Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Developmental Biology

Induksjon av Mesenchymale-Epitelial Transitions i sarkomceller

doi: 10.3791/55520 Published: April 7, 2017

ERRATUM NOTICE

Summary

Vi presenterer her en cellekultur metode for indusering av mesenchymale-epitelial overganger (MET) i sarcom-celler basert på kombinerte ektopisk ekspresjon av mikroRNA-200 familiemedlemmer og grainyhead liknende 2 (GRHL2). Denne metoden er egnet for bedre å forstå den biologiske effekten av fenotypisk plastisitet på kreft aggressivitet og behandlinger.

Abstract

Fenotypisk plastisitet refererer til et fenomen der cellene forbigående får trekk fra en annen slekt. Under karsinom progresjon, driver fenotypisk plastisitet invasjon, spredning og metastase. Faktisk, mens det meste av studier av fenotypisk plastisitet har vært i sammenheng med epitel-avledet karsinomer, viser det seg sarkomer, som er mesenchymale opprinnelse, også vise fenotypisk plastisitet, med en undergruppe av sarkomer gjennomgår et fenomen som ligner en mesenchymal- epitelial overgang (MET). Her har vi utviklet en fremgangsmåte som omfatter MIR-200 familie og grainyhead-lignende 2 (GRHL2) for å etterligne dette MET-lignende fenomen ble observert i sarkom pasient samples.We sekvensielt uttrykker GRHL2 og MIR-200 ved bruk av familie celle transduksjon og transfeksjon, respektivt , for bedre å forstå de molekylære grunnlaget for disse fenotypiske overganger i sarkomceller. Sarcom-celler som uttrykker MIR-200s og GRHL2 vist forbedret epitelial characteristics i cellemorfologi og endring av epiteliale og mesenkymale biomarkører. Fremtidige studier ved bruk av disse fremgangsmåter kan anvendes for å bedre forstå de fenotypiske konsekvensene av MET-lignende prosesser på sarkomceller, som migrering, invasjon, metastatisk tilbøyelighet, og terapi motstand.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Fenotypisk plastisitet refererer til en reversibel overgang mellom cellulære fenotyper, og er vanligvis delt inn i to typer, epitelial-til-mesenchymale (EMT) overganger og mesenchymale-til-epitelial overganger (MET). Dette fenotypisk plastisitet spiller en viktig rolle i normale prosesser i flercellede organismer, slik som utvikling og sårheling 1; imidlertid kan de samme reaksjonsveier og genekspresjon programmene også føre til sykdom, slik som fibrose (oversikt i 2, 3, 4) og karsinom metastase (gjennomgått i henvisningene 5, 6, 7, 8). I løpet av metastasering, for eksempel, forstyrrer EMT celle polaritet, og celle-celleinteraksjoner, og fremmer invasjon 9, 10. Sammen, EMT bidras til en fenotypisk tilstand som muliggjør kreftcelle formidling. I tillegg EMT fører også til en rekke andre fenotypiske endringer og som driver en aggressiv fenotype, inkludert Dereguleringen av kreftcellemetabolismen 6, utvikling av medikamentresistens 11, 12, økt tumor-initiering evne 13, 14 og vertens immun flukt 15.

Fenotypisk plastisitet er blitt grundig undersøkt i karsinom progresjon; Men sarkomer også vise fenotypisk plastisitet. Interessant, ser det ut som om noen av de samme driverne av fenotypisk plastisitet i Kreftsvulster også bidra til sarkom plastisitet og aggressivitet. For eksempel har sirkulerende tumorceller (CTCs) fra sarcoma pasienter blitt vist å uttrykke EpCAM, et celleoverflateprotein som vanligvis finnes på epitelceller 16. Addimessig, ble 250 mykvevssarkoma prøvene kategorisert som epitel-lignende eller mesenchymale-lignende basert på genekspresjon. Pasienter i epitel-lignende biomarkør signatur hadde en bedre prognose enn pasienter med mesenchymale-lignende biomarkør signatur 17. Dette er i overensstemmelse med mange karsinomer, hvor pasienter med mer epitel-lignende karsinomer, har bedre resultater sammenlignet med pasienter med mer mesenchymale lignende tumorer 18.

Mens noen sarkomer viser biomarkører og genekspresjon baner i samsvar med MET, forblir de molekylære grunnlaget for denne fenotypisk plastisitet dårlig forstått. For å studere mekanismene og sjåfører MET i sarkom vi utviklet en modell for MET-induksjon ved hjelp av to epitel-spesifikke faktorer, mikroRNA (MIR) -200 familie og grainyhead-lignende 2 (GRHL2). MIR-200s er en familie av små ikke-kodende RNA som regulerer genekspresjon ved å binde seg til de 3' UTR av Messenger RNA og hindre oversettelse til protein. MIR-200-familien består av to undergrupper - en som inneholder MIR-141 og MIR-200A, og den andre, inkludert MIR-200b, MIR-200c, og MIR-429. Medlemmer av MIR-200-familien er anriket i epitelvev, og tapet av mir-200s er forbundet med metastase i karsinomer 19. MIR-200 familien er også nedregulert i bløtvevssarkomer sammenlignet med normalt vev 20. I likhet med de MIR-200S, er GRHL2 en nøkkel regulator som er viktig for epitelisk utvikling 21. Den GRHL2 transkripsjonsfaktor virker på to måter for å oppregulere epiteliale gener, slik som E-cadherin: 1) i epitelceller, GRHL2 direkte undertrykker EMT hovedregulator, ZEB1 22; og 2) GRHL2 aktiverer direkte transkripsjon av gener epiteliale 23. Våre tidligere undersøkelser har vist at kombinerte ekspresjon av MIR-200s og GRHL2 i sarkomcellerinduserer en MET-lignende fenotype 24. Her presenterer vi en detaljert protokoll for å skape en in vitro modell av MET-induksjon i sarcom-celler ved hjelp av ektopisk ekspresjon av MIR-200S og GRHL2.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Fremstilling av reagenser

  1. Forbered DMEM i cellekultur ved å tilsette 50 ml føtalt bovint serum (FBS) og 5 ml penicillin-streptomycin (5.000 U / ml) til 500 ml DMEM. Dette mediet kan lagres ved 4 ° C i opp til seks måneder.
  2. Resuspender lyofiliserte primere i nuklease-fritt vann til en sluttkonsentrasjon på 10 uM. Oppbevar resuspendert primere ved -20 ° C.
  3. Forbered radioimmunopresipitasjonsanalyse assay (RIPA) buffer (150 mM NaCl, 0,5% natriumdeoxycholat, 0,1% SDS, 50 mM Tris, pH 8,0). Supplere med protease inhibitor cocktail før bruk og buffer på is under bruk. Oppbevar ved 4 ° C.
  4. Forbered 10 mg / ml polybren (hexadimethrine bromid) i vann og sprøytefilter for å sterilisere ved hjelp av et 0,45 um filter polyetersulfon. Løsningen kan bli lagret ved 4 ° C i opp til seks måneder.
  5. Fremstill en 1 mg / mL arbeidsløsning av nitroblått tetrazoliumklorid ved oppløsning av 10 mg i 10 ml PBS. Oppbevar ved 4 ° C.

2. Lentiviral Transduksjon av GRHL2

Dag 1

  1. Plate 3 x 10 5 HEK293T celler per brønn i en 6-brønns plate i 2 ml supplert DMEM. Kvantifisere celler ved anvendelse av et automatisk celleteller. Celler bør være 40 - 60% sammenflytende etter dyrking over natten ved 37 ° C med 5% CO2.

dag 2

  1. Fortynn 2 ug av tom vektor (pCMV-UBC-EGFP) eller 2 ug pCMV-GRHL2-UBC-EGFP 24, 25 i 200 ul av serum-frie media sammen med 1,8 pg av pΔ8.9 og 0,2 ug pCMV-VSV -G helper plasmider. I et separat rør, fortynnet 4 ul av en lipid-basert transfeksjon reagens i 200 ul serumfritt media pr transfeksjon (8 ul i 400 ul i to prøver). Tilsett 200 ul av transfeksjon reagens blanding til hvert plasmid løsning og inkuber i 20 minutter ved romtemperatur.
  2. Under incubasjon, vasker HEK293T celler ved å fjerne mediet ved vakuumavsugning og skylling av cellene med 1 ml PBS. Erstatte PBS med 800 ul serumfritt medium. Etter 20 minutter, tilsett 200 ul transfeksjonsbuffer reagens: plasmid blandingen fra trinn 2.2 tilsatt til hver brønn og inkuber-celler i 2 timer ved 37 ° C i 5% CO2.
  3. Fjern forsiktig transfeksjon medium ved vakuumavsugning og erstatte med 2 ml supplert DMEM. Returner cellene til inkubatoren for natten kultur.
    MERK: HEK293T cellene er løst tilhenger. Media utskifting må utføres med forsiktighet for å begrense fjerningen av celler fra bunnen av fatet eller kolbe.

dag 3

  1. Oppdatere media på transfekterte celler HEK293T og platen 3 x 10 5 RD celler per brønn i en 6-brønners plate i 2 ml supplert DMEM. Kultur cellene over natten. RD celler er en kommersielt tilgjengelig human rhabdomyosarcoma cellelinje.

dag 4

  • Samle virusmateriale fra HEK293T celler. Pipetter DMEM medier fra HEK293T celler og plass til en ny 15 ml konisk. Nøye erstatte med nye DMEM medier og sted HEK293T cellene tilbake i kuvøse for neste dag.
  • Tilsett 2 ul av 10 mg / ml polybren per ml av virusmateriale i to nye 50 ml koniske rør (en for den tomme vektoren transfeksjon og en annen for den GRHL2 transfeksjon). Sprøytefilter viral media ved å fjerne stemplet fra en 3 ml sprøyte og feste et 0,45 um filter polyetersulfon til spissen.
    1. Tilsett virale mediene angitt i trinn 2.6 inn i sprøytens sylinder, og styrter media i de nye 50 ml koniske rør som inneholder polybren. Fjern mediet fra RD celler ved vakuumavsugning og legge filtrert for viral media for å RD celler.
  • dag 5

    1. Gjenta Dag 4. HEK293T celler kan kastes etter virus media har blitt samlet inn.

    dag 7

    1. Vask RD celler med 1 ml PBS og Tilsett 200 ul av 0,05% trypsin pr. Inkuber ved 37 ° C i 5 minutter, tilsett 2 ml media supplert, og flytte cellesuspensjon til et nytt 15 ml konisk. Sentrifuger cellene ved 250 xg i 5 minutter ved romtemperatur og aspireres media. Gjensuspender i 1 ml DMEM (supplert med 5% FBS og 1% penicillin-streptomycin).
      MERK: Ved hjelp av en høyere prosentandel av FBS kan føre til tilstopping under flowcytometri
      1. Filter celler for flowcytometri. Bruke en pipette for å påføre en mL RD-cellesuspensjonen gjennom et 30 um filter inn i flowcytometri rør og plassere rørene på is.
      2. Sorterings EGFP + celler 26 i 1,5 ml mikrosentrifugerør som inneholdt 0,5 ml DMEM supplert med 10% FBS og 1% penicillin-streptomycin og plasser på is. Plate EGFP + sortert cellene i en samlet av 1 ml DMEM supplert inn i en enkelt brønn av en 12-brønns plate og sted i inkubatoren for kulturen.
        ; MERK: Utbyttet av EGFP + celler fra flow-cytometri etter dette transduksjon er vanligvis lav (50,000-100,000 celler). Celler kan trenge å bli dyrket i 10 - 14 dager før man går videre til trinn 3.

    3. Omvendt Transfeksjon av MIR-200s

    1. Forbered 50 uM lagrene av MIR-200 etterligner ved hjelp av nuklease-fri H2O Delmengde bestander og oppbevar ved -20 ° C for å unngå gjentatte fryse / tine sykluser.
    2. Tilsett 3 ul av hver 50 uM MIR-200 etterligne (MIR-200A, MIR-200b, og MIR-200c) til 300 ul av serum-frie media eller 9 mL av 50 ^ M-negative kontroll miRNA til 300 ul serumfritt medium.
    3. Tilsett 6 ul av siRNA-spesifikk transfeksjon reagens til 600 ul av serum-frie media og dele 300 pl av denne blandingen inn i to rør, ett for hver av de to mir blandingene fra trinn 3.2. Kombiner de 300 ul av hver MIR blandingen fra trinn 3.2 med en blanding av 300 ul av transfeksjon reagens. Inkuber i 20 minutter ved værelsemperature.
    4. Mens inkubering, fremstille en cellesuspensjon på 600.000 EGFP + RD-celler som uttrykker EV eller GRHL2 opprettet i avsnitt 2 i 2,4 ml (250 celler / ul) av serumfritt medium per behandling.
    5. I en 24-brønn plate tilsettes 100 ul per brønn av mir-200 blanding eller negativ kontrollblanding fra trinn 3,3 til seks brønner, og deretter legge til 400 ul av hver cellesuspensjon i tre brønner i hver mir blanding.
    6. Inkuber cellene ved 37 ° C i 5% CO2 over natten og endre media for å fullt ut supplert DMEM neste dag. Samle celler 2 dager senere for analyse ved anvendelse av den passende buffer (se nedenfor). Time-lapse avbildning av RD sarkom celler gjennomgår MET er tilgjengelig som supplerende materiale. Bilde hver brønn hver 2 timer med et 10X objektiv hjelp av en automatisert levende celle-imager 27.

    4. RNA-ekstraksjon, revers transkripsjon, og qPCR

    1. Pakk RNA i henhold til produsentens instruksjoner ved hjelp av en standard RNAekstraksjonssett 24. Ekstrahert RNA kan bli lagret ved -80 ° C.
    2. Kvantifisere RNA-konsentrasjon. Tine og arbeide med RNA på is. For å kvantifisere RNA-konsentrasjoner, måle UV absorbans ved 260 nm med et spektrofotometer plateleser i henhold til produsentens protokoll. Fortynn alle prøvene til den laveste konsentrasjon med nuklease-fri vann.
    3. Utføre revers transkripsjon av total RNA inn i komplementært DNA (cDNA). Kombiner ikke mindre enn 100 ng av total RNA med PCR-buffer, dNTP-blanding (100 mM), tilfeldige heksamerprimere, revers transkriptase og nuklease-fri vann i et 20 ul reaksjonsvolum 24. Kjør RT sykluser ifølge produsentens protokoll. cDNA kan lagres lang sikt ved -20 ° C.
    4. Fortynn 20 ul reaksjoner til 100 pl med 80 ul av nuklease-fri H2O
    5. Bland 5 mL av en fluorescens-basert interkalerende fargestoff 2x qPCR konsentrat-blanding, 0,06 ul av hver 10 pM primer, ennd 2 ul av fortynnet RT reaksjon per prøve.
    6. Løpe qPCR i henhold til forhandlerens protokoll for fluorescens-baserte masterblanding.
    7. Kvantifisere relative mengder av mRNA av delta CT metode og normaliseres til GAPDH. Plott midlere mRNA-ekspresjon av biologiske replikater ± standardavvik for hver behandlingsgruppe.
      MERK: Spesielle forholdsregler bør tas når du arbeider med RNA for å unngå kontakt med RNases, for eksempel ved hjelp av RNase-fri plast og reagenser. Non-engangsutstyr bør behandles før bruk for å fjerne RNases.

    5. immunofluorescensfarging

    1. Etter trinn 3.6, suge mediet ved vakuumavsugning fra RD-celler i 24-brønners format.
    2. Fix-celler ved tilsetning av 500 ul av 4% paraformaldehyd (PFA) per brønn og inkuber i 15 minutter ved romtemperatur (RT). Etter fiksering, plassere cellene i fosfatbufret saltoppløsning (PBS) og oppbevares ved 4 ° C over natten om nødvendig.
    3. permeabilizeceller ved tilsetning av 500 ul av PBS + 0,2% Triton-X-100 og inkubert 30 minutter ved romtemperatur. Ved vakuumavsugning, fjerne permeabiliseringsbuffer og vask tre ganger med PBS.
    4. Blokk i 500 ul av 5% bovint serumalbumin (BSA) / PBS og inkubere cellene i 30 minutter ved romtemperatur. Celler kan lagres ved 4 ° C over natten om nødvendig.
    5. Forbered primært antistoff-fortynning. Pipetter 200 ul 5% BSA / PBS per brønn i en 15 ml konisk (12 brønner = 2,4 ml) og tilsett 1 pl av primært antistoff per ml 5% BSA / PBS som trengs. Fjern blokkeringsbuffer ved vakuumavsugning og dispenser 200 ul fortynnede primært antistoff til hver brønn.
      1. Inkuber cellene i 1: 1000 fortynnet primære antistoffer i 5% BSA / PBS i 1 time ved romtemperatur eller over natten ved 4 ° C. Etter inkubering vaskes cellene to ganger med PBS.
    6. Fremstill den sekundære antistoff-fortynning i det samme volum av 5% BSA / PBS som ovenfor. Tilsett langt-rødt fargestoff-konjugert sekundært antistoff under anvendelse av en 1: 2000 fortynning. I tillegg legger1 ug / ml av Hoechst fargestoff til blandingen. Fjern PBS og tilsett 200 pl av blandingen til hver brønn.
      1. Inkuber ved RT i 1 time i mørke. Vask 3 ganger med PBS, la cellene i PBS, og beskytter cellene mot lys ved hjelp av folie. Celler kan lagres ved 4 ° C dersom det er nødvendig.
    7. Bilde celler ved 400x total forstørrelse på et invertert mikroskop med epifluorescens eksitasjons bølgelengde 594 til 650 nm.

    6. Western blotting

    1. Vask celler fra 3.6 to ganger med iskald PBS. På is, buffer Cellene lyseres med 50 ul av 1 x RIPA supplert med 1x protease inhibitor cocktail.
    2. Fjell lysater ved 4 ° C i 15 minutter, samle lysater i 1,5 ml ampuller, rør og sentrifuger ved høy hastighet (20.000 x g) i 5 minutter for å klargjøre prøver. Cellelysater kan lagres lang sikt ved -80 ° C hvis det er nødvendig.
    3. Kvantifisere totalt protein ved hjelp av en Bradford-analyse og alikvotere en lik mengde protein til nye 1,5 ml mikrosentrifugerør. Bring prøver til samme volum ved hjelp av RIPA-buffer, og 3 x Laemmli-ladebuffer supplert med 2-merkaptoetanol.
    4. Inkuber prøver i 1 x Laemmli-prøveladningsbuffer i 5 minutter ved 95 ° C og drives SDS-PAGE ved anvendelse av en 4-12% Tris-glysin gel ved 200 V i 45 minutter. Mengden av protein lastet varierer avhengig av cellelinjen. I noen tilfeller er 50 til 100 mikrogram av totalt protein som er nødvendig for å påvise E-cadherin i mesenkymale cellelinjer.
    5. Overføring proteinene på et nitrocellulosemembran i 2 timer ved 50 V i 1 x Tris-glycin-overføringsbuffer.
    6. Blokk membran i 1 time ved romtemperatur eller over natten ved 4 ° C i en BSA-baserte blokkeringsbuffer.
    7. Fortynn primære antistoffer ved 1: 1000-konsentrasjon i 5 ml blokkeringsbuffer, legger fortynning til membranen, og inkuber med forsiktig vugging i 1 time ved romtemperatur eller over natten ved 4 ° C. Vask membran 3 ganger i PBS med 0,05% Tween-20.
    8. Inkuber membraner i 1 time ved RT med fluorescerende koplet sekundærviklingeny-antistoff ved 1: 20000 fortynning i blokkeringsbuffer som ovenfor.
    9. Vask membran to ganger i PBS med 0,05% Tween-20, og deretter en gang i PBS.
    10. Bilde membran ved hjelp av vanlig infrarød fluorescens deteksjon.

    7. forankringsuavhengige vekstanalyser

    MERK: For en detaljert Mykagarutprøvning protokollen, se 28.

    1. Varm steril 2x DMEM-media til 42 ° C i varmt vannbad. I løpet av denne tiden, varme pre-autoklaveres i 1% agarose i mikrobølgeovn i 3 min. Mikrobølgeovn i ytterligere 30 sekunder ved en tid som er nødvendig, eller til det er helt smeltet. Flytt agarose til en 42 ° C vannbad.
    2. Plassere et 50 ml konisk rør i et begerglass med 42 ° C vann i en steril hette og blande 1% agarose og 2x DMEM-medium i en 1: 1-forhold regnskap for 1,5 ml av blandingen pr brønn i en 6-brønners plate. Alltid forberede ekstra DMEM / agarose å gjøre rede for pipetteringsfeil og for å unngå bobler.
    3. Legg blandingen tilsider av brønnen, noe som sikrer ingen bobler dannes, og la blandingen stå i 30 minutter ved romtemperatur.
    4. Mens bunnlaget er størkne, å klargjøre hver gruppe av RD-celler transfektert i trinn 3, ved å suge media og vasking én gang med 1 ml PBS. Aspirer PBS og tilsett 0,2 ml av 0,05% trypsin og inkuber ved 37 ° C i 5 min.
    5. Nøytralisere trypsin i 0,8 ml medium og triturer celler til å danne en enkeltcellesuspensjon. Overfør cellesuspensjonen til en 15 ml konisk rør.
    6. Cellene telles og beregne volumet av cellesuspensjon som kreves for 10.000 celler per brønn.
    7. Varm 0,6% agarose i mikrobølgeovn i 3 minutter, fulgt av 30 s ved et tidspunkt til det er helt smeltet. Flytt agarose til 42 ° C vannbad.
    8. Plassere et 50 ml konisk rør i et begerglass med 42 ° C vann i en steril hette. Bland 0,6% agarose og ble fortynnet cellesuspensjon i et 1: 1 forhold for å fremstille 1,5 ml av blandingen pr brønn i en 6-brønners plate. Alltid fremstille ekstra cellesuspensjon / agarose blanding for å gjøre rede for pipetteringsfeil ogfor å unngå bobler.
      MERK: Det er viktig å jobbe ved 42 ° C her. Dersom temperaturen er for lav vil blandingen størkne før plettering, og temperaturer over 42 ° C vil påvirke cellenes levedyktighet.
    9. Bland godt ved triturering celler flere ganger, og legge til celleblandingen til brønnene, sikrer at ingen bobler form, og la stivne i 20 minutter ved RT.
    10. Tilsett 2 ml media supplert til hver brønn og platene beveger seg til inkubatoren.
      1. Endre media en gang i uken i 3-4 uker eller til flercellede kolonier dannes. Vær forsiktig for å unngå å berøre agar når du fjerner media ved vakuumaspirasjon. Alternativt kan bruke en P1000 for å fjerne det øverste laget av flytende medier.
      2. Flekken myke agar-platene ved tilsetning av 200 ul av nitroblått tetrazoliumklorid oppløsning (1 mg / ml i PBS) og inkuber platen over natten ved 37 ° C. Bytt media neste dag med PBS for bildebehandling.
      3. Bilde brønner på 40X total forstørrelse på en invertert mikroskop.
      4. Utføre analyser på ImageJ for koloni areal og antall. Plot mener koloni rekke biologiske replikater ± standardavvik.

    Subscription Required. Please recommend JoVE to your librarian.

    Representative Results

    or Start trial to access full content. Learn more about your institution’s access to JoVE content here

    Schema for MET-induksjon i sarkomceller

    En generell tidslinje for induksjon av MET-lignende forandringer i sarcom-celler er vist i figur 1. Protokollen begynner ved å transdusere GRHL2 (figur 1A), etterfulgt av transfeksjon av den mir-200 familie (figur 1B). GRHL2 eller MIR-200 familiemedlemmer var ikke i stand til å påvirke utseendet av RD-celler når de uttrykkes alene, men ektopisk ekspresjon av GRHL2 og MIR-200s sammen resulterer i epitel-lignende morfologiske forandringer i RD celler. Celler overgang fra en spindel-form til en mer avrundet utseende med øket celle-celle kontakt (figur 1C).

    Induksjon av MET-lignende endringer i sarkomceller

    Den morfologiske forandring i RD celler ved GRHL2 og MIR-200over-ekspresjon ble fulgt ved oppregulering av epitel markør E-cadherin (figur 2A). Tilsetning av MIR-200s oppregulerte E-cadherin alene, men kombinert MIR-200s og GRHL2 overekspresjon synergistisk øket E-cadherin uttrykket (figur 2A; ikke log skala). I tillegg var det en økning i celle-celleforbindelser av epitel adhesjonsmolekyler, EpCAM og TJP1, hvite piler (også kjent som zona occludens 1, ZO-1) (figur 2B).

    MET induksjon reduserer kolonidannelse evne sarkomceller

    Oppregulering av epiteliale proteiner ble fulgt ved nedregulering av mesenchymale gener Zeb1 og Notch1 (figur 3A), som er kjent mål for MIR-200. Induksjon av MET redusert den forankrings-uavhengig vekst av RD-celler som målt ved koloninummer (figur 3B). dette growth inhibering ble drevet av MIR-200s alene; som overekspresjon av GRHL2 ført til en økning i forankringsuavhengig vekst (figur 3). Dette er i overensstemmelse med tidligere rapporter som viser GRHL2 ekspresjon induserer forankrings-uavhengig vekst 22.

    Figur 1
    Figur 1: tidslinje av MET Induksjon med GRHL2 Overekspresjon og MIR-200 Transfeksjon. (A) tidslinje for ektopisk overekspresjon av GRHL2 i målceller. (B) tidslinje for MET-induksjon via revers transfeksjon av mir-200 familiemedlemmer i målceller. (C) GRHL2 og MIR-200 overekspresjon ført til endringer i morfologien av målceller i samsvar med MET. Scale bar = 75 mikrometer Klikk herfor å se en større versjon av dette tallet.

    Figur 2
    Figur 2: Samtidig Overekspresjon av GRHL2 og MIR-200s Ført til MET i målceller. (A) Ekspresjon av MIR-200s førte til forhøyet E-cadherin uttrykk mens kombinerte ekspresjon av GRHL2 og MIR-200S fremstilt en synergistisk virkning på E-cadherin uttrykk både mRNA (middelverdier ± standardavvik), og proteinnivåer. (B) til sammen ekspresjon av GRHL2 og MIR-200s førte til øket ekspresjon av EpCAM og TJP1 ved celle-celle-kontakter (piler). Skala bar = 20 mikrometer. * Indikerer p <0,05 analysert ved anvendelse av ANOVA med Tukey post-hoc correction.This figuren er blitt modifisert fra referanse 24. Copyright © American Society for Microbiology, Molecular Cell Biology, volum 36, Issue 19, 2503-2513, 2016. Klikk her for å se en større versjon av dette tallet.

    Figur 3
    Figur 3: Ekspresjon av MIR-200S undertrykker Mesenchymale markering og minker Forankringsuavhengig vekst på sarkomceller. (A) Over - ekspresjon av MIR-200s men ikke GRHL2 hemmet Zeb1 og Notch1 mRNA-ekspresjon (middelverdier ± standardavvik). (B) Over-ekspresjon av MIR-200s men ikke GRHL2 inhiberte anoikis motstand på sarkomceller. Representative bilder av fargede kolonier (Skala bar = 200 um), og kvantifisering av koloninummer (middelverdier ± standardavvik) er vist. * Indikerer p <0,05 analysert ved anvendelse av ANOVA med Tukey post-hoc correction.This figuren er blitt forandret fra reference 24. Copyright © American Society for Microbiology, Molecular Cell Biology, volum 36, Issue 19, 2503-2513, 2016. Klikk her for å se en større versjon av dette tallet.

    Figur 3
    Supplemental Video: RD celler som uttrykker tom vektor og negative kontroll miRNAs. Videoer ble kompilert fra bilder av RD-celler transfektert med tom vektor og negative kontroll mirnas ervervet hver annen time ved å bruke en automatisert levende celle-imager. Klikk her for å se denne videoen. (Høyreklikk for å laste ned.)

    Figur 3 />
    Supplemental Video 2: RD celler som uttrykker GRHL2-EGFP og negativ kontroll miRNAs. Videoer ble kompilert fra bilder av RD-celler transfektert med GRHL2-EGFP og negative kontroll mirnas ervervet hver annen time ved å bruke en automatisert levende celle-imager. Klikk her for å se denne videoen. (Høyreklikk for å laste ned.)

    Figur 3
    Supplemental Video 3: RD celler som uttrykker tom vektor og miR200 miRNAs. Videoer ble kompilert fra bilder av RD-celler transfektert med tom vektor og miR200 mirnas ervervet hver annen time ved å bruke en automatisert levende celle-imager. Klikk her for å se denne videoen. (Høyreklikk for å laste ned.)

    nt" fo: keep-together.within-page = "1"> Figur 3
    Supplemental Video 4: RD celler som uttrykker GRHL2-EGFP og miR200 miRNAs. Videoer ble samlet fra bilder av RD-celler transfektert med GRHL2-EGFP og miR200 mirnas tilegnet hver annen time ved å bruke en automatisert levende celle-imager. Klikk her for å se denne videoen. (Høyreklikk for å laste ned.)

    Subscription Required. Please recommend JoVE to your librarian.

    Discussion

    or Start trial to access full content. Learn more about your institution’s access to JoVE content here

    Sarkomer er sjeldne, men svært aggressiv kreft i en mesenchymale avstamning. Til tross for deres mesenchymale avstamning, en undergruppe av sarkomer ser ut til å gjennomgå en fenotypisk overgang til en mer epitel-lignende tilstand. Dette MET-lignende bryter har prognostisk betydning, da pasienter med mer epitel-lignende svulster er mindre aggressive 24. Til tross for sin kliniske relevans, er det få studier som omhandler de molekylære mekanismene som driver disse fenotypiske overganger i sarkomer.

    For å undersøke MET-lignende overganger i sarcom-celler, har vi utviklet en MET-induksjon modell ved å kombinere ekspresjon av epiteliale faktorer GRHL2 og MIR-200 familien. Denne metoden raskt induserer sarcom-celler til å bli mer epitel-lignende målt ved forandringer i morfologi og genekspresjon. Ved hjelp av denne protokollen til å indusere MET i sarkomceller muliggjør studium av virkningen av disse overganger på de fenotyper som driver sarkom aggresjon, f.ekssom migrasjon, invasjon, proliferasjon og død motstand, og hvor hver av disse forandringer i biologi kan påvirke medikamentresistens.

    I forbindelse med epitel-avledet karsinomer, er ekspresjon av en mesenchymale faktor ofte tilstrekkelig til å indusere EMT 14. Men i denne sarkom-avledet modell av MET ekspresjonen av to faktorer, epiteliale GRHL2 og MIR-200S, er nødvendig. Interessant, MIR-200s alene hadde en sterkere virkning på de fleste biomarkører for MET enn GRHL2, mens GRHL2 var i stand til å aktivere robust epiteliale gener bare i nærvær av mir-200-basert undertrykkelse av epiteliale gen repressorer, slik som ZEB1 24. Det er mulig at for noen mesenchymale celletyper epitel-gener må være både de-undertrykket (for eksempel via MIR-200s) og aktivert (for eksempel via GRHL2) for å drive MET.

    Vi har opplevd variasjoner i nivåene av GRHL2 uttrykk på tvers av ulike cell linjer. For å overvinne dette, ble det benyttet en GRHL2 ekspresjonsplasmid som også uttrykker EGFP 25 for å sortere ved flowcytometri EGFP-positive celler før forsøkene. Det er også viktig å validere funksjonaliteten til mir-200s og GRHL2 i forskjellige celletyper. EMT er sett på som et spektrum basert på ekspresjon av epitelial og mesenkymale-assosierte gener, noe som kan ha kontekstavhengig variasjon basert på cellelinjen, krefttype, behandling, etc. Derfor, analyserte vi fem gener som reguleres av MIR-200 eller GRHL2 til står for cellekontekstavhengige endringer. En annen forbeholdet av denne analysen er avhengigheten av en transient transfeksjon av MIR-200s for MET-induksjon. Dermed kan langsiktige eksperimenter blir kostbart og komplisert når flere gjentar transfections bli nødvendig. Dette kan overvinnes ved anvendelse MIR-200 ekspresjonsplasmider.

    Andre studier har også rapportert bevis for MET i sarkomer. For eksempel ble MET observert i et delsett av leiomyosarcomas og var forbundet med bedre overlevelse for pasientene. Mekanistisk Yang et al. funnet at i en leiomyosarkom cellelinje hemming av Slug med siRNA var tilstrekkelig til å indusere MET-lignende endringer 29. Likeledes, uttømming av enda en mesenchymale faktor, snegl, i stamceller redusert sarkom dannelse hos mus 30. Således er det klart fra litteraturen at det er flere veier til en MET-lignende fenotype, som kan variere med celletypen. Selv om dette er ikke den eneste måten å indusere MET har vi brukt vår metode for å indusere MET i to sarkom undergrupper, inkludert rabdomyosakrom (RD celler) og osteosarkom (143B celler). I fremtiden vil det være interessant å sammenligne disse ulike metoder i et bredere spekter av sarkom celler. For eksempel har visse sarkom undertypene har underliggende genetiske eller epigenetiske forandringer som gjør dem mer eller mindre utsatt for MET induksjon?

    Identifisere virkningen av METpå en rekke biologiske utganger i sarkomer celler kan gi en bedre forståelse av hvorfor pasienter med flere epitel-lignende sarkomer har en bedre prognose. I tillegg forstå virkningen av behandlingen på å styre de fenotypiske overganger mellom stater vil utdype vår biologiske forståelse og informere på svar på aktuelle behandlingsformer i sarkom pasienter.

    Subscription Required. Please recommend JoVE to your librarian.

    Disclosures

    Forfatterne har ikke noe å avsløre.

    Acknowledgments

    JAS erkjenner støtte fra Duke Cancer Institute, The Duke University Genitourinary Oncology Laboratory, og Duke University Ortopedisk avdeling. HL ble støttet av National Science Foundation (NSF) Senter for teoretisk Biological Physics (NSF PHY-1427654) og NSF DMS-1361411, og som en CPRIT (Cancer Prevention and Research Institute of Texas) Scholar i Cancer Research i delstaten Texas ved Rice University. KEW ble støttet av NIH F32 CA192630 MKJ og HL tjente nyttig diskusjon med Mary C. Farach-Carson, JN Onuchic, Samir M. Hanash, Kenneth J. Pienta, og Donald S. Coffey.

    Materials

    Name Company Catalog Number Comments
    Countess automated counter Life technologies AMQAX1000
    Countess cell counting chamber slides Invitrogen C10283
    SimpliAmp Thermal Cycler Thermo Fisher A24811
    Odyssey Fc LI-COR Inc
    ViiA7 Real Time PCR System Thermo Fisher 4453536
    PCR microplate Corning 321-29-051
    KAPA SYBR Fast Universal qPCR Kit KAPA Biosystems KK4602
    Starting Block (PBS) Blocking Buffer Thermo Fisher 37538 BSA-based blocking buffer
    Agarose General Purpose LE Genesee Scientific 20-102
    10x Tris/Glycine/SDS Buffer Bio-Rad Laboratories Inc 161-0732 Running buffer
    10x Tris/Glycine Buffer Bio-Rad Laboratories Inc 161-0734 Transfer buffer
    RIPA Buffer Sigma Life Sciences SLBG8489
    Amersham Protran 0.45 μm nitrocellulose GE Healthcare Lifesciences 10600012
    Quick-RNA MiniPrep Kit Genesee Scientific 11-358
    Laemmli Sample Buffer (4X) Bio-Rad Laboratories Inc 1610747
    Mini Trans-Blot Cell Bio-Rad Laboratories Inc 1703930
    Mini-Protean Tetra Cell Bio-Rad Laboratories Inc 1658005EDU
    DPBS Life technologies 14190-144
    0.05% Trypsin-EDTA Life technologies 11995-065
    DMEM Life technologies 11995-065
    Lipofectamine RNAi Max Thermo Fisher 13778150
    Lipofectamine 2000 Ragents Thermo Fisher 11668019
    Penicillin Streptomycin Life technologies 15140-122
    miRVana miRNA mimic negative control #1 Thermo Fisher 4464058 neg miRNA
    hsa-miR-200 mirVana miRNA mimic Thermo Fisher 4464066 miR200A
    has-miR-200 mirVana miRNA mimic Thermo Fisher 4404066 miR200B
    has-miR-200 mirVana miRNA mimic Thermo Fisher 4404066 miR200C
    Opti-MEM Life technologies 11088-021 serum-free media
    anti-Ecadherin antibody BD Bioscience 610182
    anti-beta actin Santa Cruz Biotechnology sc-69879
    anti-EpCam Ab Serotec MCA18706
    anti-ZO1 Invitrogen 402200
    IRDye 800W LI-COR Inc 925-32210
    IRDye 680 LI-COR Inc 926-32223
    anti-mouse AlexaFluor 647 Thermo Fisher A211241
    anti-rabbit AlexaFluor 647 Thermo Fisher ab150075
    Halt Protease and Phosphatesse Inhibitor Thermo Fisher 1861281
    Precision Plus Protein Dual Color Bio-Rad Laboratories Inc 161-0374
    Partec CellTrics Sysmex 04-004-2326 30 μm filter for flow
    GAPDH-F IDT AGCCACATCGCTCAGACAC
    GAPDH-R IDT GCCCAATACGACCAAATCC
    Ecadherin-F IDT TGGAGGAATTCTTGCTTTGC
    Ecadherin-R IDT CGCTCTCCTCCGAAGAAAC
    ZEB1-F IDT GCATACAGAACCCAACTTGAACGTC
    ZEB1-R IDT CGATTACACCCAGACTGC
    NOTCH-F IDT GGCAATCCGAGGACTATGAG
    NOTCH-R IDT CTCAGAACGCACTCGTTGAT
    nitro blue tetrazolium  Sigma N5514
    hexadimethrine bromide Sigma H9268 polybrene
    3 mL syringe BD Bioscience 309657
    Sterile syringe filter VWR 28145-505
    5mL polypropylene round-bottom tube 352063 flow cytometry tubes
    High-Capacity cDNA Reverse Transcription Kit Thermo Fisher 4368814 reverse transcription kit
    4% paraformaldyhyde Santa Cruz Biotechnology sc-281612
    Triton-X100 Sigma 93443
    bovine serum albumin Sigma A7906

    DOWNLOAD MATERIALS LIST

    References

    1. Weber, C. E., Li, N. Y., Wai, P. Y., Kuo, P. C. Epithelial-mesenchymal transition, TGF-beta, and osteopontin in wound healing and tissue remodeling after injury. J Burn Care Res. 33, (3), 311-318 (2012).
    2. Galichon, P., Finianos, S., Hertig, A. EMT-MET in renal disease: should we curb our enthusiasm. Cancer Lett. 341, (1), 24-29 (2013).
    3. Carew, R. M., Wang, B., Kantharidis, P. The role of EMT in renal fibrosis. Cell Tissue Res. 347, (1), 103-116 (2012).
    4. Willis, B. C., Borok, Z. TGF-beta-induced EMT: mechanisms and implications for fibrotic lung disease. Am J Physiol Lung Cell Mol Physiol. 293, (3), L525-L534 (2007).
    5. Ye, X., Weinberg, R. A. Epithelial-Mesenchymal Plasticity: A Central Regulator of Cancer Progression. Trends Cell Biol. 25, (11), 675-686 (2015).
    6. Li, L., Li, W. Epithelial-mesenchymal transition in human cancer: comprehensive reprogramming of metabolism, epigenetics, and differentiation. Pharmacol Ther. 150, 33-46 (2015).
    7. Tsai, J. H., Yang, J. Epithelial-mesenchymal plasticity in carcinoma metastasis. Genes Dev. 27, (20), 2192-2206 (2013).
    8. Bitting, R. L., Schaeffer, D., Somarelli, J. A., Garcia-Blanco, M. A., Armstrong, A. J. The role of epithelial plasticity in prostate cancer dissemination and treatment resistance. Cancer Metastasis Rev. 33, (2-3), 441-468 (2014).
    9. Schaeffer, D., Somarelli, J. A., Hanna, G., Palmer, G. M., Garcia-Blanco, M. A. Cellular Migration and Invasion Uncoupled: Increased Migration Is Not an Inexorable Consequence of Epithelial-to-Mesenchymal Transition. Mol Cell Biol. 34, (18), 3486-3499 (2014).
    10. Mathow, D., et al. Zeb1 affects epithelial cell adhesion by diverting glycosphingolipid metabolism. EMBO Rep. 16, (3), 321-331 (2015).
    11. Ware, K. E., et al. A mechanism of resistance to gefitinib mediated by cellular reprogramming and the acquisition of an FGF2-FGFR1 autocrine growth loop. Oncogenesis. 2, e39 (2013).
    12. Yauch, R. L., et al. Epithelial versus mesenchymal phenotype determines in vitro sensitivity and predicts clinical activity of erlotinib in lung cancer patients. Clin Cancer Res. 11, (24 Pt 1), 8686-8698 (2005).
    13. Jolly, M. K., et al. Towards elucidating the connection between epithelial-mesenchymal transitions and stemness. J R Soc Interface. 11, (101), 20140962 (2014).
    14. Mani, S. A., et al. The epithelial-mesenchymal transition generates cells with properties of stem cells. Cell. 133, (4), 704-715 (2008).
    15. Chen, L., et al. Metastasis is regulated via microRNA-200/ZEB1 axis control of tumour cell PD-L1 expression and intratumoral immunosuppression. Nat Commun. 5, 5241 (2014).
    16. Nicolazzo, C., Gradilone, A. Significance of circulating tumor cells in soft tissue sarcoma. Anal Cell Pathol (Amst). 697395 (2015).
    17. Somarelli, J. A., et al. Mesenchymal-epithelial transition in sarcomas is controlled by the combinatorial expression of miR-200s and GRHL2. Mol Cell Biol. (2016).
    18. Bae, Y. K., Choi, J. E., Kang, S. H., Lee, S. J. Epithelial-Mesenchymal Transition Phenotype Is Associated with Clinicopathological Factors That Indicate Aggressive Biological Behavior and Poor Clinical Outcomes in Invasive Breast Cancer. J Breast Cancer. 18, (3), 256-263 (2015).
    19. Humphries, B., Yang, C. The microRNA-200 family: small molecules with novel roles in cancer development, progression and therapy. Oncotarget. 6, (9), 6472-6498 (2015).
    20. Renner, M., et al. MicroRNA profiling of primary high-grade soft tissue sarcomas. Genes Chromosomes Cancer. 51, (11), 982-996 (2012).
    21. Petrof, G., et al. Mutations in GRHL2 result in an autosomal-recessive ectodermal Dysplasia syndrome. Am J Hum Genet. 95, (3), 308-314 (2014).
    22. Werner, S., et al. Dual roles of the transcription factor grainyhead-like 2 (GRHL2) in breast cancer. J Biol Chem. 288, (32), 22993-23008 (2013).
    23. Werth, M., et al. The transcription factor grainyhead-like 2 regulates the molecular composition of the epithelial apical junctional complex. Development. 137, (22), 3835-3845 (2010).
    24. Somarelli, J. A., et al. Mesenchymal-Epithelial Transition in Sarcomas Is Controlled by the Combinatorial Expression of MicroRNA 200s and GRHL2. Mol Cell Biol. 36, (19), 2503-2513 (2016).
    25. Varma, S., et al. The transcription factors Grainyhead-like 2 and NK2-homeobox 1 form a regulatory loop that coordinates lung epithelial cell morphogenesis and differentiation. J Biol Chem. 287, (44), 37282-37295 (2012).
    26. Pruitt, S. C., Mielnicki, L. M., Stewart, C. C. Analysis of fluorescent protein expressing cells by flow cytometry. Methods Mol Biol. 263, 239-258 (2004).
    27. Zhao, Z., et al. A high-content morphological screen identifies novel microRNAs that regulate neuroblastoma cell differentiation. Oncotarget. 5, (9), 2499-2512 (2014).
    28. Borowicz, S., et al. The soft agar colony formation assay. J Vis Exp. (92), e51998 (2014).
    29. Yang, J., et al. Integrated proteomics and genomics analysis reveals a novel mesenchymal to epithelial reverting transition in leiomyosarcoma through regulation of slug. Mol Cell Proteomics. 9, (11), 2405-2413 (2010).
    30. Alba-Castellon, L., et al. Snail1 expression is required for sarcomagenesis. Neoplasia. 16, (5), 413-421 (2014).
    31. Takaishi, M., Tarutani, M., Takeda, J., Sano, S. Mesenchymal to Epithelial Transition Induced by Reprogramming Factors Attenuates the Malignancy of Cancer Cells. PLoS One. 11, (6), e0156904 (2016).

    Erratum

    Formal Correction: Erratum: Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells
    Posted by JoVE Editors on 07/03/2018. Citeable Link.

    An erratum was issued for: Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells. An author name was updated.

    One of the authors' names was corrected from:

    Shenghan Xu

    to:

    Shengnan Xu

    Induksjon av Mesenchymale-Epitelial Transitions i sarkomceller
    Play Video
    PDF DOI DOWNLOAD MATERIALS LIST

    Cite this Article

    Ware, K. E., Gilja, S., Xu, S., Shetler, S., Jolly, M. K., Wang, X., Bartholf Dewitt, S., Hish, A. J., Jordan, S., Eward, W., Levine, H., Armstrong, A. J., Somarelli, J. A. Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells. J. Vis. Exp. (122), e55520, doi:10.3791/55520 (2017).More

    Ware, K. E., Gilja, S., Xu, S., Shetler, S., Jolly, M. K., Wang, X., Bartholf Dewitt, S., Hish, A. J., Jordan, S., Eward, W., Levine, H., Armstrong, A. J., Somarelli, J. A. Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells. J. Vis. Exp. (122), e55520, doi:10.3791/55520 (2017).

    Less
    Copy Citation Download Citation Reprints and Permissions
    View Video

    Get cutting-edge science videos from JoVE sent straight to your inbox every month.

    Waiting X
    simple hit counter