Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

Pamuk Yeşilkurt bir densovirüs Host Fitness Host doku Dağılımı, İletim-modunu ve Etkisi incelenmesi için Protokoller

doi: 10.3791/55534 Published: April 12, 2017

Summary

Burada, bir lepidopteran tür içindeki bir densovirüs konakçı fitness konak doku dağılımı, iletim modunu ve etkisi, pamuk kurtları araştırmak için bir protokol mevcut. Bu protokol aynı zamanda diğer oral bulaşan virüsler ve bunların haşere arasındaki etkileşimi incelemek için kullanılabilir.

Abstract

Birçok yeni virüsler yeni nesil dizileme teknolojileri kullanarak hayvan konakçılarda keşfedildi. Daha önce, bir lepidopteran türlerde, bir Mutualistik virüsü, yeşil kurt densovirüs (HaDV2) bildirilen, pamuk kurdu, yeşil kurt (Hubner). Burada, şu anda kendi ana bilgisayarda HaDV2 etkisini incelemek için kullanılan protokolleri açıklar. İlk olarak, tek bir üreme çifti bir HaDV2 içermeyen pamuk kurdu kolonisi kurmak. Bir HaDV2 enfekte diğer enfekte olmamış: Daha sonra, ağız yoluyla, aynı genetik arkaplana sahip iki koloniler elde etmek için filtre edilmiş sıvının HaDV2 içeren bazı yeni doğmuş larva yavruları inoküle. HaDV2 konak doku dağılımı ve transmisyon verimi belirlemek için protokoller gibi bir protokolü, sunulan HaDV2 enfekte olmuş ve -uninfected bireyler arasında hayat tablosu parametreleri (örneğin, larva, pupa ve yetişkin dönemleri ve doğurganlığı) karşılaştırmak. Bu protokoller, woULD ayrıca haşere, özellikle lepidopteran ana diğer oral yolla bulaşan virüsler etkilerinin araştırılması için uygun olmaktadır.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Son birkaç on yıl içinde, örneğin yeni nesil sıralama olarak dizileme teknolojisinin gelişmesi (NGS), bir çok yeni bir DNA ve RNA virüsleri, özellikle patojenik olmayan virüs değil, aynı zamanda, daha önce bilinen virüsler, 1, 2, 3 yeni izolat keşfini kolaylaştırmıştır 4, 5, 6, 7, 8, 9, 10, 11, 12. Model organizma Drosophila melanogaster olarak, 20'den fazla yeni kısmi virüs genomları metagenomic teknikleri 13 kullanılarak tespit edilmiştir. yeni virüsler de dahil olmak üzere pek çok viral diziler, aynı zamanda, örneğin bal arıları, m gibi başka böceklere tanımlanmıştırosquitoes, Asya narenciye psyllid, böcekler, ve birden fazla lepidopteran türler 14, 15, 16, 17, 18, 19, 20, 21.

Gelecekte, daha yeni virüsler bu gelişmiş teknolojileri kullanarak böceklerin keşfedilen olacağını beklenebilir; dolayısıyla, virüs konak etkileşimin anlayışımız, 9 buna göre 6 değişebilir. Birçok yeni virüsler Mutualistik ortakları ziyade sıkı patojenler 22 olarak tanımlanan ediliyor çünkü Örneğin, virüs konak etkileşimleri, önceden düşünüldüğünden daha karmaşık olduğu kabul edilir. Örneğin, Dysaphis plantaginea içinde Mutualistik densovirüs DplDNV kanatlı Morf indükler ve virüs 23 yanı sıra konağın dağılımı kolaylaştırmak, hareketlilik artar. Ayrıca, Mutualistik virüsler memeli sağlık, kuraklık ve bitkilerin soğuk toleransı ve bakteriyel enfeksiyonların 24 etkisine ilişkin olarak tarif edilmiştir. Seneca vadi virüsü-001 nöroendokrin kanseri 25 sahiptir, tümör hücrelerine karşı seçici sitotoksisiteye aracılık gösterilmiştir. Hepatit A virüsü enfeksiyonları hepatit C virüsü replikasyonunu baskılamak ve hepatit C 26 kurtarma yol açabilir. Herpesvirüs gecikme bakteriyel enfeksiyon 27 simbiyotik koruma sağlamaktadır. Insan endojen retrovirüs HERV-W zarf glikoproteini dalak nekroz virüsü 28 hücresel direnç indükler. bir mantar endofit gelen Curvularia termal tolerans virüsü (CThTV) bu mantar ve tropikal panik çim arasındaki Mutualistik etkileşiminde yer alanref "> 29. Dolayısıyla, yeni bulunan virüsler ve onların ana arasındaki etkileşimlerin bilgisi onların biyoloji ve yönetimi konusunda yeni bakış açıları oluşturmak gerekir. Ancak, yeni virüsler, akut enfeksiyon tipik belirgin belirtisi sergileyen özellikle gizli virüsler, nadiren var been araştırdık ve biz olan ev sahipleri yeni bulunan virüslerin etkilerini araştırmak için bir boru hattı ve protokoller gerekir.

Daha önce, pamuk kılıfı kurdu yeşil kurt içinde yaygınlığını yeni monosense densovirüs yeşil kurt densovirüs (HaDV2) bildirilmiştir ve HaDV2 ve pamuk kılıfı kurdu 30, 31 arasında bir Mutualistik ilişkinin kanıtları sundular. Bu yazıda ayrıntılı olarak HaDV2 ve pamuk kurdu konak arasındaki etkileşimi incelemek için laboratuvar protokol anlatacağız. Burada sunulan protokol de r inceleyerek araştırmacıların son derece alakalı olabilirÖzellikle lepidopteran haşerelere de, diğer oral bulaşan virüslerin ole.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

HaDV2 içermeyen Pamuk Yeşilkurt Colony 1. İnşaat

  1. Arka pamuk kurdu larvası 14 saat aydınlık / 10 saat karanlık ve% 60 bağıl nem ile, 25 ± 1 ° C 'de kontrollü bir büyüme odası veya bir yapay iklim bölmesine bir suni diyetin 32 (H. armigera).
  2. İyi havalandırma sağlamak için bir yumurtlama alt-tabaka olarak hizmet etmek üzere gazlı bez ile kaplı çift başına plastik bir kafes (10 cm yükseklik, çapı 5 cm) kullanılarak yeni eclosed kelebeklerin tek çifti çiftleşme Aid. virüssüz bir koloni elde olasılığını arttırmak için, tek-çift çiftleşmesinden en az 30 çiftleri kullanmaktadır. % 10 şeker ve% 2 Vitamin çözeltisi 32 ile besleme yetişkin kelebekleri bir pamuk ile ıslatılmış ve her gün doldurulan.
  3. kadın yetişkin yaklaşık 2 days pamuk gazlı bez üzerine sonrası çiftleşme yumurtalarını gibi, günlük gazlı bez değiştirin. Toplayın ve aynı büyüme odasında gazlı içeren yumurta (ya da yapay iklim cham korumakber) yumurta kapak kadar yetişkin güveler olarak.
  4. Hemen bir birey ile, yeni 24-kuyu plakalarına yumurtadan yeni çıkmış larvaların aktarmak başına iyi.
  5. Beş gün önce yumurtlama tarihinden sonra, üst pervane toplamak ve sıvı azot içinde muhafaza edin.
    NOT: 5 gün ilk yumurtlama tarihinden sonra güveler Toplama anne toplama noktasında diri olmasını sağlar ve bu nedenle DNA ekstraksiyon doğruluğuna ölü pervane kullanmanın olası etkilerini önler.
  6. üreticinin talimatlarına göre bir DNA ekstraksiyon kiti kullanılarak bu örneklerden elde edilen genomik DNA izole edin.
    1. primerler aktin F / aktin R formülüne sahip aktin geninin bir 574-bp fragmanı amplifiye (aktin F: 5-CATCTACGAGGGTTACGC-3 ve aktin R: 5-CATCTGTTGGAAGGTGGA-3). Polimeraz zincir reaksiyonu (PCR), standart protokollere göre, agaroz jel elektroforezi kullanılarak ürünler Visualise; aktin geninin başarılı amplifikasyon DNA, iyi kalitede olmasını sağlar.
    2. t değerlendirinspesifik primerler ile PCR kullanılarak ana kelebeklerdeki HaDV2 arasında o varlığı: DVVPF (GGATTGGCCTGGGAAATGAC) ve DVVPR (CGTTGTTTTTATATCCGAGG) 31.
  7. Temiz bir çifti en az beş nesildir bu tek HaDV2-bulaşmamış üreme çifti gelen, arka yavrular tespit ve HaDV2 içermeyen kolonisinin (NONINF-soy) olarak muhafaza edildikten sonra; HaDV2 enfekte koloni INF-suşu olarak tanımlanmıştır.
  8. NONINF-gerginlik içinde HaDV2 enfeksiyon durumunu doğrulamak için (ve bilinen bakteri veya ana gelişimi üzerine virüslerin etkisini dışlamak için), sekiz rastgele seçilen larvalar bireylerde HaDV2, Wolbachia ve H'.armıgrer Nukleopolihedrovirüs'ün (HaNPV) için enfeksiyon durumunu değerlendirmek (: HaNPV için HaDV2, NPVF / NPVR için DVVPF / DVVPR ve Wolbachia 31 için 81F / 691R, 33 özel primerlerle) PCR kullanılarak NONINF-suşu.
    NOT: Bazı virüsler geç olabileceği bilinmektedirnt bir PCR bazlı teknik kullanılarak saptanamayan hatta seviyesi ile enfekte olmuş bir konakçıya, içinde. NGS teknolojileri hiçbir viral diziler genomik DNA örnekleri mevcut olduğunu teyit etmek için kullanılabilir.

HaDV2 içeren sıvı Akışkanların 2. Hazırlık

NOT: Biz HaDV2 virüs parçacıklarının teşebbüs arıtma enfeksiyon yetilerini ve aktivitesini 31 engellediğini göstermiştir; Bu nedenle, aşağıdaki protokol HaDV2 enfekte bireylerin filtreleyerek Enfektif HaDV2 çözeltisi elde etmek için gerçekleştirilir.

  1. tek tek yetişkin pervane toplayın ve hemen sıvı nitrojen içinde depolayın.
  2. Tamamen steril bir havan ve havan tokmağı kullanarak sıvı azot altında toplanan bireysel pervane öğütün. Temiz bir 1.5-mL tüp yaklaşık 10 ug enkaz aktarın. yeni bir tüpe kalan artıkları aktarın ve hemen -80 ° C'de saklayın.
  3. enkaz ug 10 DNA ekstrakte edin, follokanat üreticisi tarafından sağlanan protokolleri. güve DNA izole edildikten sonra adım 1.6 de tarif edildiği gibi, bir protokol kullanılarak HaDV2 kontrol edin.
  4. adım 2.3 'de elde edilen sonuçlara göre, iki gruba kalan artıkları bölün: HaDV2-pozitif ve HaDV2-negatif, bunların enfeksiyon durumuna bağlı olarak değişecektir. Fosfat tamponlu tuzlu su ile 1 ml ekleyin (PBS; 137 mM NaCI, 2.7 mM KCI, 8 mM Na2 HPO 4 ve 1.5 mM KH2 PO4; pH 7,5), her bir birey için tamamen geri kalan larva artıkları çözülmesi için.
  5. Santrifüj, 4 ° C'de 15 dakika boyunca 6500 x g'de (adım 2.4 den) homojenat. 0.22 um'lik bir membran filtre ile sıvı süpernatant süzülür. süzüldü sıvıları (tüp başına 200 uL) toplayın ve hemen -80 ° C'de saklayın.
    NOT: 0.22 um membran filtre istenmeyen partiküller, bakteriler ve mantarların en süzer. İlk olarak, 4 ° C'de santrifüj ön soğutma. Tüm protokolleri gerçekleştirin involviBuz üzerinde filtrelenmiş sıvı çalışmasını ng kahverengi dönüm ve pıhtılaştırıcı gelen Homojenat önlemek için kullanılırlar.

HaDV2 bulaşmış Pamuk Yeşilkurt Colony 3. İnşaat

  1. HaDV2 yatay iletim kabiliyetini
    1. Bir HaDV2 standart eğri oluşturun.
      1. novo primerleri ile HaDV2 virüsünün ölçümü için kullanılır:, ve sonda (GCCACCACTAGAGGACCCACCAGATG VP-prob):; (TGACAAGATCCAGCGTAGACATC VPR CTGGTGAGGCGATGGACATG VPF) primerleri içeren parçacığın yükseltilmesi (PF: GGACAATGCTGGTGAGGC; PR: AATCCTCTTTGTCCGTTATCTATG). Bir PCR makinesi 31, 40 döngü için 72 ° C'de, 94 ° C'de 30 s, 53 ° C'de 30 saniye ve 60 saniye: Aşağıdaki programı kullanın. şablon DNA olarak 25 uL PCR reaksiyonu için genomik DNA HaDV2 genomunu içeren (aşama 2.3) 1 uL ekleyin. üreticinin protokollerine göre bir klonlama vektörüne genişletilmiş parçacık Clone.
      2. kopya sayısı hesaplayınaşağıdaki denklem ile plazmid N Bir Avogadro sayısı (6.02 x 10 23 moleküller / mol) kopya / uL = (C x K A) / (n x M 10 9 ×); mikrospektrofotometri kullanılarak ölçülebilir plazmid (ng / uL), kütle yoğunluğu olduğu; n, PCR ürünü (5.195 bp) içeren plasmidle uzunluğudur; ve M, çift sarmallı DNA (660 g / mol) arasında bir ortalama taban çiftinin molekül ağırlığıdır.
      3. 1.5 x 10 9 konsantrasyonları ile, 1.5 mL mikrosantrifüj tüpleri içinde, 1.5 x 10 8, 1.5 x 10 7, 1.5 x 10 6, 1.5 x 10 5, 1.5 x 10 4 kopya sayısı altı 10-misli seri seyreltimler hazırlayın / mcL.
      4. döngüsü tasarımda oluşturmak için özel primerler (VPF / VPR) ve bir sondayı (VP-prob), gerçek zamanlı kantitatif polimeraz zincir reaksiyonu (qPCR) gerçekleştirmekAdım 3.1.1.3 tarif plazmid shold (BT) değerleridir. üç bağımsız teknik çoğaltır gerçekleştirin ve sonraki hesaplamalar için onları ortalamasını alırız.
      5. Yukarıdaki sonuçları kullanarak, ilgili ortalama CT değerleri için log 2-dönüştürülmüş HaDV2 konsantrasyonları ile bir standart eğri oluşturmak.
    2. Filtre edilmiş sıvı sıvılarda HaDV2 ölçmek.
      1. Pipet DNA ekstraksiyonu için HaDV2 içeren filtre edilmiş sıvı akışkan (aşama 2.6) bir 100-uL test örneği.
      2. Sıvı akışkanlar için, CT değerleri elde edilir ve adım 3.1.1 standart eğri kullanılarak kopya sayısını hesaplamak için gerçek bir zaman qPCR kullanın.
    3. Farklı konsantrasyonlarda HaDV2 enfekte süzüldü sıvı oral enfeksiyon etkinliğini belirler.
      1. Aşağıdaki konsantrasyonlara HaDV2 içeren sıvı akışkan seyreltilir: 10 8, 10 7, 10 6, 10 5, 10 4, ve 0 kopya sayısı / ml.
      2. Yapay di yayıldıve eşit katılaşmadan önce bir 9 cm çapında bir Petri tabağına. Eşit katı suni diyetin yüzeyine her bir konsantrasyonu için HaDV2-içeren filtre edilmiş sıvının (200 uL) yayıldı. Davlumbaz yapın.
      3. bir Petri kabındaki HaDV2 içeren suni diyete 100 taze yumurtadan larva aktarın. Yavaşça beyaz bir kağıt tabakasına gazlı larvaların aktarmak için (yeni doğmuş larvaları da dahil olmak üzere), pamuk gazlı bez çal. nazikçe kağıdı yendi böylece kağıttan larva sıkma ipek ve "balon". ipek dokunun ve Petri kabı larva taşımak için sterilize forseps kullanın.
      4. 48 saat sonra, 24-çukurlu levhalara suni diyetin (oyuk başına bir birey) üzerinde larva aktarın.
      5. Arka yetişkin aşamaya üzerindeki konsantrasyonlarda HaDV2 ile aşılanmış larva.
      6. Yetişkin pervane toplamak DNA özü ve adım 1.5 de tarif edildiği gibi PCR kullanılarak HaDV2 algılar.
        Burada ortak bir% 100 HaDV2 enfeksiyon oranı elde: NOTHaDV2 enfekte koloni (INF-soyu) kurmak ve böylece 10 8 kopya sayısı / uL kullanılarak ve tton bollworms.
  2. HaDV2 Dikey bulaşma yeteneği
    1. negatif: -; HaDV2 enfenksiyonu: NONINF ve INF-suşlarından seçin yetişkin güveler ♀- / ♂-, ♀ + / ♂-, ♀- / ♂ + ve ♀ + / ♂ + (+ tek çiftlerinin üretilmesi için, HaDV2 enfeksiyon).
    2. virüssüz 24 oyuklu plakalara yukarıdaki çiftleri yavrular aktarma; Arka Üçüncü dönem larva.
    3. Adım 1.5'de tarif edildiği gibi, HaDV2 varlığını belirlemek için bir şablon olarak kullanmak için toplanan üçüncü instar larvaları DNA ekstrakte edilir.

HaDV2 4. Doku Dağılımı

  1. , Virüs ve bakterilerden kirlenmeyi önlemek% 75 etanol ile Forseps ve makas sterilize üç kez ve daha sonra, bir alkol lambanın alevinde ısıtmak için.
    NOT: Forseps sterilizatiokirlenme, n gereklidir.
  2. bir analitik terazi kullanılarak dokuların depolamak için kullanılacak olan boş masura tartın.
  3. yaklaşık olarak 5 dakika için, buz üzerinde INF-suşundan larva ve yetişkin pervane yerleştirin.
  4. PBS tampon içeren temin bir petri kutusuna larva, yetişkin kadın ve yetişkin erkeklerde bir stereo mikroskop altında aşağıdaki dokuların teşrih.
    1. Larvaları, pipet hemolimf ve ön bağırsak, orta bağırsak, kalın barsak, yağ vücut incelemek ve Malpighian tübül (Şekil 1A) için. Hemen sıvı azot içinde tüplere her doku aktarın.
      1. Başa yakın bölümler arası zar ve son karın bölümü (Şekil 1A) içine sokulması, iki böcek pimleri (çapı 200 um, uzunluğu 20 mm) kullanılarak cystosepiment donmuş larvaları sabitleyin.
      2. Larvalar Hemolimf dışarı akar, böylece larva posterior karın bölgesinde proleg kesin. Bir microp kullanılarak 10 saniye içinde larva hemolimf Pipetipette hemolimf esmerleşme ve koagülasyon önlemek için.
        Not: feniltiyoüre (50 ug / ml) melanization önlemek için hemolimf ile 1:20 hacim / hacim oranında karıştırılabilir.
      3. bir makas kullanarak, kafasına son bölümler arası zar arasında değişen manikür bir kesi yapmak. iki forseps kullanılarak bir stereo mikroskop altında kalan dokuları teşrih; her bir doku için resim Şekil 1A'da gösterilmiştir.
      4. tek suret olarak birlikte üç kişi doku örnekleri karıştırın.
      5. Diseksiyon sırasında hemolimf kalan dokuların kirlenmesini önlemek için, PBS içinde kesilmiş dokuları, üç kez yıkama tamponu. Daha sonra, yıkama için kullanılan PBS HaDV2 enfeksiyon durumunu test. Nihai yıkama tamponu HaDV2 içermeyen ise, doku hemolimf kontaminasyondan temiz olmalıdır.
    2. yetişkin kadın için, kafa (beyin), kaslar, yağ vücut, gut, Malpighian tübüller ve yumurtalık (teşrihPBS tamponu içinde bir stereo mikroskop altında Şekil 1B). Yetişkin erkek için, PBS tamponu içinde bir stereo mikroskop altında kafa (beyin), kaslar, yağ kütlesi, gut, Malpighian tübüller ve testisler (Şekil 1C) incelemek. Hemen sıvı azot içinde tüplere her doku aktarın.
      1. forseps ve makas kullanarak, yetişkin güveler kanatlarını çıkarıp ölçekler temizlemek için kalan vücudu üç kez yıkayın.
      2. makas kullanarak kafa, göğüs kafesi ve karın ayırın.
      3. Toraks iç iskelet çıkarın ve kas toplamak.
      4. Forseps kullanarak, karın kütikül kaldırmak ve Şekiller 1B ve 1C, aşağıdaki diğer dokulara incelemek.
      5. tek suret olarak birlikte üç kişi doku örnekleri karıştırın. PBS içinde kesilmiş dokuları, üç kez yıkama tamponu.
  5. bunlar dondurulmuş olan zaman tüpler ve yukarıda dokuları tartılır ve m sağlamakfarklı dokuların eşek hemen hemen eşittir.
    Kütle (doku) = kütle (tüp / doku örneği) - kütle (tüp için)
  6. bu dokulardan DNA ekstrakte edilir ve adım 3.1.2 tarif edildiği gibi, qPCR gerçekleştirmek.
  7. Adım 3.1.1 oluşturulan standart bir eğri kullanılarak her bir doku mg başına kopya sayısını hesaplayın. DNA ekstraksiyonu için kullanılan doku miktarında herhangi bir farktan kaynaklanan örnek önyargı düzeltilmesi için birim kütle başına virüs titresi kullanın.
  8. aşağıdaki gibi belirli dokularda HaDV2 yüzdesini hesaplayın: HaDV2 yüzdesini her bir doku için = HaDV2 test doku / (bütün dokularda mg'ı başına kopya sayısı toplamı) mg'ı başına kopya sayısı.

5. Biyolojik tayinler Test HaDV2 Etkisi Sunucu Kalkınma

  1. Talep en az 100 pupa ya da bir pamuk gazlı bez kaplı, 5 L'lik, tel örgü kafese NONINF-suşundan türetilmiş yeni ortaya çıkan erişkin güveleri. 2 gün sonra, çiftleşmiş yetişkin dişiler pamuk gazlı bez üzerine yumurtalarını bırakmak için başlayacaktır. Toplayın ve bakımıyumurta içeren pamuk tülbent; Yumurtalar yaklaşık üç gün içinde yumurtadan olacaktır.
  2. HaDV2 ile yeni doğmuş larvalarına aşılanması.
    1. INF-gerginlik kurmak için HaDV2 (10 8 kopya sayısı / ml) içeren suni diyetine NONINF-suşu yenidoğan larvalarını aktarın.
    2. Benzer şekilde, kontrol grubu (NONINF-soyu) kurmak için HaDV2 içermeyen filtrelenmiş sıvı (aşama 2.4) ile kaplanmış suni diyete yeni doğmuş larva aktarın. Her bir tedavi (Şekil 2A), en az 240 larva içerir.
      Not: Larvalar NONINF- ve INF-bakteri oluşturmak için kullanılan aynı genetik arkaplana sağlanması, aynı zamanda, aynı ana kohort ve kapak türetilir. NONINF- ve INF-suşları gelişme senkron hızı (14 saat aydınlık / 10 saat karanlık ve% 60 bağıl nem ile, 25 ± 1 ° C 'de) aynı klima kabini içinde muhafaza emin olun; hızı, sıcaklık ve neme bağlı olarak değişebilir. Deliç Kulpnazikçe larvaları yedi.
  3. 48 saat sonra, 24-gözlü levhalar (oyuk başına bir tek) (Şekil 2B) tek tek larvalar aktarın.
    1. Sırayla sayı her her kuyuda larva ve günlük evre evre ve sağkalım durumunu kaydedin.
    2. Yapay diyet bozulduğunda Yaklaşık 5 gün sonra, aynı anda taze yapay diyet (Şekil 2C) içeren yeni bir 24 plaka için bu kişileri aktarın.
    3. 0.0001 g hassasiyetle için bir analitik terazi kullanılarak 11 sonrası yumurtadan 7. günde larvaların tartılır. Tartıldıktan sonra, tek tek 24-yuvalı plakaya larva döndürür.
  4. Dördüncü ecdysis sonrası beşinci instar için deri değiştirme sırasında (yaklaşık on gün kuluçkadan çıktıktan sonra), cam tüpler (10 cm yükseklik, 2 cm çapında) (Şekil 2D) Larvalar aktarmak; Beşinci instar larvaları da baş kapsülü (yaklaşık 2.6 mm) genişliği ile tespit edilebilir.
    NOT: bireyleri aktarınAynı zamanda cam tüpe her gün.
    1. Kod boya ya da kalem ile bir cam tüp ile orijinal referans numarası ile her larva. Günlük larva durumunu kaydetme; yaklaşık beş gün-pupa aşaması yaklaşık 11 gün sürer sonra cam tüplerde, larva pupa olacaktır.
    2. cam tüp içinde her birey için pupa ve eclosion tarihini kaydedin. 3 günlük bir pupa kütlesini kaydedin.
  5. Eclosion sonra,% 10 sakaroz ve% 2 Vitamin çözeltisi (Şekil 2E) ile tek bir kafes içine, bir dişi ve bir erkek koydu. Her gün sukroz çözeltisi yenileyin. Her güve için ölüm tarihini kaydedin.
  6. yumurta koyulur zaman, günlük pamuklu gazlı bez değiştirin. Hemen yumurtaların sayısını. yumurtadan iken bu yeni doğmuş yavrular sayın.
  7. Her tedavi HaDV2 enfeksiyon durumunu onaylamak için biyoanalizlere sırasında, rastgele sekiz bireyleri seçin. Ticari tripsin reaktif kullanılarak, bu numunelerin toplam RNA ekstrakteÜreticinin protokolü takip. üreticinin protokolü takiben ilk iplikli cDNA sentezlemek ve virüsler başarıyla transkripsiyonu olup olmadığını test etmek için bir şablon olarak kullanabilirsiniz.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

HaDV2 içermeyen (Şekil 3A) olan ebeveynlerden dölleri NONINF-suşu olarak yetiştirilir. Başarıyla DNA şablonları kaliteli (Şekil 3B) olduğunu öne süren, aynı DNA şablonları kullanılarak, aktin geni amplifiye edilmiştir. Buna ek olarak, rasgele seçilen sekiz dölleri de HaDV2 (Şekil 3C), HaNPV (Şekil 3D), ve Wolbachia (Şekil 3E) serbest edildi. Yine, aktin geninin bir kısmı başarıyla test edilen tüm örneklerin (Şekil 3F) için amplife edilmiştir, çünkü progenlerinin DNA örnekleri, iyi kalitede olduğu sonucuna varmışlardır.

Başlangıç malzemesinin kalitesi ve elde edilen CT değerleri log arasındaki ilişkiyi tanımlayan bir standart eğri, Şekil 4'te olduğu gibi üretildi. Güçlü bir doğrusal ilişki (R, (Şekil 4) arasında bulunmuştur.

Taze çıkmış larvaların kopya sayısı / ml 8 4 ila 10 ile 10 arasında 10 kat seri seyreltiler kullanılarak HaDV2 sıvı akışkanların noktası standart eğri ile aşılanmıştır. Enfeksiyon frekansı ve HaDV2 sıvı akışkanların konsantrasyonları arasında doğrusal bir ilişki elde edilenler; 10 8 kopya sayısı / ml pamuk kılıfı kurdu 100% enfeksiyon vermiştir, fakat diğer konsantrasyonlarda (ayrıca Xu ve ark. 31) değil. aşağıdaki gibi farklı HaDV2 enfeksiyonu durumlara sahip ebeveyn progenlerinin HaDV2 enfeksiyonu frekansları: 100% ♀ + için / ♂-,% 78 için ♀- + / ♂ + (bakınız ayrıca Xu ♀ için / ♂ +,% 100 ve ark. 31).

correct HaDV2 titresinde bireysel farklılıklara, her doku mg başına HaDV2 kopya sayısı ve özel doku toplam HaDV2 titresinin yüzdesi hesaplanır. (Aynı zamanda bakınız Xu ve diğerleri 31 Şekil 5). Sonuçlar HaDV2 esas olarak vücut yağ dağıtıldı olduğunu ortaya çıkarmıştır. Larva dönemlerde, pupa dönemleri, yetişkin uzunluğu ve doğurganlık dahil olmak üzere hayat tablosu parametrelerin karşılaştırılması, Tablo 1 'de gösterilmiştir (ayrıca Xu ve ark., 31 bakınız). Xu ve arkadaşları tarafından yayınlanan larva ve pupa kütleler idi. 31. NONINF gerginlik ve INF-suşu hem de HaDV2 enfeksiyon durumları PCR (Xu ve ark., 31 tarafından yayınlanan sonuçları) ile tespit edilmiştir.

Şekil 1
Şekil 1. Disseke Dokular (A) Larvalar (B)Kadın Yetişkin ve (C) Erkek Yetişkin. H, baş (beyin); O, Hemolimf; FB, vücut yağ; Mt, Malpighian tübüller; G, bağırsak; , Ön bağırsak FG; MG, orta bağırsak; HG, arka bağırsak; Mu, kaslar; , Yumurtalık O olduğu; T, testis. Bu rakamın büyük halini görmek için buraya tıklayın.

şekil 2
Pamuk Yeşilkurt üzerinde HaDV2 etkilerini belirlemek için 2. Biyoassay Prosedür Şekil. HaDV2 ile yeni yumurtadan çıkmış larva (A) aşılama. (B), 48 saat sonra 24 oyuklu plakalara HaDV2 ile enfekte olan ve HaDV2 içermeyen bireylerin transferi. (C) HaDV2 bulaşmış ve -ücretsiz bireylerin farklı boyutlarda. Yeni bir cam borular (10 cm yükseklik, 2 cm çapında) beşinci aşama larvaları (D) transferi. (E) bir yerleştirmeYetişkin uzun ömürlü, yumurta verimi ve kapağı hızını belirlemek için bir kadın, aynı kafes içine bir erkek güve. Bu rakamın büyük halini görmek için buraya tıklayın.

Şekil 3,
HaDV2 bulaşmış ve HaDV2 içermeyen koloniler HaDV2, HaNPV veya Wolbachia için Şekil 3. Enfeksiyon Durumu. Kadın ve erkek ebeveynlerinin HaDV2 enfeksiyonu durumu (A). Rastgele seçilen nesillerinde HaDV2 (C) HaNPV (D) ve Wolbachia (E) enfeksiyonu durumu. Genomik DNA kalitesini kontrol etmek için, referans gen aktin da ebeveyn (B) ve döllerinin (F) büyütüldü. Şerit M DL2000 işaretleyici (2.000 bp 1000 bp 750 bp, 500 bp, 250 bp, bir gösterirD 100 bp). Şerit 1: dişi ebeveyn. Yol 2: erkek ebeveyn. Şerit 3-10: yavrularıyla. Bu rakamın büyük halini görmek için buraya tıklayın.

Şekil 4,
Döngü Eşiği (BT) Değerler Şekil 4. Standart Eğri ilişkilendirilmesi Giriş 2-dönüştürülmüş HaDV2 konsantrasyonları. Bu rakamın büyük halini görmek için buraya tıklayın.

Şekil 5,
Şekil Larva (A) HaDV2 5. Ana doku dağılımı, yetişkin dişi (B) ve yetişkin erkek (C) Pamuk Bollworms. Yüzde (%) = (her bir mg için) farklı dokularda HaDV2 oranı olarak i 'de tarifn, adım 4.7 veri varyans analizi (ANOVA) ve Tukey testi analizi kullanılarak istatistiksel olarak analiz edildi (larva: n = 7, yetişkin erkeklerin n = 6; yetişkin dişiler: n = 6). ± SE anlamına gelir. Sonuçlar Xu ve arkadaşları tarafından yayımlanmıştır. 31. Bu rakamın büyük halini görmek için buraya tıklayın.

Yaşam öyküsü parametreleri HaDV2 + HaDV2- t değeri df P değeri
Larva süresi (gün) Erkek 16.51 (0.72 ±) 16.93 (1.21 ±) 4,147 379 <0.001
Kadın 16.51 (0.79 ±) 16.80 (1.05 ±) 2,732 312 0.0067
Pupa süresi (gün) Erkek 13.02 (0.68 ±) 13.31 (0.69 ±) 4,057 379 <0.001
Kadın 11.62 (0.67 ±) 12.00 (0.63 ±) 5.1 312 <0.001
Yetişkin Ömür (gün) Erkek 10.69 (1.98 ±) 10.93 (2.46 ±) 0.915 367 0,36
Kadın 9.07 (1.98 ±) 8.51 (1.58 ±) 2,992 367 0.003
Yumurta sayısı dişi başına üretilen 482 (174 ±) 403 (180 ±) 2,172 93 0.032
dişi başına taramalar mevcut sayısı 207 (108 ±) 143 (± 99) 3,026 93 0.0032

HaDV2 + ve HaDV2-pamuk Bollworms için Tablo 1. Yaşam öyküsü parametreler. Student t-testi anlamlılık düzeyini belirlemek için kullanılır. ± SE gösterilmektedir anlamına gelir. Bu tabloda sunulan veriler Xu ve arkadaşları tarafından yayınlanmıştır. 31.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Son birkaç on yılda, böcek-virüs etkileşimlerine çoğu çalışma bal arısı sağlığı 34, 35, 36, insan hastalığının 37 vektörler üzerine odaklanmıştır, bitki 38 virüsleri, ve biyolojik kontrol ajanları 39 gibi büyük bir potansiyele sahip bazı böcek patojenik virüsleri. Biraz dikkat, özellikle lepidopteran haşerelere de, böceklerde gizli virüslere ödenmiştir. Burada gizli bir virüs ve konak böceğin arasındaki etkileşimlerin çalışma için bir protokol mevcut. virüs bulaşmış ve virüssüz konak bireyler için yaşam tablosu parametrelerinin karşılaştırılması ideal konak genetik arka planda farklılıkların herhangi bir etkisi hariç tutmalıdır. Viral fenotipi incelemek için, birçok önceki çalışmalar aşılanmış aynı kolonide ya bireylerde ya doğal enfekte veya enfekte olmamış bireylerin yaşam tablosu parametrelerini karşılaştırdıkmikroenjeksiyon ile, ancak bu çaba sefer 23 40 alıcıdır. Burada anlatılan HaDV2 pamuk bollworms, oral aşılama, viral fenotipleri analiz etmek için basit ve etkili bir araç olarak hizmet eder. Bu prosedür, aynı zamanda HaDV2 enfekte olmuş ve enfekte olmamış HaDV2-koloniler için aynı genetik arka planı sağlar.

Virüs aşı birçok şekilde hazırlanabilir. Yüksek-hızda santrifüjleme kullanılarak virüs parçacıklarının saflaştırma düşük enfeksiyon ile sonuçlanan, virüs enfektivitesini inhibe eder; bu nedenle, virüs içeren filtre edilmiş sıvı pamuk kurdu larvalarına 31 enfekte etmek için kullanıldı. 0.22 um membran HaDV2-içeren filtre sıvıdan ve HaDV2 içermeyen filtre edilmiş sıvı sonuçlar üzerindeki diğer virüslerin etkisi dahil olabilir kontrol olarak kullanılmıştır çoğu mantar ve bakteri parçacıkları filtre gerçeği. Ancak, durum gözardı edilemez olduğunu biyolojik deneylerin sonuçları gelebilenLSO keşfedilmemiş virüsler tarafından önyargılı. Bu nedenle, yüksek enfektivitesi ile HaDV2 parçacıkları ideal sağlam sonuçlar elde etmek için, gelecekte arındırılmalıdır.

virüs konsantrasyonu pozitif, virüs bulaşmasmda korelasyon; bu nedenle,% 100 enfeksiyonu verecektir HaDV2 konsantrasyonunun saptanması ilgilenmişlerdir. Sonuçlarımız 10 8 kopya numarası / ul Bu enfeksiyon oranını elde etmek virüs aşılaması için kullanılabileceğini gösterdi. Kuşkusuz, virüs titresi ve enfeksiyon oranı arasındaki korelasyon ileride çalışılan diğer virüs konak etkileşimleri için araştırılmalıdır. Buna ek olarak, alandaki her bireyin virüs titresi da araştırılmalıdır. Dolayısıyla, ardından alana bireylerin üzerine virüslerin etkisini taklit olabilir.

onlar kolayca ölümcül zarar görür çünkü onlar yumurtadan sonraki ilk birkaç gün boyunca narin larvalarının hassas taşıma, çok önemlidir. Ayrıca, HaDV2-enfekte olmamış colony HaDV2 önlemek için serada ayrı tutulmalıdır kirlenme-HaDV2 enfeksiyon oranı alanında ve laboratuvarda 31 hem de çok yüksek olduğu tespit edilmiştir.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Yazarlar hiçbir rakip mali çıkarları olduğunu beyan ederim.

Acknowledgments

Bu çalışma Çin Milli Anahtar Temel Araştırma Programı (No 2013CB127602) ve Çin Ulusal Bilim Vakfı (No 31321004) Yaratıcı Araştırma Grupları için Bilim Fonu tarafından desteklenmiştir.

Materials

Name Company Catalog Number Comments
24-well plate Corning 07-200-740 Multiple suppliers available.
DNA extraction kit TIANGEN DP304-03 Multiple suppliers available.
thermal cycler Veriti; Applied Biosystems 4375786
PBS Corning 21-040-CV
0.22 µm membrane filter Millipore SLGS025NB
pEASY-T Cloning Vector TransGen, Beijing, China CT301-02
Tweezers IDEAL-TEK 2.SA
Premix Ex Taq (Probe qPCR) Takara RR390A
Probes Invitrogen Custom order
Primers Invitrogen Custom order
microspectrophotometry NanoDrop 2000c  Thermo scientific  not available
7500 Real-Time PCR system Applied Biosystems not available
stereomicroscope SZX-16 Olympus not available
sucrose Multiple suppliers available.
vitamin complex Multiple suppliers available.

DOWNLOAD MATERIALS LIST

References

  1. Tang, P., Chiu, C. Metagenomics for the discovery of novel human viruses. Future Microbiol. 5, 177-189 (2010).
  2. Rosario, K., Breitbart, M. Exploring the viral world through metagenomics. Curr. Opin. Virol. 1, 289-297 (2011).
  3. Hugenholtz, P., Tyson, G. W. Microbiology - metagenomics. Nature. 455, 481-483 (2008).
  4. Kristensen, D. M., Mushegian, A. R., Dolja, V. V., Koonin, E. V. New dimensions of the virus world discovered through metagenomics. Trends Microbiol. 18, 11-19 (2010).
  5. Kleiner, M., Hooper, L. V., Duerkop, B. A. Evaluation of methods to purify virus-like particles for metagenomic sequencing of intestinal viromes. BMC Genomics. 16, 7 (2015).
  6. Ho, T., Tzanetakis, I. E. Development of a virus detection and discovery pipeline using next generation sequencing. Virology. 471, 54-60 (2014).
  7. Marx, C. J. Can you sequence ecology? Metagenomics of adaptive diversification. PLoS Biol. 11, e1001487 (2013).
  8. Radford, A. D., et al. Application of next-generation sequencing technologies in virology. J. Gen. Virol. 93, 1853-1868 (2012).
  9. Liu, S. J., Chen, Y. T., Bonning, B. C. RNA virus discovery in insects. Curr. Opin. Insect Sci. 8, 54-61 (2015).
  10. Mokili, J. L., Rohwer, F., Dutilh, B. E. Metagenomics and future perspectives in virus discovery. Curr. Opin. Virol. 2, 63-77 (2012).
  11. Liu, S. J., Vijayendran, D., Bonning, B. C. Next generation sequencing technologies for insect virus discovery. Viruses-Basel. 3, 1849-1869 (2011).
  12. Cook, S., et al. Novel virus discovery and genome reconstruction from field RNA samples reveals highly divergent viruses in Dipteran hosts. PLoS ONE. 8, e80720 (2013).
  13. Webster, C. L., et al. The discovery, distribution, and evolution of viruses associated with Drosophila melanogaster. PLoS Biol. 13, e1002210 (2015).
  14. Granberg, F., et al. Metagenomic detection of viral pathogens in spanish honeybees: co-infection by aphid lethal paralysis, israel acute paralysis and lake sinai viruses. PLoS ONE. 8, e57459 (2013).
  15. Runckel, C., et al. Temporal analysis of the honey bee microbiome reveals four novel viruses and seasonal prevalence of known viruses, Nosema, and Crithidia. PLoS ONE. 6, 20656 (2011).
  16. Cox-Foster, D. L., et al. A metagenomic survey of microbes in honey bee colony collapse disorder. Science. 318, 283-287 (2007).
  17. Chandler, J. A., Liu, R. M., Bennett, S. N. RNA shotgun metagenomic sequencing of northern California (USA) mosquitoes uncovers viruses, bacteria, and fungi. Front. Microbiol. 6, 185 (2015).
  18. Shi, C. Y., et al. A metagenomic survey of viral abundance and diversity in mosquitoes from Hubei province. PLoS ONE. 10, e0129845 (2015).
  19. Nouri, S., Salem, N., Nigg, J. C., Falk, B. W. Diverse array of new viral sequences identified in worldwide populations of the Asian citrus psyllid (Diaphorina citri) using viral metagenomics. J. Virol. 90, 2434-2445 (2016).
  20. Dayaram, A., et al. Identification of diverse circular single-stranded DNA viruses in adult dragonflies and damselflies (Insecta Odonata) of Arizona and Oklahoma, USA. Infect. Genet. Evol. 30, 278-287 (2015).
  21. Jakubowska, A. K., et al. Simultaneous occurrence of covert infections with small RNA viruses in the lepidopteran Spodoptera exigua. J.Invert. Pathol. 121, 56-63 (2014).
  22. Roossinck, M. J. Move over, Bacteria! Viruses make their mark as mutualistic microbial symbionts. J. Virol. 89, 6532-6535 (2015).
  23. Ryabov, E. V., Keane, G., Naish, N., Evered, C., Winstanley, D. Densovirus induces winged morphs in asexual clones of the rosy apple aphid, Dysaphis plantaginea. Proc. Natl. Acad. Sci. USA. 106, 8465-8470 (2009).
  24. Roossinck, M. J. The good viruses: viral mutualistic symbioses. Nat. Rev. Microbiol. 9, 99-108 (2011).
  25. Venkataraman, S., et al. Structure of seneca valley virus-001: an oncolytic picornavirus representing a new genus. Structure. 16, 1555-1561 (2008).
  26. Deterding, K., et al. Hepatitis a virus infection suppresses hepatitis c virus replication and may lead to clearance of hcv. J. Hepatol. 45, 770-778 (2007).
  27. Barton, E. S., et al. Herpesvirus latency confers symbiotic protection from bacterial infection. Nature. 447, 326-329 (2007).
  28. Ponferrada, V. G., Mauck, B. S., Wooley, D. P. The envelope glycoprotein of human endogenous retrovirus herv-w induces cellular resistance to spleen necrosis virus. Arch. Virol. 148, 659-675 (2003).
  29. Márquez, L. M., Redman, R. S., Rodriguez, R. J., Roossinck, M. J. A virus in a fungus in a plant: three-way symbiosis required for thermal tolerance. Science. 315, 513-515 (2007).
  30. Xu, P. J., et al. Complete genome sequence of a monosense densovirus infecting the cotton bollworm, Helicoverpa armigera. J. Virol. 86, 10909-10909 (2012).
  31. Xu, P. J., Liu, Y. Q., Graham, R. I., Wilson, K., Wu, K. M. Densovirus is a mutualistic symbiont of a global crop pest (Helicoverpa armigera) and protects against a baculovirus and Bt biopesticide. PLoS Pathog. 10, e1004490 (2014).
  32. Liang, G. M., Tan, W. J., Guo, Y. Y. An improvement in the technique of artificial rearing cotton bollworm. Plant Protec. 25, 15-17 (1999).
  33. Zhou, W. G., Rousset, F., O'Neill, S. Phylogeny and PCR-based classification of Wolbachia strains using wsp gene sequences. P. Roy. Soc. B-Biol. Sci. 265, 509-515 (1998).
  34. Mondet, F., de Miranda, J. R., Kretzschmar, A., Le Conte, Y., Mercer, A. R. On the front line: quantitative virus dynamics in honeybee (Apis mellifera L.) colonies along a new expansion front of the parasite Varroa destructor. PLoS Pathog. 10, e1004323 (2014).
  35. Chen, Y. P., et al. Israeli acute paralysis virus: epidemiology, pathogenesis and implications for honey bee health. PLoS Pathog. 10, e1004261 (2014).
  36. Hunter, W., et al. Large-scale field application of RNAi technology reducing israeli acute paralysis virus disease in honey bees (Apis mellifera, Hymenoptera: Apidae). PLoS Pathog. 6, e1001160 (2010).
  37. Halstead, S. B. Dengue virus - mosquito interactions. Annu. Rev. Entomol. 53, 273-291 (2008).
  38. Whitfield, A. E., Falk, B. W., Rotenberg, D. Insect vector-mediated transmission of plant viruses. Virology. 479-480, 278-289 (2015).
  39. Moscardi, F. Assessment of the application of baculoviruses for control of Lepidoptera. Annu. Rev. Entomol. 44, 257-289 (1999).
  40. Szelei, J., et al. Susceptibility of North-American and European crickets to Acheta domesticus densovirus (AdDNV) and associated epizootics. J. Invert. Pathol. 106, 394-399 (2011).
Pamuk Yeşilkurt bir densovirüs Host Fitness Host doku Dağılımı, İletim-modunu ve Etkisi incelenmesi için Protokoller
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Yang, X., Xu, P., Graham, R. I., Yuan, H., Wu, K. Protocols for Investigating the Host-tissue Distribution, Transmission-mode, and Effect on the Host Fitness of a Densovirus in the Cotton Bollworm. J. Vis. Exp. (122), e55534, doi:10.3791/55534 (2017).More

Yang, X., Xu, P., Graham, R. I., Yuan, H., Wu, K. Protocols for Investigating the Host-tissue Distribution, Transmission-mode, and Effect on the Host Fitness of a Densovirus in the Cotton Bollworm. J. Vis. Exp. (122), e55534, doi:10.3791/55534 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter