Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

Protocolli per Indagare la distribuzione Host-tessuti, trasmissione-mode, e Effetto sul Fitness ospite di un Densovirus in cotone bollworm

doi: 10.3791/55534 Published: April 12, 2017

Summary

Qui, vi presentiamo un protocollo per indagare la distribuzione host-tessuto, modalità di trasmissione, e l'effetto sulla forma fisica host di un densovirus all'interno di una specie di lepidotteri, il bollworm cotone. Questo protocollo può essere utilizzato anche per studiare l'interazione tra altri virus per via orale-trasmissibili e loro ospiti dell'insetto.

Abstract

Molti nuovi virus sono stati scoperti in ospiti animali che utilizzano tecnologie di sequenziamento di prossima generazione. In precedenza, abbiamo riportato un virus mutualistica, Helicoverpa armigera densovirus (HaDV2), in una specie di lepidotteri, il bollworm cotone, Helicoverpa armigera (Hubner). Qui, descriviamo i protocolli che sono attualmente utilizzati per studiare l'effetto di HaDV2 sul suo ospite. In primo luogo, stabiliamo un cotone bollworm colonia senza HaDV2 da una singola coppia di riproduttori. Poi, abbiamo oralmente inoculare alcuni prole larvale neonato con HaDV2 contenenti liquido filtrato per la produzione di due colonie con lo stesso background genetico: una HaDV2 infettati, l'altro non infetti. Un protocollo per confrontare parametri della tabella vita (ad esempio, larvale, pupa e periodi adulti e fecondità) tra gli individui HaDV2-infetti e -uninfected è anche presentati, come i protocolli per determinare la distribuzione host-tessuto e l'efficienza della trasmissione di HaDV2. Questi protocolli woULD anche essere adatto per lo studio degli effetti di altri virus trasmesse oralmente sui loro ospiti dell'insetto, gli host lepidotteri in particolare.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Negli ultimi decenni, lo sviluppo della tecnologia di sequenziamento, come sequenziamento di prossima generazione (NGS) ha facilitato la scoperta di molti DNA e RNA virus nuovi, virus particolare non patogeni, ma anche nuovi ceppi di virus già noti 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12. Nel organismo modello Drosophila melanogaster, più di 20 nuovi genomi virali parziali sono stati rilevati utilizzando tecniche metagenomic 13. Molte sequenze virali, e nuovi virus, sono stati identificati in altri insetti, come api, mosquitoes, psille agrumi asiatica, libellule e specie multiple lepidotteri 14, 15, 16, 17, 18, 19, 20, 21.

In futuro, si può prevedere che più nuovi virus saranno scoperti negli insetti che utilizzano queste tecnologie avanzate; di conseguenza, la nostra comprensione dell'interazione virus-ospite può cambiare di conseguenza 6, 9. Ad esempio, le interazioni virus-ospite sono considerati essere più complicato di quanto si pensasse, perché molti virus nuovi si stanno definendo come partner mutualistiche, piuttosto che gli agenti patogeni rigorose 22. Ad esempio, il DplDNV densovirus mutualistico in Dysaphis plantaginea induce il Variante alato e aumenta la mobilità, favorendo la dispersione del paese ospitante, così come il virus 23. Inoltre, i virus mutualistici sono stati descritti per quanto riguarda la salute dei mammiferi, la siccità e la tolleranza al freddo delle piante, e l'impatto delle infezioni batteriche 24. Seneca valle virus-001 è mostrato per mediare la citotossicità selettiva verso le cellule tumorali con il cancro neuroendocrino caratteristiche 25. Infezioni da virus dell'epatite A sopprimere la replicazione del virus dell'epatite C e può portare a recupero da epatite C 26. Latenza herpesvirus conferisce protezione simbiotico da infezione batterica 27. La glicoproteina busta di umana endogena retrovirus HERV-W induce resistenza cellulare milza necrosi virus 28. Curvularia virus tolleranza termica (CThTV) da un endophyte fungina è coinvolto nell'interazione mutualistica tra questo funghi e un'erba di panico tropicaleref "> 29. Quindi, la conoscenza delle interazioni tra i virus più recenti trovati ed i loro ospiti dovrebbe generare nuove prospettive sulla loro biologia e gestione. Tuttavia, i nuovi virus, in particolare i virus segrete che mostrano segni evidenti tipici di infezione acuta, raramente hanno stato indagato, e abbiamo bisogno di un oleodotto e protocolli per studiare gli impatti dei nuovi virus trovati sui loro ospiti.

In precedenza, abbiamo riportato la prevalenza di una nuova monosense densovirus Helicoverpa armigera densovirus (HaDV2) nella bollworm cotone, Helicoverpa armigera, e ha presentato le prove di un rapporto mutualistico tra la HaDV2 e il verme del cotone 30, 31. In questo articolo, descriveremo il protocollo laboratorio per studiare in dettaglio l'interazione tra HaDV2 e il suo ospite cotone verme. Il protocollo presentato qui può anche essere molto rilevante per i ricercatori che esaminano il role di altri virus per via orale trasmissibili, soprattutto in lepidotteri.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Costruzione del HaDV2-libera Cotton bollworm Colony

  1. Cotone posteriore bollworm larve (H. armigera) su una dieta artificiale 32 in una camera di crescita controllata o una camera climatica artificiale a 25 ± 1 ° C, con 14 h di luce / 10 h scuro e il 60% di umidità relativa.
  2. Aiutare singola coppia di accoppiamento farfalle appena eclosed utilizzando una gabbia di plastica per paio (altezza 10 cm diametro 5 cm) rivestito con una garza di cotone per assicurare una buona ventilazione e per servire come substrato ovideposizione. Per aumentare la probabilità di ottenere una colonia privo di virus, utilizzare almeno 30 coppie di singole coppie accoppiamenti. Falene feed adulti con un 10% di zucchero e 2% di vitamina soluzione di 32 imbevuti su un batuffolo di cotone e rifornito giornalmente.
  3. Da adulti femmine depongono le uova sulla garza di cotone circa 2 giorni dopo l'accoppiamento, cambiare la garza quotidiano. Raccogliere e conservare garza contenenti uova nella stessa camera di crescita (o artificiale cham climaber) come le farfalle adulte fino alla schiusa.
  4. trasferire immediatamente larve neonate di nuove piastre da 24 pozzetti, con un individuo per pozzetto.
  5. Cinque giorni dopo la prima data di deposizione delle uova, raccogliere le falene genitore e conservarli in azoto liquido.
    NOTA: Raccolta le falene 5 giorni dopo la prima data di deposizione delle uova garantisce che i genitori sono vivi presso il punto di raccolta e quindi evita eventuali impatti dell'utilizzo di falene morte sulla precisione l'estrazione del DNA.
  6. Isolare il DNA genomico da questi campioni utilizzando un kit di estrazione del DNA secondo le istruzioni del produttore.
    1. Amplificare un frammento 574 bp del gene actina con primers actina F / R actina (actina F: 5 CATCTACGAGGGTTACGC-3 e actina R: 5 CATCTGTTGGAAGGTGGA-3). Visualizza la reazione a catena della polimerasi (PCR) utilizzando prodotti elettroforesi su gel di agarosio secondo protocolli standard; l'amplificazione di successo del gene actina assicura che il DNA è di buona qualità.
    2. valutare tegli presenza di HaDV2 nelle falene genitore utilizzando PCR con primer specifici: DVVPF (GGATTGGCCTGGGAAATGAC) e DVVPR (CGTTGTTTTTATATCCGAGG) 31.
  7. Una volta che una coppia pulita è stato identificato, progenie posteriore da quella singola coppia di allevamento HaDV2 non infetti da almeno cinque generazioni e mantenere quale HaDV2 privo colonia (NONINF-strain); la colonia HaDV2 infettate è definita come l'INF-ceppo.
  8. Per verificare lo stato di infezione HaDV2 nel NONINF-deformazione (e per escludere l'effetto di batteri o virus sullo sviluppo host noto), valutare lo stato di infezione per HaDV2, Wolbachia, e H. armigera nucleopolyhedrovirus (HaNPV) in otto individui scelti a caso larve del NONINF-deformazione mediante PCR (con primer specifici: DVVPF / DVVPR per HaDV2, NPVF / NPVR per HaNPV, e 81F / 691R per Wolbachia 31, 33).
    NOTA: E 'noto che alcuni virus potrebbero essere in ritardont nell'ospite infetto, con un livello non rilevabile anche quando si utilizza una tecnica basata sulla PCR. tecnologie NGS potrebbero essere utilizzati per confermare che non sequenze virali sono presenti nei campioni di DNA genomico.

2. Preparazione di HaDV2 contenenti fluidi liquidi

Nota: abbiamo dimostrato che il tentativo di purificazione delle particelle di virus HaDV2 inibisce la loro infettività e l'attività 31; pertanto, il seguente protocollo è eseguita per realizzare la soluzione infettivo HaDV2 filtrando individui HaDV2-infetti.

  1. Raccogliere lepidotteri adulti individualmente e immediatamente memorizzarli in azoto liquido.
  2. Completamente macinare le tarme singoli raccolti in azoto liquido con un mortaio e pestello sterilizzato. Trasferire circa 10 mg di detriti in una provetta pulita da 1,5 ml. Trasferire i detriti rimanente in una nuova provetta e immediatamente conservarle a -80 ° C.
  3. Estrarre il DNA da 10 ug di detriti, folloala i protocolli forniti dal produttore. Una volta che il DNA è stato isolato falena, controllare HaDV2 utilizzando il protocollo, come descritto al punto 1.6.
  4. Secondo i risultati ottenuti nello stadio 2.3, dividere i detriti rimanente in due gruppi: HaDV2-positivi e HaDV2-negativi, a seconda del loro stato di infezione. Aggiungere 1 ml di soluzione salina tamponata con fosfato (PBS; 137 mM NaCl, 2.7 mM KCl, 8 mM Na 2 HPO 4, e 1,5 mM KH 2 PO 4, pH 7,5) ad ogni individuo sciogliere completamente i detriti larvale rimanente.
  5. Centrifugare l'omogeneizzato (dal punto 2.4) a 6.500 xg per 15 min a 4 ° C. Filtrare il surnatante liquido con un filtro a membrana da 0,22 micron. Raccogliere i liquidi filtrati (200 pl per tubo) e immediatamente conservarle a -80 ° C.
    NOTA: Il filtro a membrana da 0,22 micron filtrerà la maggior parte del particolato indesiderabile, batteri e funghi. Prima preraffreddare la centrifuga a 4 ° C. Eseguire tutti i protocolli involving il funzionamento di liquido filtrato sul ghiaccio per evitare che l'omogeneizzato da imbrunimento e coagulazione.

3. Costruzione della HaDV2 infettati cotone bollworm Colony

  1. capacità di trasmissione orizzontale di HaDV2
    1. Genera una curva standard HaDV2.
      1. Amplificare i frammenti contenenti primer (VPF: CTGGTGAGGCGATGGACATG; VPR: TGACAAGATCCAGCGTAGACATC) e sonda (VP-probe: GCCACCACTAGAGGACCCACCAGATG), che vengono utilizzati per la quantificazione del virus HaDV2, con i primer de novo (PF: GGACAATGCTGGTGAGGC; PR: AATCCTCTTTGTCCGTTATCTATG). Utilizzare il seguente programma: 30 s a 94 ° C, 30 s at 53 ° C e 60 s a 72 ° C per 40 cicli in un ciclatore termico PCR 31. Aggiungere 1 ml di DNA genomico contenente il genoma HaDV2 (passo 2,3) per la reazione di 25 microlitri PCR come DNA stampo. Clonare i frammenti amplificati in un vettore di clonaggio secondo i protocolli del produttore.
      2. Calcolare il numero di copie diplasmidi con la seguente equazione: copie / ml = (N A × C) / (n × M × 10 9), dove N è un numero di Avogadro (6,02 × 10 23 molecole / mol); C è la concentrazione di massa di plasmidi (ng / mL), che possono essere misurate con microspettrofotometria; n è la lunghezza del plasmide ricombinante contenente il prodotto di PCR (5,195 bp); e M è il peso molecolare di una coppia di basi media di DNA a doppio filamento (660 g / mol).
      3. Preparare sei diluizioni seriali di 10 volte in tubi da microcentrifuga da 1,5 mL, con concentrazioni di 1,5 × 10 9 1,5 × 10 8, 1,5 x 10 7, 1,5 x 10 6, 1.5 × 10 5 e 1.5 × 10 4 numero di copie / microlitri.
      4. Eseguire Real time PCR quantitativa (qPCR) usando primer specifici (VPF / VPR) e una sonda (VP-probe) per generare ciclo threshold (CT) valori dei plasmidi descritti al punto 3.1.1.3. Eseguire tre repliche tecnici indipendenti e media per ulteriori calcoli.
      5. Utilizzando i risultati di cui sopra, generare una curva standard correlazione concentrazioni HaDV2 log2 trasformati ai relativi valori CT medi.
    2. Quantificare HaDV2 nei fluidi liquidi filtrati.
      1. Pipettare un test campione di 100 ml di fluido liquido filtrato (passo 2.6) contenente HaDV2 per l'estrazione del DNA.
      2. Utilizzare real time-qPCR per ottenere i valori CT per i fluidi liquidi e calcolare il numero di copie utilizzando la curva standard nel passaggio 3.1.1.
    3. Determinare l'efficienza infezione orale con liquidi filtrati HaDV2 infette di diverse concentrazioni.
      1. Diluire il fluido liquido contenente HaDV2 alle seguenti concentrazioni: 10 8, 10 7, 10 6, il numero 10 5, 10 4, e 0 copia / ml.
      2. Stendere la di artificialeet uniformemente su a 9 cm di diametro capsula Petri prima solidificazione. Distribuito liquido HaDV2 contenente filtrato (200 mL) per ciascuna concentrazione sulla superficie della dieta artificiale solido. Fate questo in una cappa aspirante.
      3. Trasferire 100 larve appena schiuse alla dieta artificiale HaDV2 contenenti in una capsula di Petri. battere delicatamente la garza di cotone (compresi larve appena tratteggiato) per trasferire le larve della garza ad un foglio di carta bianca. Battere delicatamente la carta in modo che le larve di spin seta e "fumetto" fuori la carta. Utilizzare pinze sterilizzate per toccare la seta e spostare le larve di una capsula di Petri.
      4. Dopo 48 h, trasferire le larve sulla dieta artificiale per piastre da 24 pozzetti (un individuo per pozzetto).
      5. Posteriore le larve inoculati con HaDV2 alle concentrazioni superiori allo stadio adulto.
      6. Raccogliere le tarme adulti, estrarre il DNA, e rilevare HaDV2 utilizzando PCR, come descritto al punto 1.5.
        NOTA: Qui, ottenere un tasso di infezione HaDV2 100% del cobollworm tton utilizzando il 10 8 copia numero / ml e stabilire la colonia HaDV2 infettate (INF-strain) così.
  2. capacità di trasmissione verticale del HaDV2
    1. Seleziona lepidotteri adulti dai NONINF e INF-ceppi per generare singole coppie di ♀- / ♂-, ♀ + / ♂-, ♀- / ♂ + ♀ e + / + ♂ (+: positiva per infezione HaDV2; -: negativo per HaDV2 infezione).
    2. Trasferire la discendenza che le suddette coppie di piastre da 24 pozzetti privo di virus; posteriori le larve al terzo stadio.
    3. Estrarre il DNA dal raccolto larve terzo stadio utilizzare come modello per determinare la presenza di HaDV2, come descritto al punto 1.5.

4. Tissue Distribuzione di HaDV2

  1. Per prevenire la contaminazione da virus e batteri, sterilizzare le pinze e forbici in etanolo al 75% per tre volte e poi riscaldare nella fiamma di una lampada ad alcool.
    NOTA: sterilizatio Pinzan è necessario quando si verifica una contaminazione.
  2. Utilizzando una bilancia analitica, pesare i tubetti vuoti che devono essere utilizzati per memorizzare i tessuti.
  3. Mettere le larve e adulti di falene dalla INF-deformazione in ghiaccio per circa 5 min.
  4. Sezionare i seguenti tessuti sotto uno stereomicroscopio nelle larve, femmine adulte e maschi adulti in un piatto pulito Petri contenente tampone PBS.
    1. Per le larve, pipetta emolinfa e sezionare foregut, midgut, hindgut, grasso corporeo, e tubuli malpighiani (Figura 1A). Trasferire immediatamente ogni tessuto ai tubi in azoto liquido.
      1. Fissare le larve surgelata su cystosepiment utilizzando due perni di insetti (200 micron di diametro, 20 mm di lunghezza), inserendo nelle membrane intersegmentale vicino alla testa e l'ultimo segmento addominale (Figura 1A).
      2. Tagliare il proleg nell'addome posteriori delle larve in modo che l'emolinfa larve fuoriesce. Pipettare l'emolinfa larvale entro 10 s utilizzando un microPipette per prevenire l'imbrunimento e coagulazione del emolinfa.
        NOTA: feniltiourea (50 ug / mL) potrebbe essere miscelato con un rapporto / vol 01:20 vol con emolinfa per impedire melanizzazione.
      3. Usando un paio di forbici, fare un'incisione nella cuticola vanno dall'ultimo membrana intersegmentale alla testa. Sezionare tutti i tessuti rimanenti sotto uno stereomicroscopio utilizzando due pinze; l'immagine di ogni tessuto è mostrato nella Figura 1A.
      4. Mescolare campioni di tessuto da tre individui insieme come un replicato.
      5. Per evitare la contaminazione dei restanti tessuti con emolinfa durante la dissezione, lavare i tessuti sezionati in tampone PBS tre volte. Poi, testare lo stato HaDV2-infezione della PBS utilizzata per il lavaggio. Se il tampone di lavaggio finale è HaDV2-libera, il tessuto deve essere pulito dalla contaminazione con emolinfa.
    2. Per le femmine adulte, sezionare la testa (cervello), i muscoli, il grasso del corpo, intestino, tubuli malpighiani, e dell'ovaio (Figura 1B) allo stereomicroscopio in tampone PBS. Per i maschi adulti, sezionare la testa (cervello), i muscoli, grasso corporeo, intestino, tubuli malpighiani e testicoli (Figura 1C) allo stereomicroscopio in tampone PBS. Trasferire immediatamente ogni tessuto ai tubi in azoto liquido.
      1. Con pinze e forbici, rimuovere le ali dei lepidotteri adulti e lavare il corpo rimanente tre volte per cancellare le scale.
      2. Separare la testa, torace e dell'addome con le forbici.
      3. Rimuovere l'endoscheletro del torace e raccogliere il muscolo.
      4. Utilizzando pinze, rimuovere la cuticola dell'addome e sezionare altri tessuti seguenti figure 1B e 1C.
      5. Miscelare i campioni di tessuto da tre individui insieme come un replicato. Lavare i tessuti sezionati in tampone PBS tre volte.
  5. Pesare i tubi ed i tessuti di cui sopra, quando sono stati congelati e garantire che il mculi dei diversi tessuti sono quasi uguali.
    Massa (tessuti) = massa (tubi / campione di tessuto) - massa (solo tubo)
  6. Estrarre il DNA da questi tessuti ed eseguire qPCR, come descritto al punto 3.1.2.
  7. Calcolare il numero di copie per mg di ciascun tessuto utilizzando la curva standard generata nel passaggio 3.1.1. Utilizzare il titolo del virus per unità di massa per correggere l'errore di campionamento causata da qualsiasi differenza nella quantità di tessuto utilizzati per l'estrazione del DNA.
  8. Calcolare la percentuale di HaDV2 nel tessuto specifico come segue: percentuale di HaDV2 per ogni tessuto = HaDV2 numero di copie per mg di tessuto testato / (somma del numero di copie per mg di tutti i tessuti).

5. Bioassays Verifica l'effetto della HaDV2 sullo sviluppo Host

  1. Luogo almeno 100 pupe o adulti lepidotteri nuovi emersi derivati ​​dalla NONINF-ceppo in una gabbia di cotone-garza coperto 5-L, wire-mesh. Dopo 2 giorni, le femmine adulte accoppiati inizieranno a deporre le uova sulla garza di cotone. Raccogliere e conservarela garza di cotone contenente le uova; le uova si schiudono in circa tre giorni.
  2. L'inoculazione delle larve neonato con HaDV2.
    1. Trasferire le larve del neonato NONINF-deformazione alla dieta artificiale contenente HaDV2 (10 8 numero di copie / mL) per stabilire l'INF-ceppo.
    2. Analogamente, trasferire neonato larve alla dieta artificiale coperto con liquido filtrato HaDV2-libera (passo 2.4) per stabilire i gruppi di controllo (NONINF-ceppo). Includere almeno 240 larve ciascun trattamento (Figura 2A).
      NOTA: Le larve che vengono utilizzati per costruire il NONINF- e INF-ceppi sono derivati ​​dalla stessa coorte genitore e portello allo stesso tempo, garantendo lo stesso sfondo genetico. Assicurarsi che i NONINF- e INF-ceppi sono tenuti nella stessa camera climatica (a 25 ± 1 ° C, con 14 h di luce / 10 h buio e umidità relativa 60%) per un tasso sincrono di sviluppo; il tasso può variare a seconda della temperatura e dell'umidità. Maneggiare il Delicmangiato delicatamente le larve.
  3. Dopo 48 h, trasferire le larve individualmente per piastre da 24 pozzetti (un individuo per pozzetto) (Figura 2B).
    1. numero in sequenza ogni larva in ciascun pozzetto e registrare la fase instar e lo stato di sopravvivenza quotidiana.
    2. Circa 5 giorni più tardi, quando la dieta artificiale si deteriora, trasferire simultaneamente questi individui ad un nuovo 24-pozzetti contenenti dieta artificiale fresco (Figura 2C).
    3. Pesare le larve dal giorno 7 alle 11 dopo la schiusa utilizzando una bilancia analitica con una precisione di 0,0001 g. Dopo la pesatura, restituire individualmente le larve alla piastra da 24 pozzetti.
  4. Su muta al quinto instar dopo il quarto ecdysis (circa dieci giorni dopo la schiusa), trasferire le larve di tubi di vetro (altezza 10 cm, 2 cm di diametro) (Figura 2D); quinto larve instar può anche essere identificata dalla larghezza della capsula testa (circa 2,6 mm).
    NOTA: Trasferire gli individuial tubo di vetro, allo stesso tempo ogni giorno.
    1. Codice ogni larva con il suo numero di riferimento originale sul tubo di vetro con vernice o marcatori. Registrare lo stato larvale quotidiana; nei tubi di vetro, le larve si pupate dopo circa cinque giorni, la fase pupe dura circa 11 giorni.
    2. Registrare la data e pupe eclosion per ogni individuo nel tubo di vetro. Registrare la massa di 3 giorni di età pupe.
  5. Dopo eclosion, mettere una femmina e un maschio in una singola gabbia con 10% di saccarosio e soluzione di vitamina 2% (figura 2E). Ricostituire la soluzione di saccarosio ogni giorno. Registrare la data di morte per ogni falena.
  6. Quando le uova vengono deposte, cambiare la garza di cotone al giorno. Contare il numero di uova immediatamente. Count prole appena tratteggiato, mentre si schiudono.
  7. Durante i test biologici, selezionare casualmente otto persone per ogni trattamento per confermare lo stato di infezione di HaDV2. Estrarre l'RNA totale di questi campioni utilizzando il reagente tripsina commercialeseguendo il protocollo del produttore. Sintetizzare il primo filamento di cDNA seguendo il protocollo del produttore e usarlo come modello per verificare se i virus sono trascritti con successo.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Progenie dai genitori che erano HaDV2-libera (Figura 3A) sono stati allevati come NONINF-strain. Abbiamo amplificato con successo il gene actina usando gli stessi modelli di DNA, suggerendo che i modelli di DNA erano di buona qualità (Figura 3B). Inoltre, i selezionati casualmente otto progenie erano liberi di HaDV2 (Figura 3C), HaNPV (Figura 3D), e Wolbachia (Figura 3E). Ancora una volta, abbiamo concluso che i campioni di DNA della progenie erano di buona qualità, in quanto una porzione di gene actina è stato amplificato con successo per tutti i campioni testati (Figura 3F).

Una curva standard che definisce la relazione tra il log della qualità di materiale di partenza e dei valori CT ottenuti è stata generata, come in Figura 4. Una forte correlazione lineare (R (Figura 4).

Appena larve si sono schiuse sono stati inoculati con una curva standard punto di HaDV2 fluidi liquidi utilizzando diluizioni seriali di 10 volte tra 10 4 e 10 8 numero di copie / ml. Abbiamo ottenuto una correlazione lineare tra la frequenza infezione e le concentrazioni dei fluidi liquidi HaDV2; 10 8 numero di copie / ml prodotto% infezione 100 per il verme del cotone, ma altre concentrazioni non (vedi anche Xu et al. 31). Le frequenze infezione HaDV2 di progenie dei genitori aventi un diverso stato di infezione HaDV2 sono stati i seguenti: 100% per ♀ + / ♂-, 78% per ♀- / ♂ +, e 100% per ♀ + / ♂ + (vedi anche Xu et al. 31).

per correct differenze individuali nel titolo HaDV2, è stato calcolato il numero di copie HaDV2 per mg di ogni tessuto e la percentuale del totale titolo HaDV2 per il tessuto specifico. I risultati hanno rivelato che HaDV2 è principalmente distribuita nel corpo grasso (figura 5; anche vedere Xu et al. 31). Il confronto dei parametri della tabella vita, compresi i periodi larvali, periodi pupe, lunghezza degli adulti, e fecondità, sono stati mostrati in Tabella 1 (vedi anche Xu et al. 31). Le masse larvali e pupe erano come pubblicato da Xu et al. 31. Gli stati di infezione HaDV2 sia nel NONINF-deformazione e INF-ceppo sono stati determinati mediante PCR (risultati pubblicati da Xu et al. 31).

Figura 1
Figura 1. sezionato tessuti per (A) larve, (B) unFemmina adulta, e (C) un maschio adulto. H, testa (cervello); Egli, emolinfa; FB, grasso corporeo; Mt, tubuli malpighiani; G, intestino; FG, foregut; MG, midgut; HG, hindgut; Mu, i muscoli; O, ovaio; T, testicolo. Si prega di cliccare qui per vedere una versione più grande di questa figura.

figura 2
Figura 2. Procedura Bioassay per determinare gli effetti della HaDV2 sul cotone bollworm. (A) inoculazione delle larve appena schiuse con HaDV2. (B) Il trasferimento degli individui infetti HaDV2 e HaDV2-liberi per piastre da 24 pozzetti dopo 48 ore. (C) I formati differenti di individui HaDV2-infetti e senza glutine. (D) Trasferimento di quinta instar larve di nuovi tubi di vetro (10 cm Altezza, a 2 cm di diametro). (E) Il posizionamento di unofemmina ed una falena maschio nella stessa gabbia per determinare la longevità degli adulti, produzione di uova, e il tasso di tratteggio. Si prega di cliccare qui per vedere una versione più grande di questa figura.

Figura 3
Figura 3. Stato Infezione per HaDV2, HaNPV o Wolbachia in colonie HaDV2-infetti e HaDV2-liberi. HaDV2 stato di infezione nei genitori femminili e maschili (A). Stato di infezione di HaDV2 (C), HaNPV (D), e Wolbachia (E) nella progenie selezionati casualmente. Per verificare la qualità del DNA genomico, l'actina gene housekeeping è stato inoltre amplificato per i genitori (B) e progenie (F). Corsia M mostra l'indicatore DL2000 (2.000 bp, 1000 bp, 750 bp, 500 bp, 250 bp, und 100 bp). Corsia 1: genitore di sesso femminile. Corsia 2: genitore maschio. Corsia 3-10: progenie. Si prega di cliccare qui per vedere una versione più grande di questa figura.

Figura 4
Figura 4. Le Curva standard correlando Log 2-trasformate HaDV2 Concentrazioni al ciclo soglia (CT) Valori. Si prega di cliccare qui per vedere una versione più grande di questa figura.

Figura 5
Figura 5. Host-tessuto Distribuzione di HaDV2 a larve (A), femmina adulta (B), e del maschio adulto (C) cotone bollworm. Percentuale (%) = rapporto di HaDV2 in differenti tessuti (per mg), come descritto i(:; I maschi adulti n = 7: larve n = 6; femmine adulte: n = 6) n passo 4.7 I dati sono stati analizzati statisticamente mediante analisi della varianza (ANOVA) e il test di Tukey. Medie ± SE. I risultati sono stati pubblicati da Xu et al. 31. Si prega di cliccare qui per vedere una versione più grande di questa figura.

Parametri storia di vita HaDV2 + HaDV2- valore t df valore di P
periodo larvale (giorni) Maschio 16.51 (± 0,72) 16.93 (± 1,21) 4.147 379 <0.001
Femmina 16.51 (± 0,79) 16.80 (± 1,05) 2.732 312 0,0067
periodo di pupa (giorni) Maschio 13.02 (± 0,68) 13.31 (± 0,69) 4.057 379 <0.001
Femmina 11.62 (± 0,67) 12.00 (± 0,63) 5.1 312 <0.001
La longevità degli adulti (giorni) Maschio 10.69 (± 1,98) 10.93 (± 2.46) 0,915 367 0,36
Femmina 9.07 (± 1,98) 8.51 (± 1,58) 2.992 367 0.003
Numero di uova prodotte per femmina 482 (± 174) 403 (± 180) 2.172 93 0,032
Numero di tratteggi per femmina 207 (± 108) 143 (± 99) 3.026 93 0,0032

Tabella 1. Parametri di vita precedenti di HaDV2 + e bollworm HaDV2-cotone. test t viene utilizzato per determinare il livello di significatività. Medie ± SE sono presenti. I dati presentati in questa tabella sono stati pubblicati da Xu et al. 31.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Negli ultimi decenni, la maggior parte degli studi sulle interazioni insetto-virus sono concentrati sulla salute miele delle api 34, 35, 36, vettori di malattie umane 37, impianto di virus 38, e alcuni virus patogeni di insetti che hanno un grande potenziale come agenti di controllo biologico 39. Poca attenzione è stata prestata ai virus segrete negli insetti, soprattutto in lepidotteri. Qui, vi presentiamo un protocollo per lo studio delle interazioni tra un virus e la sua segreta insetto ospite. Un confronto tra i parametri della tabella di vita per le persone di host infettati da virus e virus-free dovrebbe idealmente escludere qualsiasi effetto delle differenze di accoglienza background genetico. Per studiare il fenotipo virale, molti studi precedenti hanno confrontato i parametri della tabella di vita di entrambi gli individui naturalmente infetti o non infetti nella stessa colonia o individui inoculaticon microiniezione, ma questo sforzo è che richiede tempo 23, 40. L'inoculazione orale di bollworm cotone con HaDV2, qui descritte, serve come mezzo semplice ed efficace per analizzare fenotipi virali. Questa procedura garantisce anche lo stesso background genetico per le colonie HaDV2-infetti e non infetti HaDV2.

Virus inoculo può essere preparato in molti modi. La purificazione di particelle virali mediante centrifugazione ad alta velocità inibisce infettività del virus, con conseguente bassa infettività; quindi, liquido filtrato contenente il virus è stato usato per infettare cotone verme larve 31. Il fatto che la membrana 0,22 micron può filtrare più fungine e batteriche particelle dal liquido HaDV2 contenente filtrato e il liquido filtrato HaDV2-libero è stato utilizzato come controllo potrebbe escludere l'effetto di altri virus sui risultati. Tuttavia, non possiamo escludere la possibilità che i risultati test biologici potrebbe unLSO essere prevenuto da virus non scoperti. Quindi, le particelle HaDV2 con elevata infettività dovrebbero idealmente essere purificati in futuro per ottenere risultati affidabili.

La concentrazione di virus correlata positivamente con infettività del virus; quindi, siamo stati interessati a determinare la concentrazione HaDV2 che produrrà% infezione 100. I nostri risultati hanno mostrato che il 10 numero 8 copie / ml potrebbe essere utilizzato per l'inoculazione del virus per ottenere questo tasso di infezione. Senza dubbio, la correlazione tra titolo del virus e il tasso di infezione dovrebbe essere studiato per altre interazioni virus-ospite studiati in futuro. Inoltre, il titolo del virus di ogni individuo nel campo dovrebbe essere esplorata. Quindi, si potrebbe quindi simulare l'effetto del virus sugli individui nel campo.

Il trattamento delicato delle larve delicate durante i primi giorni dopo si schiudono è molto importante, perché sono facilmente fatalmente danneggiati. Inoltre, il colle HaDV2 non infettiony vanno separati in serra per evitare contaminazione HaDV2 il tasso di infezione di HaDV2 è stato trovato per essere molto elevata, sia in campo e in laboratorio 31.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Gli autori dichiarano di non avere interessi finanziari in competizione.

Acknowledgments

Questo lavoro è stato sostenuto dal Programma Nazionale di Ricerca di base chiave della Cina (n 2013CB127602) e il Fondo Scienza for Creative gruppi di ricerca del National Science Foundation della Cina (n ° 31.321.004).

Materials

Name Company Catalog Number Comments
24-well plate Corning 07-200-740 Multiple suppliers available.
DNA extraction kit TIANGEN DP304-03 Multiple suppliers available.
thermal cycler Veriti; Applied Biosystems 4375786
PBS Corning 21-040-CV
0.22 µm membrane filter Millipore SLGS025NB
pEASY-T Cloning Vector TransGen, Beijing, China CT301-02
Tweezers IDEAL-TEK 2.SA
Premix Ex Taq (Probe qPCR) Takara RR390A
Probes Invitrogen Custom order
Primers Invitrogen Custom order
microspectrophotometry NanoDrop 2000c  Thermo scientific  not available
7500 Real-Time PCR system Applied Biosystems not available
stereomicroscope SZX-16 Olympus not available
sucrose Multiple suppliers available.
vitamin complex Multiple suppliers available.

DOWNLOAD MATERIALS LIST

References

  1. Tang, P., Chiu, C. Metagenomics for the discovery of novel human viruses. Future Microbiol. 5, 177-189 (2010).
  2. Rosario, K., Breitbart, M. Exploring the viral world through metagenomics. Curr. Opin. Virol. 1, 289-297 (2011).
  3. Hugenholtz, P., Tyson, G. W. Microbiology - metagenomics. Nature. 455, 481-483 (2008).
  4. Kristensen, D. M., Mushegian, A. R., Dolja, V. V., Koonin, E. V. New dimensions of the virus world discovered through metagenomics. Trends Microbiol. 18, 11-19 (2010).
  5. Kleiner, M., Hooper, L. V., Duerkop, B. A. Evaluation of methods to purify virus-like particles for metagenomic sequencing of intestinal viromes. BMC Genomics. 16, 7 (2015).
  6. Ho, T., Tzanetakis, I. E. Development of a virus detection and discovery pipeline using next generation sequencing. Virology. 471, 54-60 (2014).
  7. Marx, C. J. Can you sequence ecology? Metagenomics of adaptive diversification. PLoS Biol. 11, e1001487 (2013).
  8. Radford, A. D., et al. Application of next-generation sequencing technologies in virology. J. Gen. Virol. 93, 1853-1868 (2012).
  9. Liu, S. J., Chen, Y. T., Bonning, B. C. RNA virus discovery in insects. Curr. Opin. Insect Sci. 8, 54-61 (2015).
  10. Mokili, J. L., Rohwer, F., Dutilh, B. E. Metagenomics and future perspectives in virus discovery. Curr. Opin. Virol. 2, 63-77 (2012).
  11. Liu, S. J., Vijayendran, D., Bonning, B. C. Next generation sequencing technologies for insect virus discovery. Viruses-Basel. 3, 1849-1869 (2011).
  12. Cook, S., et al. Novel virus discovery and genome reconstruction from field RNA samples reveals highly divergent viruses in Dipteran hosts. PLoS ONE. 8, e80720 (2013).
  13. Webster, C. L., et al. The discovery, distribution, and evolution of viruses associated with Drosophila melanogaster. PLoS Biol. 13, e1002210 (2015).
  14. Granberg, F., et al. Metagenomic detection of viral pathogens in spanish honeybees: co-infection by aphid lethal paralysis, israel acute paralysis and lake sinai viruses. PLoS ONE. 8, e57459 (2013).
  15. Runckel, C., et al. Temporal analysis of the honey bee microbiome reveals four novel viruses and seasonal prevalence of known viruses, Nosema, and Crithidia. PLoS ONE. 6, 20656 (2011).
  16. Cox-Foster, D. L., et al. A metagenomic survey of microbes in honey bee colony collapse disorder. Science. 318, 283-287 (2007).
  17. Chandler, J. A., Liu, R. M., Bennett, S. N. RNA shotgun metagenomic sequencing of northern California (USA) mosquitoes uncovers viruses, bacteria, and fungi. Front. Microbiol. 6, 185 (2015).
  18. Shi, C. Y., et al. A metagenomic survey of viral abundance and diversity in mosquitoes from Hubei province. PLoS ONE. 10, e0129845 (2015).
  19. Nouri, S., Salem, N., Nigg, J. C., Falk, B. W. Diverse array of new viral sequences identified in worldwide populations of the Asian citrus psyllid (Diaphorina citri) using viral metagenomics. J. Virol. 90, 2434-2445 (2016).
  20. Dayaram, A., et al. Identification of diverse circular single-stranded DNA viruses in adult dragonflies and damselflies (Insecta Odonata) of Arizona and Oklahoma, USA. Infect. Genet. Evol. 30, 278-287 (2015).
  21. Jakubowska, A. K., et al. Simultaneous occurrence of covert infections with small RNA viruses in the lepidopteran Spodoptera exigua. J.Invert. Pathol. 121, 56-63 (2014).
  22. Roossinck, M. J. Move over, Bacteria! Viruses make their mark as mutualistic microbial symbionts. J. Virol. 89, 6532-6535 (2015).
  23. Ryabov, E. V., Keane, G., Naish, N., Evered, C., Winstanley, D. Densovirus induces winged morphs in asexual clones of the rosy apple aphid, Dysaphis plantaginea. Proc. Natl. Acad. Sci. USA. 106, 8465-8470 (2009).
  24. Roossinck, M. J. The good viruses: viral mutualistic symbioses. Nat. Rev. Microbiol. 9, 99-108 (2011).
  25. Venkataraman, S., et al. Structure of seneca valley virus-001: an oncolytic picornavirus representing a new genus. Structure. 16, 1555-1561 (2008).
  26. Deterding, K., et al. Hepatitis a virus infection suppresses hepatitis c virus replication and may lead to clearance of hcv. J. Hepatol. 45, 770-778 (2007).
  27. Barton, E. S., et al. Herpesvirus latency confers symbiotic protection from bacterial infection. Nature. 447, 326-329 (2007).
  28. Ponferrada, V. G., Mauck, B. S., Wooley, D. P. The envelope glycoprotein of human endogenous retrovirus herv-w induces cellular resistance to spleen necrosis virus. Arch. Virol. 148, 659-675 (2003).
  29. Márquez, L. M., Redman, R. S., Rodriguez, R. J., Roossinck, M. J. A virus in a fungus in a plant: three-way symbiosis required for thermal tolerance. Science. 315, 513-515 (2007).
  30. Xu, P. J., et al. Complete genome sequence of a monosense densovirus infecting the cotton bollworm, Helicoverpa armigera. J. Virol. 86, 10909-10909 (2012).
  31. Xu, P. J., Liu, Y. Q., Graham, R. I., Wilson, K., Wu, K. M. Densovirus is a mutualistic symbiont of a global crop pest (Helicoverpa armigera) and protects against a baculovirus and Bt biopesticide. PLoS Pathog. 10, e1004490 (2014).
  32. Liang, G. M., Tan, W. J., Guo, Y. Y. An improvement in the technique of artificial rearing cotton bollworm. Plant Protec. 25, 15-17 (1999).
  33. Zhou, W. G., Rousset, F., O'Neill, S. Phylogeny and PCR-based classification of Wolbachia strains using wsp gene sequences. P. Roy. Soc. B-Biol. Sci. 265, 509-515 (1998).
  34. Mondet, F., de Miranda, J. R., Kretzschmar, A., Le Conte, Y., Mercer, A. R. On the front line: quantitative virus dynamics in honeybee (Apis mellifera L.) colonies along a new expansion front of the parasite Varroa destructor. PLoS Pathog. 10, e1004323 (2014).
  35. Chen, Y. P., et al. Israeli acute paralysis virus: epidemiology, pathogenesis and implications for honey bee health. PLoS Pathog. 10, e1004261 (2014).
  36. Hunter, W., et al. Large-scale field application of RNAi technology reducing israeli acute paralysis virus disease in honey bees (Apis mellifera, Hymenoptera: Apidae). PLoS Pathog. 6, e1001160 (2010).
  37. Halstead, S. B. Dengue virus - mosquito interactions. Annu. Rev. Entomol. 53, 273-291 (2008).
  38. Whitfield, A. E., Falk, B. W., Rotenberg, D. Insect vector-mediated transmission of plant viruses. Virology. 479-480, 278-289 (2015).
  39. Moscardi, F. Assessment of the application of baculoviruses for control of Lepidoptera. Annu. Rev. Entomol. 44, 257-289 (1999).
  40. Szelei, J., et al. Susceptibility of North-American and European crickets to Acheta domesticus densovirus (AdDNV) and associated epizootics. J. Invert. Pathol. 106, 394-399 (2011).
Protocolli per Indagare la distribuzione Host-tessuti, trasmissione-mode, e Effetto sul Fitness ospite di un Densovirus in cotone bollworm
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Yang, X., Xu, P., Graham, R. I., Yuan, H., Wu, K. Protocols for Investigating the Host-tissue Distribution, Transmission-mode, and Effect on the Host Fitness of a Densovirus in the Cotton Bollworm. J. Vis. Exp. (122), e55534, doi:10.3791/55534 (2017).More

Yang, X., Xu, P., Graham, R. I., Yuan, H., Wu, K. Protocols for Investigating the Host-tissue Distribution, Transmission-mode, and Effect on the Host Fitness of a Densovirus in the Cotton Bollworm. J. Vis. Exp. (122), e55534, doi:10.3791/55534 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter