il existe peu d'études portant sur les mécanismes moléculaires de conduite ces transitions phénotypiques dans les sarcomes.

    Examiner les transitions MET-comme dans les cellules de sarcome, nous avons mis au point un modèle d'induction en combinant l'expression MET des facteurs épithéliales GRHL2 et la famille miR-200. Cette méthode induit rapidement des cellules de sarcome de devenir plus epithelial telle que mesurée par des altérations de la morphologie et l'expression des gènes. En utilisant ce protocole pour induire MET dans les cellules sarcome facilite l'étude de l'impact de ces transitions sur les phénotypes qui conduisent l'agression du sarcome, telscomme la migration, l'invasion, la prolifération et la résistance à la mort et la façon dont chacun de ces changements dans la biologie peuvent affecter la résistance aux médicaments.

    Dans le contexte des cancers épithéliaux, l' expression d'un facteur mésenchymateuses est souvent suffisante pour induire EMT 14. Cependant, dans ce modèle dérivé sarcomes du MET l'expression de deux facteurs épithéliales, GRHL2 et miR-200s, sont obligatoires. Fait intéressant, les miR-200s seul a eu un effet plus fort sur la plupart des biomarqueurs de MET que GRHL2, alors que GRHL2 a pu activer robustement gènes épithéliales seulement en présence de répression à base de miR-200 de répresseurs de gènes épithéliales, tels que ZEB1 24. Il est possible que pour certains types de cellules mésenchymateuses gènes épithéliales doivent être à la fois de réprimés (par exemple via miR-200s) et activé (par exemple via GRHL2) pour conduire MET.

    Nous avons connu une variation des niveaux d'expression de GRHL2 à travers différentes cellignes l. Pour remédier à cela, nous avons utilisé un plasmide d'expression de GRHL2 qui exprime également EGFP 25 pour trier par cytométrie en flux de cellules positives à l' EGFP avant les expériences. Il est également essentiel de valider la fonctionnalité de miR-200s et GRHL2 dans différents types de cellules. EMT est considéré comme un spectre basé sur l'expression de l'épithélium et les gènes associés mésenchymateuses, qui peut avoir des variations dépendant du contexte basé sur la lignée cellulaire, le type de cancer, le traitement, etc., nous avons donc analysé cinq gènes régulés par miR-200 ou GRHL2 à compte des changements dépendant du contexte cellulaire. Une autre mise en garde de ce test est le recours à une transfection transitoire de miR-200s pour l'induction MET. Ainsi, des expériences à long terme peuvent devenir coûteux et compliqué lorsque plusieurs transfections répétées sont nécessaires. Cela peut être surmonté en utilisant des plasmides d'expression miR-200.

    D'autres études ont également rapporté des preuves de MET dans les sarcomes. Par exemple, MET a été observée dans un sous-ensemble de leiomyosarcomas et était associé à une meilleure survie pour les patients. De façon mécaniste, Yang et al. constaté que , dans une inhibition de la lignée cellulaire de léiomyosarcome de Slug avec l' ARNsi était suffisante pour induire des changements de type MET 29. De même, l' épuisement d'un autre facteur mésenchymateuses, Escargot, dans les cellules souches mésenchymateuses réduit la formation de sarcomes chez les souris 30. Ainsi, il ressort de la littérature qu'il existe plusieurs voies d'accès à un phénotype MET semblable, qui peut varier selon le type de cellule. Bien que ce n'est pas la seule façon d'induire MET, nous avons utilisé notre méthode pour induire MET en deux sous-types de sarcomes, y compris rhabdomyosarcome (cellules RD) et ostéosarcome (cellules 143B). À l'avenir, il serait intéressant de comparer ces différentes méthodes dans une plus large gamme de cellules de sarcome. Par exemple, certains ne sous-types de sarcomes ont des altérations génétiques ou épigénétiques sous-jacentes qui les rendent plus ou moins sensibles à l'induction MET?

    Identification de l'impact du METsur une variété de sorties biologiques dans les cellules de sarcomes pourrait fournir une meilleure compréhension des raisons pour lesquelles les patients atteints de sarcomes plus de type épithélial ont un meilleur pronostic. De plus, la compréhension de l'impact du traitement sur la conduite des transitions phénotypiques entre les Etats serait d'approfondir notre compréhension biologique et d'informer sur la réponse aux traitements actuels chez les patients atteints de sarcome.

    Subscription Required. Please recommend JoVE to your librarian.

    Disclosures

    Les auteurs n'ont rien à dévoiler.

    Acknowledgments

    JAS reconnaît le soutien du Duke Cancer Institute, l'Université d'oncologie génito Laboratoire Duke, et le duc département de chirurgie orthopédique de l'Université. HL a été soutenu par la National Science Foundation (NSF) Centre de Biophysique théorique (NSF PHY-1427654) et NSF DMS-1361411, et comme CPRIT (Institut de prévention et de recherche sur le cancer du Texas) Scholar en recherche sur le cancer de l'État du Texas à l'Université Rice. KEW a été soutenu par le NIH F32 CA192630 MKJ et HL a bénéficié de discussions utiles avec Mary C. Farach-Carson, JN Onuchic, Samir M. Hanash, Kenneth J. Pienta et Donald S. Coffey.

    Materials

    Name Company Catalog Number Comments
    Countess automated counter Life technologies AMQAX1000
    Countess cell counting chamber slides Invitrogen C10283
    SimpliAmp Thermal Cycler Thermo Fisher A24811
    Odyssey Fc LI-COR Inc
    ViiA7 Real Time PCR System Thermo Fisher 4453536
    PCR microplate Corning 321-29-051
    KAPA SYBR Fast Universal qPCR Kit KAPA Biosystems KK4602
    Starting Block (PBS) Blocking Buffer Thermo Fisher 37538 BSA-based blocking buffer
    Agarose General Purpose LE Genesee Scientific 20-102
    10x Tris/Glycine/SDS Buffer Bio-Rad Laboratories Inc 161-0732 Running buffer
    10x Tris/Glycine Buffer Bio-Rad Laboratories Inc 161-0734 Transfer buffer
    RIPA Buffer Sigma Life Sciences SLBG8489
    Amersham Protran 0.45 μm nitrocellulose GE Healthcare Lifesciences 10600012
    Quick-RNA MiniPrep Kit Genesee Scientific 11-358
    Laemmli Sample Buffer (4X) Bio-Rad Laboratories Inc 1610747
    Mini Trans-Blot Cell Bio-Rad Laboratories Inc 1703930
    Mini-Protean Tetra Cell Bio-Rad Laboratories Inc 1658005EDU
    DPBS Life technologies 14190-144
    0.05% Trypsin-EDTA Life technologies 11995-065
    DMEM Life technologies 11995-065
    Lipofectamine RNAi Max Thermo Fisher 13778150
    Lipofectamine 2000 Ragents Thermo Fisher 11668019
    Penicillin Streptomycin Life technologies 15140-122
    miRVana miRNA mimic negative control #1 Thermo Fisher 4464058 neg miRNA
    hsa-miR-200 mirVana miRNA mimic Thermo Fisher 4464066 miR200A
    has-miR-200 mirVana miRNA mimic Thermo Fisher 4404066 miR200B
    has-miR-200 mirVana miRNA mimic Thermo Fisher 4404066 miR200C
    Opti-MEM Life technologies 11088-021 serum-free media
    anti-Ecadherin antibody BD Bioscience 610182
    anti-beta actin Santa Cruz Biotechnology sc-69879
    anti-EpCam Ab Serotec MCA18706
    anti-ZO1 Invitrogen 402200
    IRDye 800W LI-COR Inc 925-32210
    IRDye 680 LI-COR Inc 926-32223
    anti-mouse AlexaFluor 647 Thermo Fisher A211241
    anti-rabbit AlexaFluor 647 Thermo Fisher ab150075
    Halt Protease and Phosphatesse Inhibitor Thermo Fisher 1861281
    Precision Plus Protein Dual Color Bio-Rad Laboratories Inc 161-0374
    Partec CellTrics Sysmex 04-004-2326 30 μm filter for flow
    GAPDH-F IDT AGCCACATCGCTCAGACAC
    GAPDH-R IDT GCCCAATACGACCAAATCC
    Ecadherin-F IDT TGGAGGAATTCTTGCTTTGC
    Ecadherin-R IDT CGCTCTCCTCCGAAGAAAC
    ZEB1-F IDT GCATACAGAACCCAACTTGAACGTC
    ZEB1-R IDT CGATTACACCCAGACTGC
    NOTCH-F IDT GGCAATCCGAGGACTATGAG
    NOTCH-R IDT CTCAGAACGCACTCGTTGAT
    nitro blue tetrazolium  Sigma N5514
    hexadimethrine bromide Sigma H9268 polybrene
    3 mL syringe BD Bioscience 309657
    Sterile syringe filter VWR 28145-505
    5mL polypropylene round-bottom tube 352063 flow cytometry tubes
    High-Capacity cDNA Reverse Transcription Kit Thermo Fisher 4368814 reverse transcription kit
    4% paraformaldyhyde Santa Cruz Biotechnology sc-281612
    Triton-X100 Sigma 93443
    bovine serum albumin Sigma A7906

    DOWNLOAD MATERIALS LIST

    References

    1. Weber, C. E., Li, N. Y., Wai, P. Y., Kuo, P. C. Epithelial-mesenchymal transition, TGF-beta, and osteopontin in wound healing and tissue remodeling after injury. J Burn Care Res. 33, (3), 311-318 (2012).
    2. Galichon, P., Finianos, S., Hertig, A. EMT-MET in renal disease: should we curb our enthusiasm. Cancer Lett. 341, (1), 24-29 (2013).
    3. Carew, R. M., Wang, B., Kantharidis, P. The role of EMT in renal fibrosis. Cell Tissue Res. 347, (1), 103-116 (2012).
    4. Willis, B. C., Borok, Z. TGF-beta-induced EMT: mechanisms and implications for fibrotic lung disease. Am J Physiol Lung Cell Mol Physiol. 293, (3), L525-L534 (2007).
    5. Ye, X., Weinberg, R. A. Epithelial-Mesenchymal Plasticity: A Central Regulator of Cancer Progression. Trends Cell Biol. 25, (11), 675-686 (2015).
    6. Li, L., Li, W. Epithelial-mesenchymal transition in human cancer: comprehensive reprogramming of metabolism, epigenetics, and differentiation. Pharmacol Ther. 150, 33-46 (2015).
    7. Tsai, J. H., Yang, J. Epithelial-mesenchymal plasticity in carcinoma metastasis. Genes Dev. 27, (20), 2192-2206 (2013).
    8. Bitting, R. L., Schaeffer, D., Somarelli, J. A., Garcia-Blanco, M. A., Armstrong, A. J. The role of epithelial plasticity in prostate cancer dissemination and treatment resistance. Cancer Metastasis Rev. 33, (2-3), 441-468 (2014).
    9. Schaeffer, D., Somarelli, J. A., Hanna, G., Palmer, G. M., Garcia-Blanco, M. A. Cellular Migration and Invasion Uncoupled: Increased Migration Is Not an Inexorable Consequence of Epithelial-to-Mesenchymal Transition. Mol Cell Biol. 34, (18), 3486-3499 (2014).
    10. Mathow, D., et al. Zeb1 affects epithelial cell adhesion by diverting glycosphingolipid metabolism. EMBO Rep. 16, (3), 321-331 (2015).
    11. Ware, K. E., et al. A mechanism of resistance to gefitinib mediated by cellular reprogramming and the acquisition of an FGF2-FGFR1 autocrine growth loop. Oncogenesis. 2, e39 (2013).
    12. Yauch, R. L., et al. Epithelial versus mesenchymal phenotype determines in vitro sensitivity and predicts clinical activity of erlotinib in lung cancer patients. Clin Cancer Res. 11, (24 Pt 1), 8686-8698 (2005).
    13. Jolly, M. K., et al. Towards elucidating the connection between epithelial-mesenchymal transitions and stemness. J R Soc Interface. 11, (101), 20140962 (2014).
    14. Mani, S. A., et al. The epithelial-mesenchymal transition generates cells with properties of stem cells. Cell. 133, (4), 704-715 (2008).
    15. Chen, L., et al. Metastasis is regulated via microRNA-200/ZEB1 axis control of tumour cell PD-L1 expression and intratumoral immunosuppression. Nat Commun. 5, 5241 (2014).
    16. Nicolazzo, C., Gradilone, A. Significance of circulating tumor cells in soft tissue sarcoma. Anal Cell Pathol (Amst). 697395 (2015).
    17. Somarelli, J. A., et al. Mesenchymal-epithelial transition in sarcomas is controlled by the combinatorial expression of miR-200s and GRHL2. Mol Cell Biol. (2016).
    18. Bae, Y. K., Choi, J. E., Kang, S. H., Lee, S. J. Epithelial-Mesenchymal Transition Phenotype Is Associated with Clinicopathological Factors That Indicate Aggressive Biological Behavior and Poor Clinical Outcomes in Invasive Breast Cancer. J Breast Cancer. 18, (3), 256-263 (2015).
    19. Humphries, B., Yang, C. The microRNA-200 family: small molecules with novel roles in cancer development, progression and therapy. Oncotarget. 6, (9), 6472-6498 (2015).
    20. Renner, M., et al. MicroRNA profiling of primary high-grade soft tissue sarcomas. Genes Chromosomes Cancer. 51, (11), 982-996 (2012).
    21. Petrof, G., et al. Mutations in GRHL2 result in an autosomal-recessive ectodermal Dysplasia syndrome. Am J Hum Genet. 95, (3), 308-314 (2014).
    22. Werner, S., et al. Dual roles of the transcription factor grainyhead-like 2 (GRHL2) in breast cancer. J Biol Chem. 288, (32), 22993-23008 (2013).
    23. Werth, M., et al. The transcription factor grainyhead-like 2 regulates the molecular composition of the epithelial apical junctional complex. Development. 137, (22), 3835-3845 (2010).
    24. Somarelli, J. A., et al. Mesenchymal-Epithelial Transition in Sarcomas Is Controlled by the Combinatorial Expression of MicroRNA 200s and GRHL2. Mol Cell Biol. 36, (19), 2503-2513 (2016).
    25. Varma, S., et al. The transcription factors Grainyhead-like 2 and NK2-homeobox 1 form a regulatory loop that coordinates lung epithelial cell morphogenesis and differentiation. J Biol Chem. 287, (44), 37282-37295 (2012).
    26. Pruitt, S. C., Mielnicki, L. M., Stewart, C. C. Analysis of fluorescent protein expressing cells by flow cytometry. Methods Mol Biol. 263, 239-258 (2004).
    27. Zhao, Z., et al. A high-content morphological screen identifies novel microRNAs that regulate neuroblastoma cell differentiation. Oncotarget. 5, (9), 2499-2512 (2014).
    28. Borowicz, S., et al. The soft agar colony formation assay. J Vis Exp. (92), e51998 (2014).
    29. Yang, J., et al. Integrated proteomics and genomics analysis reveals a novel mesenchymal to epithelial reverting transition in leiomyosarcoma through regulation of slug. Mol Cell Proteomics. 9, (11), 2405-2413 (2010).
    30. Alba-Castellon, L., et al. Snail1 expression is required for sarcomagenesis. Neoplasia. 16, (5), 413-421 (2014).
    31. Takaishi, M., Tarutani, M., Takeda, J., Sano, S. Mesenchymal to Epithelial Transition Induced by Reprogramming Factors Attenuates the Malignancy of Cancer Cells. PLoS One. 11, (6), e0156904 (2016).

    Erratum

    Formal Correction: Erratum: Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells
    Posted by JoVE Editors on 07/03/2018. Citeable Link.

    An erratum was issued for: Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells. An author name was updated.

    One of the authors' names was corrected from:

    Shenghan Xu

    to:

    Shengnan Xu

    L&#39;induction de mésenchymateuses-épithélial Transitions dans les cellules Sarcome
    Play Video
    PDF DOI DOWNLOAD MATERIALS LIST

    Cite this Article

    Ware, K. E., Gilja, S., Xu, S., Shetler, S., Jolly, M. K., Wang, X., Bartholf Dewitt, S., Hish, A. J., Jordan, S., Eward, W., Levine, H., Armstrong, A. J., Somarelli, J. A. Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells. J. Vis. Exp. (122), e55520, doi:10.3791/55520 (2017).More

    Ware, K. E., Gilja, S., Xu, S., Shetler, S., Jolly, M. K., Wang, X., Bartholf Dewitt, S., Hish, A. J., Jordan, S., Eward, W., Levine, H., Armstrong, A. J., Somarelli, J. A. Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells. J. Vis. Exp. (122), e55520, doi:10.3791/55520 (2017).

    Less
    Copy Citation Download Citation Reprints and Permissions
    View Video

    Get cutting-edge science videos from JoVE sent straight to your inbox every month.

    Waiting X
    simple hit counter