Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Developmental Biology

La inducción de la mesenquimales-epitelial Transitions en células de sarcoma

doi: 10.3791/55520 Published: April 7, 2017

ERRATUM NOTICE

Summary

Presentamos aquí un método de cultivo celular para inducir transiciones mesenquimales-epitelial (MET) en células de sarcoma en base a la expresión ectópica combinado de miembros de la familia microRNA-200 y Grainyhead-como 2 (GRHL2). Este método es adecuado para una mejor comprensión del impacto biológico de la plasticidad fenotípica de la agresividad del cáncer y los tratamientos.

Abstract

plasticidad fenotípica se refiere a un fenómeno en el que las células transitoriamente adquieren rasgos de otro linaje. Durante la progresión de carcinoma, la plasticidad fenotípica impulsa la invasión, la difusión y la metástasis. De hecho, mientras que la mayoría de los estudios de plasticidad fenotípica han sido en el contexto de los carcinomas epiteliales derivadas, resulta que los sarcomas, que son de origen mesenquimal, también exhiben plasticidad fenotípica, con un subconjunto de los sarcomas de someterse a un fenómeno que se asemeja a un mesenchymal- transición epitelial (MET). Aquí, hemos desarrollado un método que comprende la familia miR-200 y Grainyhead-como 2 (GRHL2) para imitar este fenómeno MET-como observados en paciente sarcoma samples.We expresan secuencialmente GRHL2 y la familia miR-200 usando la transducción de células y transfección, respectivamente , para entender mejor las bases moleculares de estas transiciones fenotípicas en células de sarcoma. células de sarcoma que expresan de miR-200 y GRHL2 demostraron mejorada, ambie epitelialics en la morfología celular y la alteración de epiteliales y mesenquimales biomarcadores. Futuros estudios utilizando estos métodos se pueden utilizar para comprender mejor las consecuencias fenotípicas de procesos MET-como en células de sarcoma, como la migración, invasión, la propensión metastásica, y resistencia a la terapia.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

plasticidad fenotípica se refiere a una transición reversible entre fenotipos celulares, y es comúnmente dividido en dos tipos, epitelial-a-mesenquimal (EMT) transiciones y transiciones-mesenquimal-a epitelial (MET). Esta plasticidad fenotípica juega un papel importante en los procesos normales de los organismos multicelulares, como el desarrollo y la cicatrización de la herida 1; sin embargo, estas mismas vías y programas de expresión génica también pueden conducir a la enfermedad, tales como fibrosis (revisado en 2, 3, 4) y metástasis de carcinoma (revisado en las referencias 5, 6, 7, 8). Durante la metástasis, por ejemplo, EMT interrumpe la polaridad celular, interacciones célula-célula, y promueve la invasión 9, 10. En conjunto, contribuyen EMTs de un estado fenotípico que facilitan la divulgación de las células cancerosas. Además, EMT también conduce a una serie de otras alteraciones fenotípicas que impulsan un fenotipo agresivo, incluyendo la desregulación del metabolismo de la célula de cáncer 6, el desarrollo de resistencia a los medicamentos 11, 12, mayor capacidad tumor-iniciación 13, 14 y el anfitrión de la evasión inmune 15.

plasticidad fenotípica se ha estudiado bien en la progresión del carcinoma; sin embargo, sarcomas también exhiben plasticidad fenotípica. Curiosamente, parece como si algunos de los mismos controladores de plasticidad fenotípica en los carcinomas también contribuyen a la plasticidad del sarcoma y agresividad. Por ejemplo, se ha demostrado que las células tumorales circulantes (CTC) de pacientes con sarcoma de expresar EpCAM, una proteína de superficie celular que se encuentra típicamente en las células epiteliales 16. Addicionalmente, 250 muestras de sarcoma de tejido blando se clasificaron como de tipo epitelial o mesenquimal-como basado en la expresión génica. Los pacientes de la firma biomarcador epitelial tuvieron un mejor pronóstico que los pacientes con la firma biomarcador mesenquimal 17. Esto es coherente con muchos carcinomas, en los que los pacientes con más carcinomas epiteliales-como tienen mejores resultados en comparación con los pacientes con más tumores mesenquimales-como 18.

Mientras que algunos sarcomas muestran biomarcadores y vías de expresión génica consistentes con MET, las bases moleculares de esta plasticidad fenotípica siguen siendo poco conocidos. Para estudiar los mecanismos y los conductores de MET en el sarcoma hemos desarrollado un modelo de inducción MET utilizando dos factores-epiteliales específica, el microRNA (MIR) -200 familia y Grainyhead-como 2 (GRHL2). El MIR-200 son una familia de pequeños ARN no codificantes que regulan la expresión génica mediante la unión a los 3' UTRs de messenger ARN y la prevención de traducción en proteína. La familia miR-200 se compone de dos subgrupos - uno que contiene miR-141 y miR-200a, y el otro incluyendo miR-200b, miR-200c, y miR-429. Los miembros de la familia miR-200 se enriquecen en tejidos epiteliales, y la pérdida de miR-200 se asocia con metástasis en carcinomas 19. La familia miR-200 también es downregulated en sarcomas de tejidos blandos en comparación con el tejido normal 20. Al igual que en los miR-200, GRHL2 es un regulador clave que es importante para el desarrollo del epitelio 21. El factor de transcripción GRHL2 actúa de dos formas de regular por incremento genes epiteliales, tales como E-cadherina: 1) en las células epiteliales, GRHL2 directamente reprime el regulador maestro EMT, ZEB1 22; y 2) GRHL2 activa directamente la transcripción de genes epiteliales 23. Nuestras investigaciones anteriores han demostrado que la expresión combinada de miR-200 y GRHL2 en las células del sarcomainduce un fenotipo MET-como 24. A continuación, presentamos un protocolo detallado para crear un modelo in vitro de la inducción de MET en células de sarcoma usando la expresión ectópica de miR-200 y GRHL2.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Preparación de los reactivos

  1. Preparar DMEM para el cultivo celular mediante la adición de 50 ml de suero fetal bovino (FBS) y 5 ml de penicilina-estreptomicina (5000 U / ml) a 500 ml de DMEM. Este medio se puede almacenar a 4 ° C durante hasta seis meses.
  2. Resuspender cebadores liofilizado en agua libre de nucleasa a una concentración final de 10? M. cebadores de las tiendas re-suspendieron a -20 ° C.
  3. Preparar tampón de ensayo de radioinmunoprecipitación (RIPA) (NaCl 150 mM, desoxicolato de sodio al 0,5%, 0,1% SDS, Tris 50 mM, pH 8,0). Suplemento con cóctel inhibidor de proteasa antes de usar y mantener tampón en hielo cuando está en uso. Almacenar a 4 ° C.
  4. Preparar 10 mg / ml de polibreno (bromuro de hexadimetrina) en el filtro de agua y la jeringa para esterilizar utilizando un filtro de polietersulfona 0,45 m. Solution se puede almacenar a 4 ° C durante hasta seis meses.
  5. Preparar una solución de 1 mg / mL de trabajo de cloruro de tetrazolio azul nitro disolviendo 10 mg en 10 ml de PBS. Almacenar a 4 ° C.

2. Lentiviral Transducción de GRHL2

Día 1

  1. Placa 3 x 10 5 células HEK293T por pocillo de una placa de 6 pocillos en 2 ml de DMEM suplementado. Cuantificar las células utilizando un contador de células automatizado. Las células deben ser 40 - 60% confluentes después de cultivo durante la noche a 37 ° C con 5% de CO2.

Dia 2

  1. Diluir 2 g de vector vacío (pCMV-UBC-EGFP) o 2 g de pCMV-GRHL2-UBC-EGFP 24, 25 en 200 l de medio libre de suero junto con 1,8 g de pΔ8.9 y 0,2 g de pCMV-VSV plásmidos auxiliares -G. En un tubo separado, se diluye 4 l de un reactivo de transfección basado en lípidos en 200 l de medio libre de suero por transfección (8 l en 400! L para dos muestras). Añadir 200? L de mezcla de reactivo de transfección a cada solución de plásmido y se incuba durante 20 min a temperatura ambiente.
  2. Durante el Incubadorasción, lavar las células HEK293T retirando el medio por aspiración al vacío y aclarado células con 1 ml de PBS. Sustituir el PBS con 800 l de medio libre de suero. Después de 20 min, añadir 200 l de reactivo de transfección: mezcla de plásmido de la etapa 2.2 gota a gota a cada pocillo e incubar las células durante 2 horas a 37 ° C en 5% de CO2.
  3. Retire cuidadosamente medio de transfección por aspiración al vacío y reemplazar con 2 ml de DMEM suplementado. Devolver las células a la incubadora para cultivo de una noche.
    NOTA: Las células HEK293T son poco adheridos. reemplazo de los medios de comunicación debe ser realizado con precaución para limitar la eliminación de las células de la parte inferior del plato o frasco.

Día 3

  1. Actualizar los medios de comunicación en las células HEK293T transfectadas y la placa 3 x 10 5 células RD por pocillo de una placa de 6 pocillos en 2 ml de DMEM suplementado. células de cultivo durante la noche. células RD son una línea celular de rabdomiosarcoma humano comercialmente disponible.

Día 4

  • Recoger los medios de comunicación viral a partir de células HEK293T. Pipetear los medios DMEM de las células HEK293T y lugar en un nuevo 15 ml cónico. Vuelva a colocar cuidadosamente con los nuevos medios DMEM y las células HEK293T lugar atrás en la incubadora para el día siguiente.
  • Añadir 2 l de 10 mg / ml de polibreno por ml de medios de comunicación virales en dos nuevos tubos cónicos de 50 ml (una para la transfección del vector vacío y otro para la transfección GRHL2). filtro de jeringa de medios de comunicación viral mediante la eliminación del émbolo de una jeringa de 3 ml y adjuntar un filtro de 0,45 micras polietersulfona a la punta.
    1. Añadir los medios de comunicación virales recogidos en el paso 2.6 en el barril de la jeringa, y hundir los medios de comunicación en los nuevos tubos cónicos de 50 ml que contenían polibreno. Retire el medio de las células RD por aspiración al vacío y añadir medios viral se filtró a células RD.
  • día 5

    1. Día 4. células HEK293T repetidas pueden ser desechados después de los medios de comunicación viral que se ha recogido.

    día 7

    1. Lavar las células RD con 1 ml de PBS y añadir 200? l de tripsina al 0,05% por pocillo. Incubar a 37 ° C durante 5 min, añadir 2 ml de medio suplementado, y mover suspensión celular a un nuevo 15 ml cónico. Centrifugar las células a 250 xg durante 5 min a temperatura ambiente y los medios de aspiración. Resuspender en 1 ml de DMEM (suplementado con 5% de FBS y 1% de penicilina-estreptomicina).
      NOTA: El uso de un mayor porcentaje de FBS puede causar la obstrucción durante la citometría de flujo
      1. células de filtro para citometría de flujo. Utilizar una pipeta para aplicar la suspensión de células ml RD 1 a través de un filtro de 30 micras en citometría de flujo tubos y Colocar los tubos en hielo.
      2. Ordenar EGFP + células 26 en 1,5 tubos de microcentrífuga ml que contenían 0,5 ml de DMEM suplementado con 10% de FBS y 1% de penicilina-estreptomicina y lugar en hielo. Plate EGFP + células en total de 1 ml de DMEM suplementado ordenadas en un solo pocillo de una placa de 12 pocillos y el lugar en la incubadora para cultivo.
        ; NOTA: El rendimiento de las células eGFP + de citometría de flujo después de este transducción es por lo general bajas (50.000-100.000 células). Las células pueden necesitar ser cultivado durante 10 - 14 días antes de proceder al paso 3.

    3. La transfección inversa de miR-200

    1. Preparar 50 M existencias de miR-200 imita utilizando libre de nucleasa H 2 poblaciones de O. alícuotas y almacenar a -20 ° C para evitar ciclos de congelación / descongelación repetidos.
    2. Añadir 3 l de cada 50? M miR-200 imitador (miR-200a, miR-200b, y miR-200c) a 300 l de medio libre de suero o 9 l de 50! M miARN de control negativo a medio libre de suero 300 mL.
    3. Añadir 6 l de reactivo de transfección-siRNA a 600 l de medio libre de suero y dividir 300! L de esta mezcla en dos tubos, uno para cada una de las dos mezclas de miR de la etapa 3.2. Combinar los 300! L de cada mezcla de miR de la etapa 3.2 con una mezcla de 300 l de reactivo de transfección. Incubar durante 20 min a te habitaciónmperatura.
    4. Mientras que la incubación, preparar una suspensión celular de 600.000 células EGFP + RD que expresan EV o GRHL2 creado en la Sección 2 en 2,4 ml (250 células / ml) de medio libre de suero por tratamiento.
    5. En una placa de 24 pocillos, añadir 100 l por pocillo de miR-200 de mezcla o mezcla de control negativo de la etapa 3.3 en seis pozos, y a continuación, añadir 400 l de cada suspensión de células en tres pocillos de cada mezcla de MIR.
    6. Se incuban las células a 37 ° C en 5% de CO 2 durante la noche y cambiar los medios de comunicación a suplementado totalmente DMEM al día siguiente. Recoger las células 2 días más tarde para el análisis utilizando el tampón apropiado (véase más adelante). Time-lapse de las células del sarcoma RD sometidos a MET está disponible como material suplementario. Imagen cada pocillo cada 2 h con un objetivo de 10X utilizando un generador de imágenes en vivo de células automatizado 27.

    extracción 4. ARN, la transcripción inversa, y qPCR

    1. Extraer ARN de acuerdo con las instrucciones del fabricante utilizando un estándar de ARNkit de extracción 24. ARN extraído se puede almacenar a -80 ° C.
    2. Cuantificar la concentración de ARN. Descongelar y trabajar con ARN en hielo. Para cuantificar las concentraciones de ARN, medir la absorbancia UV a 260 nm con un espectrofotómetro lector de placas de acuerdo con el protocolo del fabricante. Diluir todas las muestras a la concentración más baja con agua libre de nucleasa.
    3. Realizar la transcripción inversa del ARN total en ADN complementario (ADNc). Combinar no menos de 100 ng de ARN total con tampón de PCR, mezcla de dNTP (100 mM), cebadores hexámeros aleatorios, la transcriptasa inversa y agua libre de nucleasa en un volumen de reacción de 20! L 24. Ejecutar ciclos de RT de acuerdo con el protocolo del fabricante. cDNA se puede almacenar a largo plazo a -20 ° C.
    4. Diluir 20 reacciones mu l a 100 l con 80 l de nucleasa libre de H 2 O.
    5. Mezclar 5 l de un colorante intercalante basado en la fluorescencia 2x qPCR mezcla maestra, 0,06 l de cada cebador 10? M, unand 2 l de reacción RT diluida por muestra.
    6. Ejecutar qPCR de acuerdo con el protocolo del fabricante para la mezcla maestra basada en fluorescencia.
    7. Cuantificar cantidades relativas de mRNA por el método CT delta y normalizar a GAPDH. Trazar la expresión de ARNm de media de réplicas biológicas ± desviación estándar para cada grupo de tratamiento.
      NOTA: precauciones especiales deben tomarse cuando se trabaja con RNA para evitar el contacto con RNasas, tales como el uso de plásticos y reactivos libres de RNasa. equipo no desechable debe ser tratada antes de su uso para eliminar RNasas.

    5. La tinción de inmunofluorescencia

    1. Después de la etapa 3.6, los medios de aspirado por la aspiración por vacío a partir de las células RD en el formato de 24 pocillos.
    2. Fijar las células mediante la adición de 500 l de paraformaldehído al 4% (PFA) por pocillo e incubar durante 15 min a temperatura ambiente (RT). Después de la fijación, las células de lugar en tampón fosfato salino (PBS) y se almacena a 4 ° C durante la noche si es necesario.
    3. permeabilizarcélulas mediante la adición de 500 l de PBS + 0,2% de Triton-X100 e incubar 30 min a TA. Por la aspiración al vacío, eliminar el tampón de permeabilización y lavar tres veces con PBS.
    4. Bloque en 500 l de 5% de albúmina de suero bovino (BSA) / PBS y se incuban las células durante 30 min a RT. Las células se pueden almacenar a 4 ° C durante la noche si es necesario.
    5. Prepare la dilución de anticuerpo primario. Pipetear 200 l de 5% de BSA / PBS por pocillo en una cónica 15 ml (12 pozos = 2,4 ml) y añadir 1 l de anticuerpo primario por ml de 5% BSA / PBS necesario. Eliminar el tampón de bloqueo por aspiración al vacío y dispensar 200 l de anticuerpo primario diluido a cada pocillo.
      1. Se incuban las células en 1: 1.000 diluidas anticuerpos primarios en 5% de BSA / PBS durante 1 h a RT o durante la noche a 4 ° C. Después de la incubación, lavar las células dos veces con PBS.
    6. Preparar la dilución de anticuerpo secundario en el mismo volumen de 5% BSA / PBS como anteriormente. Añadir el anticuerpo secundario conjugado con colorante rojo lejano usando una dilución 1: 2000. Además añadir1 mg / ml de Hoechst colorante a la mezcla. Retire el PBS y añadir 200? L de la mezcla a cada pocillo.
      1. Incubar a TA durante 1 h en la oscuridad. Lavar 3 veces con PBS, dejar las células en PBS, y proteger las células de la luz usando papel de aluminio. Las células se pueden almacenar a 4 ° C si es necesario.
    7. células de imagen a la ampliación total de 400X en un microscopio de epifluorescencia invertido con longitud de onda de excitación de 594 a 650 nm.

    6. Transferencia Western

    1. Lavar las células de 3,6 dos veces con PBS enfriado en hielo. En hielo, las células se lisan con 50 l de 1x tampón RIPA suplementado con 1x cóctel inhibidor de proteasa.
    2. lisados ​​de roca en 4 ° C durante 15 min, recogen los lisados ​​en tubos de 1,5 ml, y se centrífuga a alta velocidad (20.000 xg) durante 5 min para aclarar las muestras. Los lisados ​​celulares se pueden almacenar a largo plazo a -80 ° C si es necesario.
    3. Cuantificar la proteína total usando un ensayo de Bradford y alícuota una cantidad igual de proteína en nuevos 1,5 tubos de microcentrífuga ml. Bring de muestras a igual volumen usando tampón RIPA y tampón de carga 3x Laemmli suplementado con 2-mercaptoetanol.
    4. Incubar las muestras en tampón de carga de muestra 1x Laemmli durante 5 min a 95 ° C y ejecutar SDS-PAGE usando un 4-12% de gel de Tris-glicina a 200 V durante 45 min. La cantidad de rangos cargadas de proteína, dependiendo de la línea celular. En algunos casos, se necesita 50-100 g de proteína total para detectar E-cadherina en líneas de células mesenquimales.
    5. proteínas de transferencia a una membrana de nitrocelulosa durante 2 horas a 50 V en tampón de transferencia 1x Tris-glicina.
    6. membrana Bloquear durante 1 h a temperatura ambiente o durante la noche a 4 ° C en un tampón de bloqueo a base de BSA.
    7. Diluir los anticuerpos primarios a 1: 1000 de concentración en 5 ml de tampón de bloqueo, añadir la dilución a la membrana, y se incuba con agitación suave durante 1 h a temperatura ambiente o durante la noche a 4 ° C. membrana Lavar 3 veces en PBS con 0,05% de Tween-20.
    8. Incubar las membranas durante 1 h a TA con secondar fluorescente acoplado infrarrojosy anticuerpo a 1: 20.000 de dilución en tampón de bloqueo como anteriormente.
    9. Lavar la membrana dos veces en PBS con 0,05% de Tween-20 y, a continuación una vez en PBS.
    10. membrana de imágenes con detección de fluorescencia de infrarrojos estándar.

    7. Ensayos de crecimiento independiente de anclaje

    NOTA: Para un protocolo de ensayo de agar blando detallada, consulte 28.

    1. Warm medios 2x DMEM estéril a 42 ° C en baño de agua caliente. Durante este tiempo, el calor pre-autoclave 1% de agarosa en el microondas durante 3 min. Microondas durante 30 s en un momento en que sea necesario o hasta que esté completamente derretido. Mueva de agarosa para un baño de agua C 42 °.
    2. Colocar un tubo cónico de 50 ml en un vaso de precipitados con 42 ° C de agua en una campana estéril y mezclar 1% de agarosa y los medios 2x DMEM en una relación 1: 1 de contabilidad para 1,5 ml de mezcla por pocillo en una placa de 6 pocillos. Siempre prepare adicional DMEM / agarosa para dar cuenta de error de pipeteado y para evitar burbujas.
    3. Añadir a la mezcla deparedes del pozo, asegurando que no se formen burbujas y dejar reposar durante 30 minutos a temperatura ambiente.
    4. Mientras que la capa inferior está solidificando, preparar cada grupo de células RD transfectadas en el paso 3 mediante la aspiración de los medios y lavar una vez con 1 ml de PBS. Aspirar PBS y añadir 0,2 ml de tripsina al 0,05% y se incuba a 37 ° C durante 5 min.
    5. Neutralizar la tripsina en 0,8 ml de medio y células de triturado para formar una suspensión de una sola célula. Transferir la suspensión celular a un tubo cónico de 15 ml.
    6. Contar las células y calcular el volumen de la suspensión celular requerida para 10.000 células por pocillo.
    7. Calentar 0,6% de agarosa en el microondas durante 3 min, seguido de 30 s en un momento hasta que esté completamente fundido. Mueva de agarosa a 42 ° C baño de agua.
    8. Colocar un tubo cónico de 50 ml en un vaso de precipitados con 42 ° C de agua en una campana estéril. Mezclar 0,6% de agarosa y la suspensión celular diluida en una proporción de 1: 1 para preparar 1,5 ml de mezcla por pocillo en una placa de 6 pocillos. Siempre prepare suspensión celular extra / agarosa mezclar para dar cuenta de error de pipeteado ypara evitar burbujas.
      NOTA: Es importante trabajar a 42ºC aquí. Si la temperatura es demasiado baja, la mezcla se solidifique antes de chapado, y temperaturas superiores a 42 ° C afectará a la viabilidad celular.
    9. Mezclar bien por trituración células varias veces y añadir mezcla de células a los pocillos, asegurándose de no formar burbujas, y dejar solidificar durante 20 min a TA.
    10. Añadir 2 ml de medio suplementado a cada pocillo y mover las placas a la incubadora.
      1. Cambiar los medios de comunicación una vez por semana durante 3-4 semanas o hasta que las colonias multicelulares forman. Tenga cuidado de no tocar el agar al retirar los medios por aspiración al vacío. Alternativamente, utilizar un P1000 para eliminar la capa superior de medios líquidos.
      2. Teñir placas de agar suave mediante la adición de solución de cloruro de 200 l de Nitro azul tetrazolio (1 mg / ml en PBS) e incubar la placa durante la noche a 37 ° C. Reemplazar los medios de comunicación al día siguiente con PBS para la imagen.
      3. pozos de imagen a 40X aumento total en un microscopio invertido.
      4. Realizar análisis de ImageJ para el área de la colonia y el número. Parcela número medio de colonias de réplicas biológicas ± desviación estándar.

    Subscription Required. Please recommend JoVE to your librarian.

    Representative Results

    or Start trial to access full content. Learn more about your institution’s access to JoVE content here

    Esquema para la inducción de MET en células de sarcoma

    Una línea de tiempo general para la inducción de cambios MET-como en células de sarcoma se muestra en la Figura 1. El protocolo comienza por transducción de GRHL2 (Figura 1A), seguido de transfección de la familia miR-200 (Figura 1B). miembros de la familia GRHL2 o miR-200 no fueron capaces de afectar la apariencia de las células RD cuando se expresa por sí sola, pero la expresión ectópica de GRHL2 y miR-200 en conjunto da como resultado cambios morfológicos de tipo epitelial en células RD. Las células de transición de una forma en forma de huso a una apariencia más redondeada con un mayor contacto célula-célula (Figura 1C).

    La inducción de cambios MET-como en células de sarcoma

    El cambio morfológico en células RD sobre GRHL2 y miR-200sobre-expresión fue acompañada por la regulación positiva del marcador epitelial E-cadherina (Figura 2A). La adición de miR-200 upregulated E-cadherina solo, pero combinado de miR-200 y la sobreexpresión GRHL2 sinérgicamente reforzada en la expresión de E-cadherina (Figura 2A; no escala logarítmica). Además, hubo un aumento en las uniones célula-célula de moléculas de adhesión epitelial, EpCAM y TJP1, flechas blancas (también conocido como occludens Zona 1, ZO-1) (Figura 2B).

    inducción MET disminuye la capacidad de formación de colonias de células de sarcoma

    Regulación positiva de las proteínas epiteliales fue acompañada por la regulación por disminución de genes mesenquimales ZEB1 y Notch 1 (Figura 3A), que son conocidos objetivos para miR-200. La inducción de la MET redujo el crecimiento independiente de anclaje de las células RD, medido por el número de colonias (Figura 3B). este growth inhibición fue impulsado por miR-200 solo; como la sobreexpresión de GRHL2 condujo a un aumento en el crecimiento independiente de anclaje (Figura 3). Esto es consistente con informes anteriores que muestran la expresión GRHL2 induce el crecimiento independiente de anclaje 22.

    Figura 1
    Figura 1: Cronología de inducción MET con GRHL2 El exceso de expresión y miR-200 de la transfección. (A) Cronología de ectópico expresión sobre-de GRHL2 en células diana. (B) línea de tiempo de la inducción de MET a través de la transfección inversa de miembros de la familia miR-200 en las células diana. (C) GRHL2 y miR-200 sobre-expresión condujeron a cambios en la morfología de las células diana consistentes con MET. Barra de escala = 75 micras Por favor, haga clic aquípara ver una versión más grande de esta figura.

    Figura 2
    Figura 2: concurrente sobre-expresión de GRHL2 y miR-200 dio lugar a MET en células diana. (A) expresión de miR-200s condujo a la expresión de E-cadherina elevada mientras que la expresión combinada de GRHL2 y miR-200 produce un efecto sinérgico sobre la expresión de E-cadherina tanto en el mRNA (valores medios ± desviación estándar) y los niveles de proteína. (B) expresión combinada de GRHL2 y miR-200 dio lugar a una mayor expresión de EpCAM y TJP1 en contactos célula-célula (flechas). Barra de escala = 20 m. * Indica p <0,05 analizaron mediante ANOVA con post-hoc de Tukey correction.This figura se ha modificado de la referencia 24. Copyright © Sociedad Americana de Microbiología, Biología Molecular Cell, volumen 36, No. 19, 2503-2513, 2016. Haga clic aquí para ver una versión más grande de esta figura.

    figura 3
    Figura 3: expresión de miR-200S Suprime mesenquimales marcadores y disminuye el crecimiento independiente del anclaje en células de sarcoma. (A) sobre - expresión de miR-200, pero no GRHL2 inhibía la expresión ZEB1 y Notch1 mRNA (valores medios ± desviación estándar). (B) El exceso de expresión de miR-200, pero no GRHL2 anoikis inhibidos resistencia en células de sarcoma. se muestran imágenes representativas de las colonias teñidas (Escala de barra = 200 m) y la cuantificación del número de colonias (valores medios ± desviación estándar). * Indica p <0,05 analizó usando ANOVA con post-hoc de Tukey correction.This figura ha sido modificado a partir de referencia 24. Copyright © Sociedad Americana de Microbiología, Biología Molecular Cell, volumen 36, número 19, 2503-2513, 2016. Por favor haga clic aquí para ver una versión más grande de esta figura.

    figura 3
    Vídeo suplementario: RD células que expresan el vector vacío y miRNAs control negativo. Videos fueron compilados a partir de imágenes de células RD transfectadas con el vector vacío y miRNAs de control negativo adquiridos cada dos horas usando un formador de imágenes en vivo de células automatizado. Haga clic aquí para ver el vídeo. (Haga clic aquí para descargar.)

    figura 3 />
    Suplementario de vídeo 2: RD células que expresan miRNAs control negativo GRHL2-EGFP y. Videos fueron compilados a partir de imágenes de células RD transfectadas con GRHL2-EGFP y miRNAs de control negativo adquiridos cada dos horas usando un formador de imágenes en vivo de células automatizado. Haga clic aquí para ver el vídeo. (Haga clic aquí para descargar.)

    figura 3
    Suplementario Video 3: células RD que expresan el vector vacío y miR200 miRNAs. Videos fueron compilados a partir de imágenes de células RD transfectadas con el vector vacío y miR200 miRNAs adquiridos cada dos horas usando un formador de imágenes en vivo de células automatizado. Haga clic aquí para ver el vídeo. (Haga clic aquí para descargar.)

    nt" fo: keep-together.within-page = "1"> figura 3
    Suplementario de vídeo 4: células RD que expresan GRHL2-EGFP y miR200 miRNAs. Videos fueron compilados a partir de imágenes de células RD transfectadas con GRHL2-EGFP y miR200 miRNAs adquirieron cada dos horas usando un formador de imágenes en vivo de células automatizado. Haga clic aquí para ver el vídeo. (Haga clic aquí para descargar.)

    Subscription Required. Please recommend JoVE to your librarian.

    Discussion

    or Start trial to access full content. Learn more about your institution’s access to JoVE content here

    Los sarcomas son cánceres raros, pero altamente agresivas de un linaje mesenquimal. A pesar de su linaje mesenquimal, un subconjunto de sarcomas parece experimentar una transición fenotípica a un estado más epitelial-similares. Este interruptor MET-como tiene relevancia pronóstica, ya que los pacientes con más tumores epiteliales como son menos agresivos 24. A pesar de su importancia clínica, hay pocos estudios sobre los mecanismos moleculares de conducción estas transiciones fenotípicas en sarcomas.

    Para examinar las transiciones MET-como en células de sarcoma, hemos desarrollado un modelo de inducción de MET mediante la combinación de la expresión de factores epiteliales GRHL2 y la familia miR-200. Este método induce rápidamente las células del sarcoma a ser más epitelial-como medido por alteraciones en la morfología y la expresión génica. Usando este protocolo para inducir MET en células de sarcoma facilita el estudio de los efectos de estas transiciones en los fenotipos que impulsan la agresión sarcoma, talescomo la migración, invasión, proliferación y la resistencia a la muerte y cómo cada uno de estos cambios en la biología puede afectar a la resistencia a fármacos.

    En el contexto de carcinomas epiteliales derivadas de, la expresión de un factor mesenquimal es a menudo suficiente para inducir EMT 14. Sin embargo, en este modelo sarcoma derivados de MET la expresión de dos factores epiteliales, GRHL2 y miR-200, son obligatorios. Curiosamente, los miR-200 solo tuvieron un efecto más fuerte en la mayoría de los biomarcadores de MET que GRHL2, mientras GRHL2 fue capaz de activar robustamente genes epiteliales sólo en presencia de la represión a base de miR-200 de represores de genes epiteliales, tales como ZEB1 24. Es posible que para algunos tipos de células mesenquimales genes epiteliales necesitan ser tanto de-reprimidos (por ejemplo, a través de miR-200) y activado (por ejemplo a través de GRHL2) para conducir MET.

    Hemos experimentado variación en los niveles de expresión a través de diferentes GRHL2 cell líneas. Para superar esto, se utilizó un plásmido de expresión GRHL2 que también expresa EGFP 25 para ordenar por citometría de flujo de células EGFP positivas antes de los experimentos. También es fundamental para validar la funcionalidad de miR-200 y GRHL2 en diferentes tipos de células. EMT es vista como un espectro basado en la expresión de genes epiteliales y mesenquimales-asociado, que puede tener variación dependiente del contexto basado en la línea celular, el tipo de cáncer, tratamiento, etc. Por lo tanto, se analizaron cinco genes regulados por miR-200 o GRHL2 a en cuenta los cambios dependientes del contexto de células. Otra advertencia de este ensayo es la dependencia de una transfección transitoria de miR-200 para la inducción de MET. Por lo tanto, los experimentos a largo plazo pueden llegar a ser costoso y complicado cuando múltiples transfecciones de repetición se hacen necesarios. Esto se puede superar mediante el uso de miR-200 plásmidos de expresión.

    Otros estudios también han señalado la presencia del MET en los sarcomas. Por ejemplo, MET se observó en un subconjunto de leiomyosarcomas y se asoció con una mejor supervivencia para los pacientes. Mecánicamente, Yang et al. encontrado que en una inhibición línea celular de leiomiosarcoma de Slug con siRNA era suficiente para inducir MET-como cambios 29. Del mismo modo, el agotamiento de otro factor mesenquimal, Snail, en las células madre mesenquimales redujo la formación de sarcoma en ratones 30. Por lo tanto, es evidente a partir de la literatura que hay múltiples vías a un fenotipo MET-similares, que pueden variar según el tipo de célula. Si bien esta no es la única manera de inducir MET, hemos utilizado nuestro método para inducir MET en dos subtipos de sarcoma, incluyendo rabdomiosarcoma (RD células) y osteosarcoma (células 143B). En el futuro, sería interesante comparar estos métodos diferentes en un rango más amplio de las células del sarcoma. Por ejemplo, qué ciertos subtipos de sarcoma tienen alteraciones genéticas o epigenéticas subyacentes que los hacen más o menos susceptibles a la inducción MET?

    Identificar el impacto de METen una variedad de productos biológicos en las células sarcomas podría proporcionar una mejor comprensión de por qué los pacientes con sarcomas más de tipo epitelial tienen un mejor pronóstico. Además, la comprensión de los efectos del tratamiento sobre la conducción de las transiciones entre los estados fenotípicos que profundizar en la comprensión biológica e informar sobre la respuesta a los tratamientos actuales en pacientes con sarcoma.

    Subscription Required. Please recommend JoVE to your librarian.

    Disclosures

    Los autores no tienen nada que revelar.

    Acknowledgments

    JAS reconoce el apoyo del Instituto del Cáncer de Duke, El Laboratorio de Oncología genitourinario Universidad de Duke, y el Departamento de Ortopedia de la Universidad de Duke. HL fue apoyada por la National Science Foundation (NSF) Centro de Física Biológica Teórica (NSF PHY-1427654) y NSF DMS-1361411, y como CPRIT Académico (Prevención del Cáncer y el Instituto de Investigación de Texas) en la Investigación del Cáncer del Estado de Texas en la Universidad Rice. KEW fue apoyado por el NIH F32 CA192630 MKJ y HL benefició de discusiones útiles con Mary C. Farach-Carson, JN Onuchic, Samir M. Hanash, Kenneth J. Pienta, y Donald S. Coffey.

    Materials

    Name Company Catalog Number Comments
    Countess automated counter Life technologies AMQAX1000
    Countess cell counting chamber slides Invitrogen C10283
    SimpliAmp Thermal Cycler Thermo Fisher A24811
    Odyssey Fc LI-COR Inc
    ViiA7 Real Time PCR System Thermo Fisher 4453536
    PCR microplate Corning 321-29-051
    KAPA SYBR Fast Universal qPCR Kit KAPA Biosystems KK4602
    Starting Block (PBS) Blocking Buffer Thermo Fisher 37538 BSA-based blocking buffer
    Agarose General Purpose LE Genesee Scientific 20-102
    10x Tris/Glycine/SDS Buffer Bio-Rad Laboratories Inc 161-0732 Running buffer
    10x Tris/Glycine Buffer Bio-Rad Laboratories Inc 161-0734 Transfer buffer
    RIPA Buffer Sigma Life Sciences SLBG8489
    Amersham Protran 0.45 μm nitrocellulose GE Healthcare Lifesciences 10600012
    Quick-RNA MiniPrep Kit Genesee Scientific 11-358
    Laemmli Sample Buffer (4X) Bio-Rad Laboratories Inc 1610747
    Mini Trans-Blot Cell Bio-Rad Laboratories Inc 1703930
    Mini-Protean Tetra Cell Bio-Rad Laboratories Inc 1658005EDU
    DPBS Life technologies 14190-144
    0.05% Trypsin-EDTA Life technologies 11995-065
    DMEM Life technologies 11995-065
    Lipofectamine RNAi Max Thermo Fisher 13778150
    Lipofectamine 2000 Ragents Thermo Fisher 11668019
    Penicillin Streptomycin Life technologies 15140-122
    miRVana miRNA mimic negative control #1 Thermo Fisher 4464058 neg miRNA
    hsa-miR-200 mirVana miRNA mimic Thermo Fisher 4464066 miR200A
    has-miR-200 mirVana miRNA mimic Thermo Fisher 4404066 miR200B
    has-miR-200 mirVana miRNA mimic Thermo Fisher 4404066 miR200C
    Opti-MEM Life technologies 11088-021 serum-free media
    anti-Ecadherin antibody BD Bioscience 610182
    anti-beta actin Santa Cruz Biotechnology sc-69879
    anti-EpCam Ab Serotec MCA18706
    anti-ZO1 Invitrogen 402200
    IRDye 800W LI-COR Inc 925-32210
    IRDye 680 LI-COR Inc 926-32223
    anti-mouse AlexaFluor 647 Thermo Fisher A211241
    anti-rabbit AlexaFluor 647 Thermo Fisher ab150075
    Halt Protease and Phosphatesse Inhibitor Thermo Fisher 1861281
    Precision Plus Protein Dual Color Bio-Rad Laboratories Inc 161-0374
    Partec CellTrics Sysmex 04-004-2326 30 μm filter for flow
    GAPDH-F IDT AGCCACATCGCTCAGACAC
    GAPDH-R IDT GCCCAATACGACCAAATCC
    Ecadherin-F IDT TGGAGGAATTCTTGCTTTGC
    Ecadherin-R IDT CGCTCTCCTCCGAAGAAAC
    ZEB1-F IDT GCATACAGAACCCAACTTGAACGTC
    ZEB1-R IDT CGATTACACCCAGACTGC
    NOTCH-F IDT GGCAATCCGAGGACTATGAG
    NOTCH-R IDT CTCAGAACGCACTCGTTGAT
    nitro blue tetrazolium  Sigma N5514
    hexadimethrine bromide Sigma H9268 polybrene
    3 mL syringe BD Bioscience 309657
    Sterile syringe filter VWR 28145-505
    5mL polypropylene round-bottom tube 352063 flow cytometry tubes
    High-Capacity cDNA Reverse Transcription Kit Thermo Fisher 4368814 reverse transcription kit
    4% paraformaldyhyde Santa Cruz Biotechnology sc-281612
    Triton-X100 Sigma 93443
    bovine serum albumin Sigma A7906

    DOWNLOAD MATERIALS LIST

    References

    1. Weber, C. E., Li, N. Y., Wai, P. Y., Kuo, P. C. Epithelial-mesenchymal transition, TGF-beta, and osteopontin in wound healing and tissue remodeling after injury. J Burn Care Res. 33, (3), 311-318 (2012).
    2. Galichon, P., Finianos, S., Hertig, A. EMT-MET in renal disease: should we curb our enthusiasm. Cancer Lett. 341, (1), 24-29 (2013).
    3. Carew, R. M., Wang, B., Kantharidis, P. The role of EMT in renal fibrosis. Cell Tissue Res. 347, (1), 103-116 (2012).
    4. Willis, B. C., Borok, Z. TGF-beta-induced EMT: mechanisms and implications for fibrotic lung disease. Am J Physiol Lung Cell Mol Physiol. 293, (3), L525-L534 (2007).
    5. Ye, X., Weinberg, R. A. Epithelial-Mesenchymal Plasticity: A Central Regulator of Cancer Progression. Trends Cell Biol. 25, (11), 675-686 (2015).
    6. Li, L., Li, W. Epithelial-mesenchymal transition in human cancer: comprehensive reprogramming of metabolism, epigenetics, and differentiation. Pharmacol Ther. 150, 33-46 (2015).
    7. Tsai, J. H., Yang, J. Epithelial-mesenchymal plasticity in carcinoma metastasis. Genes Dev. 27, (20), 2192-2206 (2013).
    8. Bitting, R. L., Schaeffer, D., Somarelli, J. A., Garcia-Blanco, M. A., Armstrong, A. J. The role of epithelial plasticity in prostate cancer dissemination and treatment resistance. Cancer Metastasis Rev. 33, (2-3), 441-468 (2014).
    9. Schaeffer, D., Somarelli, J. A., Hanna, G., Palmer, G. M., Garcia-Blanco, M. A. Cellular Migration and Invasion Uncoupled: Increased Migration Is Not an Inexorable Consequence of Epithelial-to-Mesenchymal Transition. Mol Cell Biol. 34, (18), 3486-3499 (2014).
    10. Mathow, D., et al. Zeb1 affects epithelial cell adhesion by diverting glycosphingolipid metabolism. EMBO Rep. 16, (3), 321-331 (2015).
    11. Ware, K. E., et al. A mechanism of resistance to gefitinib mediated by cellular reprogramming and the acquisition of an FGF2-FGFR1 autocrine growth loop. Oncogenesis. 2, e39 (2013).
    12. Yauch, R. L., et al. Epithelial versus mesenchymal phenotype determines in vitro sensitivity and predicts clinical activity of erlotinib in lung cancer patients. Clin Cancer Res. 11, (24 Pt 1), 8686-8698 (2005).
    13. Jolly, M. K., et al. Towards elucidating the connection between epithelial-mesenchymal transitions and stemness. J R Soc Interface. 11, (101), 20140962 (2014).
    14. Mani, S. A., et al. The epithelial-mesenchymal transition generates cells with properties of stem cells. Cell. 133, (4), 704-715 (2008).
    15. Chen, L., et al. Metastasis is regulated via microRNA-200/ZEB1 axis control of tumour cell PD-L1 expression and intratumoral immunosuppression. Nat Commun. 5, 5241 (2014).
    16. Nicolazzo, C., Gradilone, A. Significance of circulating tumor cells in soft tissue sarcoma. Anal Cell Pathol (Amst). 697395 (2015).
    17. Somarelli, J. A., et al. Mesenchymal-epithelial transition in sarcomas is controlled by the combinatorial expression of miR-200s and GRHL2. Mol Cell Biol. (2016).
    18. Bae, Y. K., Choi, J. E., Kang, S. H., Lee, S. J. Epithelial-Mesenchymal Transition Phenotype Is Associated with Clinicopathological Factors That Indicate Aggressive Biological Behavior and Poor Clinical Outcomes in Invasive Breast Cancer. J Breast Cancer. 18, (3), 256-263 (2015).
    19. Humphries, B., Yang, C. The microRNA-200 family: small molecules with novel roles in cancer development, progression and therapy. Oncotarget. 6, (9), 6472-6498 (2015).
    20. Renner, M., et al. MicroRNA profiling of primary high-grade soft tissue sarcomas. Genes Chromosomes Cancer. 51, (11), 982-996 (2012).
    21. Petrof, G., et al. Mutations in GRHL2 result in an autosomal-recessive ectodermal Dysplasia syndrome. Am J Hum Genet. 95, (3), 308-314 (2014).
    22. Werner, S., et al. Dual roles of the transcription factor grainyhead-like 2 (GRHL2) in breast cancer. J Biol Chem. 288, (32), 22993-23008 (2013).
    23. Werth, M., et al. The transcription factor grainyhead-like 2 regulates the molecular composition of the epithelial apical junctional complex. Development. 137, (22), 3835-3845 (2010).
    24. Somarelli, J. A., et al. Mesenchymal-Epithelial Transition in Sarcomas Is Controlled by the Combinatorial Expression of MicroRNA 200s and GRHL2. Mol Cell Biol. 36, (19), 2503-2513 (2016).
    25. Varma, S., et al. The transcription factors Grainyhead-like 2 and NK2-homeobox 1 form a regulatory loop that coordinates lung epithelial cell morphogenesis and differentiation. J Biol Chem. 287, (44), 37282-37295 (2012).
    26. Pruitt, S. C., Mielnicki, L. M., Stewart, C. C. Analysis of fluorescent protein expressing cells by flow cytometry. Methods Mol Biol. 263, 239-258 (2004).
    27. Zhao, Z., et al. A high-content morphological screen identifies novel microRNAs that regulate neuroblastoma cell differentiation. Oncotarget. 5, (9), 2499-2512 (2014).
    28. Borowicz, S., et al. The soft agar colony formation assay. J Vis Exp. (92), e51998 (2014).
    29. Yang, J., et al. Integrated proteomics and genomics analysis reveals a novel mesenchymal to epithelial reverting transition in leiomyosarcoma through regulation of slug. Mol Cell Proteomics. 9, (11), 2405-2413 (2010).
    30. Alba-Castellon, L., et al. Snail1 expression is required for sarcomagenesis. Neoplasia. 16, (5), 413-421 (2014).
    31. Takaishi, M., Tarutani, M., Takeda, J., Sano, S. Mesenchymal to Epithelial Transition Induced by Reprogramming Factors Attenuates the Malignancy of Cancer Cells. PLoS One. 11, (6), e0156904 (2016).

    Erratum

    Formal Correction: Erratum: Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells
    Posted by JoVE Editors on 07/03/2018. Citeable Link.

    An erratum was issued for: Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells. An author name was updated.

    One of the authors' names was corrected from:

    Shenghan Xu

    to:

    Shengnan Xu

    La inducción de la mesenquimales-epitelial Transitions en células de sarcoma
    Play Video
    PDF DOI DOWNLOAD MATERIALS LIST

    Cite this Article

    Ware, K. E., Gilja, S., Xu, S., Shetler, S., Jolly, M. K., Wang, X., Bartholf Dewitt, S., Hish, A. J., Jordan, S., Eward, W., Levine, H., Armstrong, A. J., Somarelli, J. A. Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells. J. Vis. Exp. (122), e55520, doi:10.3791/55520 (2017).More

    Ware, K. E., Gilja, S., Xu, S., Shetler, S., Jolly, M. K., Wang, X., Bartholf Dewitt, S., Hish, A. J., Jordan, S., Eward, W., Levine, H., Armstrong, A. J., Somarelli, J. A. Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells. J. Vis. Exp. (122), e55520, doi:10.3791/55520 (2017).

    Less
    Copy Citation Download Citation Reprints and Permissions
    View Video

    Get cutting-edge science videos from JoVE sent straight to your inbox every month.

    Waiting X
    simple hit counter