Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

Protocolos para investigar a distribuição Host-tecido, de modo Transmissão e Efeito sobre a aptidão do host de um densovírus na lagarta do algodão

doi: 10.3791/55534 Published: April 12, 2017

Summary

Aqui, apresentamos um protocolo para investigar a distribuição de tecido hospedeiro, o modo de transmissão, eo efeito sobre a aptidão anfitrião de um densovírus dentro de uma espécie de lepidópteros, a lagarta do algodão. Este protocolo pode também ser utilizado para estudar a interacção entre outros vírus oralmente transmitidos e os seus hospedeiros de insecto.

Abstract

Muitos vírus novos foram descobertos em hospedeiros animais, utilizando tecnologias de sequenciamento de próxima geração. Anteriormente, relatou um vírus mutualistic, Helicoverpa armigera densovírus (HaDV2), em uma espécie de lepidópteros, a lagarta do algodão, Helicoverpa armigera (Hubner). Aqui, descrevemos os protocolos que são atualmente utilizados para estudar o efeito da HaDV2 em seu hospedeiro. Primeiro, estabelecer uma colônia lagarta do algodão livre de HaDV2 partir de um único par de reprodução. Em seguida, por via oral inocular alguns prole das larvas neonato com HaDV2 que contém o líquido filtrado para produzir duas colónias com o mesmo fundo genético: um HaDV2-infectadas, o outro não infectadas. Um protocolo para comparar parâmetros de tabela de vida (por exemplo, larvas, pupas e adultos períodos e fecundidade) entre os indivíduos infectados e HaDV2--uninfected também é apresentada, assim como os protocolos para a determinação da distribuição do tecido hospedeiro e a eficiência de transmissão de HaDV2. Estes protocolos would também ser adequado para investigar os efeitos de outros vírus transmitidos por via oral sobre os seus hospedeiros de insectos lepidópteros, hospedeiros, em particular.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Nas últimas décadas, o desenvolvimento da tecnologia de sequenciação, tais como a sequenciação de última geração (NGS) facilitou a descoberta de diversos novos ADN e ARN de vírus, vírus especialmente não patogénicas, mas também novos isolados de vírus anteriormente conhecidas 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12. No modelo de organismo de Drosophila melanogaster, mais do que 20 novos genomas virais parciais foram detectadas utilizando técnicas de metagenomic 13. Muitas sequências virais, incluindo novos vírus, também foram identificadas em outros insectos, tais como abelhas, mosquitoes, psilídeos citrinos asiáticos, libélulas, e várias espécies de lepidópteros 14, 15, 16, 17, 18, 19, 20, 21.

No futuro, pode-se esperar que mais novos vírus vai ser descoberto em insetos usando essas tecnologias avançadas; Assim, a nossa compreensão da interacção hospedeiro-vírus pode mudar de acordo com 6, 9. Por exemplo, as interacções vírus-hospedeiro são considerados para ser mais complicado do que se pensava anteriormente, porque muitos vírus novos estão a ser definida como parceiros mutualistic em vez de agentes patogénicos rígidas 22. Por exemplo, o DplDNV densovírus mutualística em Dysaphis plantaginea induz a metamorfose e alado aumenta a mobilidade, o que facilita a dispersão do hospedeiro, bem como o vírus 23. Além disso, os vírus mutualistas têm sido descritas com relação à saúde dos mamíferos, a seca e tolerância ao frio das plantas, bem como o impacto de infecções bacterianas 24. Seneca vale vírus-001 é mostrado para mediar a citotoxicidade selectiva para células de tumor neuroendócrino com cancro caracteriza 25. Infecções por vírus da hepatite A suprimir a replicação do vírus da hepatite C e podem conduzir a recuperação do vírus da hepatite C 26. Latência herpesvírus confere proteção simbiótica de infecção bacteriana 27. A glicoproteína do envelope do retrovírus humano endógeno HERV-W induz resistência celular ao vírus da necrose do baço 28. Curvularia vírus tolerância térmica (CThTV) a partir de um endófito de fungos está envolvido na interacção entre mutualística este fungo e um grama de pânico tropicalref "> 29. Por isso, o conhecimento das interacções entre os vírus recém-descobertos e seus hospedeiros deve gerar novas perspectivas sobre sua biologia e gestão. No entanto, os novos vírus, especialmente os vírus secretas exibindo sem sinais óbvios típicos de infecção aguda, tem raramente sido investigada, e precisamos de um gasoduto e protocolos para investigar os impactos dos vírus recém-descobertos em seus hospedeiros.

Anteriormente, relataram a prevalência de um novo monosense densovírus Helicoverpa armigera densovírus (HaDV2) na lagarta do algodão, Helicoverpa armigera, e apresentou evidências de uma relação de mutualismo entre HaDV2 ea lagarta do algodão 30, 31. Neste papel, iremos descrever o protocolo laboratorial para estudar em detalhe a interacção entre HaDV2 e seu hospedeiro lagarta do algodão. O protocolo aqui apresentado também pode ser altamente relevante para os pesquisadores que examinam o role de outros vírus oralmente transmissíveis, especialmente em pragas de lepidópteros.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Construção do HaDV2-livre Cotton lagarta Colony

  1. Traseira algodão lagarta larvas (H. armigera) com uma dieta artificial 32 numa sala de crescimento controlado ou uma câmara de clima artificial a 25 ± 1 ° C, com 14 horas de luz / 10 horas de escuro e 60% de humidade relativa.
  2. Auxiliar de par único acasalamento de traças recém eclosed utilizando uma gaiola de plástico por par (10 cm de altura, a 5 cm de diâmetro) coberto com gaze de algodão para garantir uma boa ventilação e para servir como um substrato para oviposição. Para aumentar a probabilidade de obtenção de uma colónia livre de vírus, utilizar, pelo menos, 30 pares de acasalamentos de par único. Traças de alimentação adultos com uma solução de vitamina 10% de açúcar e 2% 32 embebido numa bola de algodão e reabastecido diariamente.
  3. Como adultos fêmeas depositam seus ovos sobre a gaze de algodão aproximadamente 2 dias pós-acasalamento, mudar a gaze diária. Recolha e manter os ovos de gaze contendo na mesma sala de crescimento (ou Cham clima artificialber) como as mariposas adultas até a eclosão dos ovos.
  4. Imediatamente transferir larvas recém-nascidos para novas placas de 24 poços, com um indivíduo por poço.
  5. Cinco dias após a primeira data de postura de ovos, recolher as traças-mãe e armazená-las em azoto líquido.
    NOTA: Coletar as mariposas 5 dias após a primeira data de postura garante que os pais estão vivos no ponto de coleta e, portanto, evita eventuais impactos do uso de mariposas mortas na precisão extração de DNA.
  6. Isolar o ADN genómico a partir destas amostras utilizando um estojo de extracção de ADN de acordo com as instruções do fabricante.
    1. Amplificar um fragmento de 574 pb do gene da actina com os iniciadores da actina F / R actina (actina F: 5-CATCTACGAGGGTTACGC-3 e actina R: 5-CATCTGTTGGAAGGTGGA-3). Visualizar a reacção em cadeia da polimerase (PCR) utilizando produtos de electroforese em gel de agarose de acordo com protocolos convencionais; a amplificação bem sucedida do gene da actina assegura que o ADN é de boa qualidade.
    2. avaliar tele presença de HaDV2 nas traças pai usando PCR com iniciadores específicos: DVVPF (GGATTGGCCTGGGAAATGAC) e DVVPR (CGTTGTTTTTATATCCGAGG) 31.
  7. Uma vez que um par limpo foi identificado, prole traseira daquele par de reprodução HaDV2 não infectadas único para pelo menos cinco gerações e manter esta como a-HaDV2 livre colónia (NONINF-deformação); a colónia HaDV2-infectados é definido como o INF-deformação.
  8. Para confirmar o estado da infecção HaDV2 no NONINF-deformação (e para excluir o efeito de bactérias ou vírus em desenvolvimento hospedeiro conhecidos), avaliar o estado de infecção por HaDV2, Wolbachia, e H. armigera nucleopolihedrovirus (HaNPV) em oito indivíduos larvas aleatoriamente seleccionadas do NONINF-estirpe utilizando PCR (com iniciadores específicos: DVVPF / DVVPR para HaDV2, NPVF / NPVR para HaNPV, e 81F / 691R para Wolbachia 31, 33).
    NOTA: Sabe-se que alguns vírus pode ser tardent no hospedeiro infectado, com um nível indetectável, mesmo quando se utiliza uma técnica baseada em PCR. tecnologias NGS poderia ser utilizado para confirmar que não há sequências virais estão presentes nas amostras de ADN genómico.

2. Preparação de HaDV2-Fluidos contendo líquidos

NOTA: Mostrámos que a tentativa de purificação das partículas do vírus HaDV2 inibe a sua infectividade e actividade de 31; Portanto, o protocolo seguinte é realizado para atingir a solução HaDV2 infecciosa, filtrando os indivíduos HaDV2-infectados.

  1. Recolha mariposas adultas individualmente e imediatamente armazená-las em azoto líquido.
  2. Completamente moer as traças individuais recolhidos em azoto líquido usando um almofariz e pilão esterilizado. Transferir cerca de 10 ug de detritos para um tubo limpo de 1,5 mL. Transferir o resíduo restante para um novo tubo e armazená-los imediatamente à temperatura de -80 ° C.
  3. Extrair ADN do 10 ug de detritos, following os protocolos fornecidos pelo fabricante. Uma vez que o ADN de traça foi isolado, para verificar HaDV2 utilizando o protocolo, como descrito na etapa 1.6.
  4. De acordo com os resultados obtidos no passo 2.3, dividir o resíduo restante em dois grupos: HaDV2-positivo e HaDV2-negativo, dependendo o seu estado de infecção. Adicionar 1 ml de solução salina tamponada com fosfato (PBS; NaCl 137 mM, KCl 2,7 mM, 8 mM de Na 2 HPO 4, 1,5 mM e KH 2 PO 4, pH 7,5) para cada indivíduo para dissolver completamente os detritos das larvas restante.
  5. Centrifugar o homogenado (a partir do passo 2.4) em 6500 × g durante 15 min a 4 ° C. Filtra-se o líquido sobrenadante com um filtro de membrana de 0,22 um. Recolher os líquidos filtrados (200 uL por tubo) e armazená-los imediatamente à temperatura de -80 ° C.
    NOTA: O filtro de membrana de 0,22 mícrons vai filtrar a maior parte da indesejável partículas, bactérias e fungos. Em primeiro lugar pré-resfriamento a centrífuga a 4 ° C. Realizar todos os protocolos involving a operação de líquido filtrado em gelo para evitar o homogeneizado escureçam e coagulação.

3. Construção do HaDV2-infectados Cotton lagarta Colony

  1. capacidade de transmissão horizontal de HaDV2
    1. Gerar uma curva padrão HaDV2.
      1. Amplificar os fragmentos que contêm os iniciadores (VPF: CTGGTGAGGCGATGGACATG; VPR: TGACAAGATCCAGCGTAGACATC) e sonda (VP-sonda: GCCACCACTAGAGGACCCACCAGATG), que são usados ​​para a quantificação de vírus HaDV2, com os iniciadores de novo (PF: GGACAATGCTGGTGAGGC; PR: AATCCTCTTTGTCCGTTATCTATG). Utilizar o programa seguinte: 30 s a 94 ° C, 30 s a 53 ° C, e 60 s a 72 ° C durante 40 ciclos de PCR numa máquina 31. Adicionar 1 mL de DNA genómico contendo o genoma HaDV2 (passo 2.3) para a reacção de 25 pL de PCR como ADN molde. Clonar os fragmentos amplificados num vector de clonagem de acordo com os protocolos do fabricante.
      2. Calcule o número de cópias deplasmídeos com a seguinte equação: cópias / mL = (N × Um C) / (n x M x 10 9), em que N é um número de Avogadro (6,02 x 10 23 moléculas / mole); C é a concentração em massa de plasmídeos (ng / pl), o qual pode ser medido usando microespectrofotometria; n é o comprimento do plasmídeo recombinante contendo o produto de PCR (5195 pb); e M é o peso molecular de um par de base médio de ADN de cadeia dupla (660 g / mol).
      3. Prepare seis diluições em série de 10 vezes em tubos de microcentrífuga de 1,5 ml, com concentrações de 1,5 x 10 9, 1,5 x 10 8, 1,5 x 10 7, 1,5 x 10 6, 1,5 x 10 5, e de 1,5 × 10 4 número cópia / mL.
      4. Realizar em tempo real da reacção em cadeia da polimerase quantitativa (qPCR), utilizando iniciadores específicos (VPF / VPR) e uma sonda (VP-sonda) para gerar ciclo tridimeShold (CT) valores dos plasmídeos descritos no passo 3.1.1.3. Execute três repetições técnicos independentes e média-los para outros cálculos.
      5. Com base nos resultados acima, gerar uma curva padrão, correlacionando concentrações HaDV2 transformou-log2 para os valores médios relacionados CT.
    2. Quantificar HaDV2 nos fluidos líquidos filtrados.
      1. Pipetar uma amostra de teste de 100 ul de fluido de líquido filtrado (passo 2.6) contendo HaDV2 para extracção de ADN.
      2. Use tempo real, qPCR para obter os valores de Ct para os fluidos líquidos e calcular o número de cópias usando a curva padrão no passo 3.1.1.
    3. Determinar a eficiência de infecção oral com líquidos filtrados HaDV2-infectadas de diferentes concentrações.
      1. Dilui-se o fluido líquido contendo HaDV2 para as seguintes concentrações: 10 8, 10 7, 10 6, número 10 5, 10 4, e 0 cópia / mL.
      2. Espalhar a di artificialet uniformemente em um de 9 cm de diâmetro placa de Petri antes da solidificação. Uniformemente distribuído líquido HaDV2 contendo filtrado (200 uL) para cada concentração na superfície da dieta artificial sólido. Faça isso em um exaustor.
      3. Transferir 100 larvas recém-eclodidos para a dieta artificial contendo HaDV2 numa placa de Petri. Suavemente bater a gaze de algodão (incluindo larvas recém-chocados) para transferir as larvas da gaze a uma folha de papel branco. Bata o papel com cuidado para que a seda larvas rotação e "balão" fora do papel. Use uma pinça esterilizados para tocar a seda e mover as larvas para uma placa de Petri.
      4. Após 48 h, a transferência das larvas com a dieta artificial para placas de 24 poços (um indivíduo por poço).
      5. Traseira as larvas inoculadas com HaDV2 nas concentrações acima para o estágio adulto.
      6. Recolher as traças adultas, extrair o ADN, e detectar HaDV2 usando PCR, tal como descrito na etapa 1.5.
        NOTA: Aqui, obter um 100% taxa de infecção HaDV2 do cobollworms tton usando o 10 8 número de cópias / mL e assim estabelecer a colónia HaDV2-infectadas (INF-tensão).
  2. capacidade de transmissão vertical de HaDV2
    1. Seleccione traças adultas dos NONINF e INF-estirpes para gerar pares individuais de ♀- / ♂-, ♀ + / ♂-, ♀- / ♂ + e ♀ + / ♂ + (+: positivo para a infecção HaDV2; -: negativo para HaDV2 infecção).
    2. Transferir a descendência dos pares acima para placas de 24 poços sem vírus; traseiro para as larvas do terceiro instar.
    3. Extrai-se a DNA a partir de larvas de terceira instar recolhido para usar como molde para determinar a presença de HaDV2, tal como descrito na etapa 1.5.

4. Tecido de distribuição de HaDV2

  1. Para evitar a contaminação a partir de vírus e bactérias, esterilizar os fórceps e tesouras em etanol a 75% três vezes e, em seguida, aquecê-los na chama de uma lâmpada de álcool.
    NOTA: sterilizatio Fórcepsn é necessária quando ocorre contaminação.
  2. Usando uma balança analítica, pesam os tubos vazios que são para ser usados ​​para armazenar os tecidos.
  3. Coloque as traças adultas e larvas de INF-estirpe em gelo durante aproximadamente 5 min.
  4. Dissecar as seguintes tecidos sob um estereomicroscópio em larvas, fêmeas adultas, e os machos adultos em uma placa de Petri limpa contendo tampão PBS.
    1. Para larvas, hemolinfa pipeta e dissecar o intestino anterior, intestino médio, intestino grosso, a gordura do corpo, e os túbulos de Malpighi (Figura 1A). Imediatamente transferir cada tecido para os tubos em azoto líquido.
      1. Fixar as larvas congelado em cystosepiment usando dois pinos de insectos (200 um de diâmetro, 20 mm de comprimento), inserir nas membranas intersegmentares perto da cabeça e o último segmento abdómen (Figura 1A).
      2. Cortar o Proleg no abdómen posterior das larvas para que a hemolinfa as larvas flui para fora. Pipetar a hemolinfa de larvas no prazo de 10 s utilizando um micropipette para evitar o escurecimento e coagulação da hemolinfa.
        NOTA: feniltioureia (50 ug / ml) podem ser misturados numa proporção / vol 01:20 vol com hemolinfa para evitar melanização.
      3. Usando um par de tesouras, fazer uma incisão na cutícula que vão desde o último membrana intersegmental na cabeça. Dissecar todos os tecidos remanescentes sob um estereomicroscópio usando duas pinças; a imagem para cada tecido é mostrado na Figura 1A.
      4. Misturar as amostras de tecido a partir de três indivíduos em conjunto como um replicado.
      5. Para evitar a contaminação dos restantes tecidos com a hemolinfa durante a dissecção, lavar os tecidos dissecados em tampão PBS três vezes. Em seguida, testar o estado HaDV2-infecção de PBS utilizada para a lavagem. Se o tampão de lavagem final é HaDV2-livre, o tecido deve ser limpo de qualquer contaminação com hemolinfa.
    2. Para as fêmeas adultas, dissecar a cabeça (cérebro), os músculos, a gordura do corpo, intestinos, tubos de Malpighi, e do ovário (A Figura 1B) sob um estereomicroscópio em tampão PBS. Para adultos do sexo masculino, dissecar a cabeça (cérebro), os músculos, a gordura do corpo, intestinos, tubos de Malpighi, e testulos (Figura 1C) sob um estereomicroscópio em tampão PBS. Imediatamente transferir cada tecido para os tubos em azoto líquido.
      1. Usando fórceps e tesouras, remover as asas das traças adultas e lavar o corpo restante três vezes para limpar as escalas.
      2. Separe a cabeça, tórax e abdómen com uma tesoura.
      3. Remova o endoskeleton do tórax e recolher o músculo.
      4. Usando fórceps, remover a cutícula do abdómen e dissecar os outros tecidos seguintes Figuras 1B e 1C.
      5. Misturar as amostras de tecido a partir de três indivíduos em conjunto como um replicado. Lavam-se os tecidos dissecados em tampão PBS três vezes.
  5. Pesar os tubos e os tecidos acima quando eles foram congelados e assegurar que o mjumentos de diferentes tecidos são quase iguais.
    Massa (tecidos) = massa (tubos / amostra de tecido) - massa (apenas tubo)
  6. Extrair o ADN a partir destes tecidos e executar qPCR, conforme descrito no passo 3.1.2.
  7. Calcular o número de cópias por cada mg de tecido utilizando a curva padrão gerada no passo 3.1.1. Usar o tulo de vus por unidade de massa para corrigir a polarização amostra causado por qualquer diferença na quantidade de tecido utilizado para a extracção do ADN.
  8. Calcular a percentagem de HaDV2 no tecido específico como se segue: percentagem de HaDV2 para cada tecido = HaDV2 número de cópias por mg de tecido testado / (soma do número de cópias por mg de todos os tecidos).

5. Os bioensaios testar o efeito de HaDV2 sobre Desenvolvimento Anfitrião

  1. Lugar, pelo menos, 100 pupas ou traças adultas emergidas recentemente derivadas da estirpe em NONINF-, uma gaiola de 5 L, de arame de algodão-cobertas de gaze. Após 2 dias, as fêmeas adultas acasaladas vai começar a colocar ovos na gaze de algodão. Coletar e mantera gaze de algodão contendo os ovos; os ovos eclodem em cerca de três dias.
  2. A inoculação das larvas recém-nascido com HaDV2.
    1. Transferir as larvas neonato da NONINF-tensão para a dieta artificial contendo HaDV2 (10 8 número de cópias / mL) para estabelecer o INF-deformação.
    2. Da mesma forma, transferir larvas neonato para a dieta artificial coberto com líquido filtrado HaDV2-livre (passo 2.4) para estabelecer os grupos de controlo (NONINF-deformação). Incluem, pelo menos, 240 larvas em cada tratamento (Figura 2A).
      NOTA: As larvas que são usados ​​para construir o NONINF- e INF-estirpes são derivadas a partir da mesma coorte pai e escotilha, ao mesmo tempo, assegurando o mesmo fundo genético. Certifique-se de que as NONINF- e INF-estirpes são mantidos na mesma câmara climatizada (a 25 ± 1 ° C, com 14 horas de luz / 10 horas de escuro e 60% de humidade relativa) por uma taxa síncrono de desenvolvimento; a taxa pode variar dependendo da temperatura e humidade. Lidar com a deliccomiam larvas suavemente.
  3. Após 48 h, transferem as larvas individualmente para placas de 24 cavidades (uma individuais por poço) (Figura 2B).
    1. número sequencial de cada larva em cada poço e registrar o estágio instar e status de sobrevivência diária.
    2. Cerca de 5 dias mais tarde, quando a dieta artificial se deteriora, transferir simultaneamente estes indivíduos para uma nova placa de 24 poços contendo fresco dieta artificial (Figura 2C).
    3. Pesar as larvas a partir do dia 7 a 11 pós-eclosão usando uma balança analítica com uma precisão de 0,0001 g. Após a pesagem, o retorno individualmente as larvas para a placa de 24 poços.
  4. Após a muda para o quinto instar, após o quarto ecdise (cerca de 10 dias após a eclosão), transferir as larvas para tubos de vidro (altura 10 cm, 2 centímetros de diâmetro) (Figura 2D); quinto instar das larvas também podem ser identificados pela largura da cápsula cabeça (aproximadamente 2,6 mm).
    NOTA: Transferir os indivíduospara o tubo de vidro, ao mesmo tempo em cada dia.
    1. Código cada larva com o seu número de referência original no tubo de vidro com tinta ou marcadores. Grave o estado larval diária; no interior dos tubos de vidro, as larvas pupate após cerca de cinco dias, a fase de pupa dura cerca de 11 dias.
    2. Registre a data pupas e eclosão de cada indivíduo no tubo de vidro. Grave a massa de pupas de 3 dias de idade.
  5. Após a eclosão, colocar um fêmea e um macho em uma única gaiola com sacarose a 10% e solução de vitaminas 2% (Figura 2E). Reabastecer a solução de sacarose a todos os dias. Registre a data da morte de cada traça.
  6. Quando os ovos são colocados, mudar a gaze de algodão diária. Contar o número de ovos imediatamente. Contagem crias recém-eclodidas, enquanto que choquem.
  7. Durante os bioensaios, seleccionar aleatoriamente oito indivíduos para cada tratamento para confirmar o estado de infecção de HaDV2. Extrai-se a ARN total das amostras utilizando o reagente de tripsina comercialseguindo o protocolo do fabricante. Sintetizar a primeira cadeia de cDNA, seguindo o protocolo do fabricante e usá-lo como um modelo para testar se os vírus são transcritos com sucesso.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Progénies dos pais que estavam HaDV2-livre (Figura 3A) foram criados como o NONINF-deformação. Nós com sucesso amplificado o gene da actina utilizando os mesmos moldes de ADN, sugerindo que os moldes de ADN foram de boa qualidade (Figura 3B). Além disso, os seleccionados aleatoriamente oito progénies também estavam livres de HaDV2 (Figura 3C), HaNPV (Figura 3D), e Wolbachia (Figura 3E). Novamente, concluiu-se que as amostras de ADN das progénies foram de boa qualidade, porque uma porção do gene da actina foi amplificado com sucesso para todas as amostras testadas (Figura 3F).

Uma curva padrão que define a relação entre o logaritmo da qualidade do material de partida e os valores de Ct obtidos foi gerada, tal como na Figura 4. Um forte correlação linear (R (Figura 4).

Recém eclodidas foram inoculados com uma curva padrão de ponto de fluidos líquidos HaDV2 utilizando diluições em série de 10 vezes entre 10 4 e 10 8 número de cópias / mL. Obteve-se uma correlação linear entre a frequência de infecção e as concentrações dos fluidos líquidos HaDV2; 10 8 número de cópias / mL produziu% infecção 100 para a lagarta do algodão, mas outras concentrações não (ver também Xu et ai. 31). As frequências de infecção HaDV2 das progénies dos pais com diferentes estados de infecção HaDV2 foram como se segue: 100% para ♀ + / ♂-, 78% para ♀- / ♂ +, e 100% para ♀ + / + ♂ (também ver Xu et ai. 31).

para correct para diferenças individuais no título HaDV2, calculou-se o número de cópias HaDV2 por mg de cada tecido e a percentagem do título total HaDV2 para o tecido específico. Os resultados revelaram que HaDV2 foi distribuído principalmente na gordura corporal (Figura 5; ver também Xu et al 31.). As comparações dos parâmetros da tabela de vida, incluindo os períodos de larvas, pupas, períodos comprimento adulto, e fecundidade, foram mostradas na Tabela 1 (ver também Xu et ai. 31). As massas de larvas e pupas foram como publicado por Xu et al. 31. Os estados de infecção HaDV2 em ambos o NONINF-estirpe e a estirpe-INF foram determinadas por PCR (resultados publicados por Xu et ai. 31).

figura 1
Figura 1. Dissecadas tecidos para (A) Larvas, (B) umFêmea adulta, e (C) um macho adulto. H, cabeça (cérebro); Ele, hemolinfa; FB, gordura corporal; Mt, túbulos de Malpighi; L, intestino; FG, intestino anterior; MG, intestino médio; HG, intestino grosso; Mu, músculos; O, ovário; T, testículo. Por favor clique aqui para ver uma versão maior desta figura.

Figura 2
Figura 2. Processo Bioensaio para determinar os efeitos de HaDV2 na lagarta do algodão. (A) A inoculação das larvas recém nascidos com HaDV2. (B) A transferência dos indivíduos infectados e HaDV2-HaDV2-livres para placas de 24 poços, depois de 48 h. (C) Os tamanhos diferentes de indivíduos infectados e HaDV2--free. (D) Transferência das larvas do quinto instar para novos tubos de vidro (10 cm de altura, dois centímetros de diâmetro). (E) A colocação de umfeminino e um do sexo masculino traça na mesma gaiola para determinar a longevidade dos adultos, a produção de ovos, e a taxa de escotilha. Por favor clique aqui para ver uma versão maior desta figura.

Figura 3
Figura 3. Estado Infecção por HaDV2, HaNPV, ou em colónias Wolbachia HaDV2-infectadas e HaDV2-livres. Estado de infecção HaDV2 nos pais femininos e masculinos (A). Estado de infecção de HaDV2 (C), HaNPV (D), e Wolbachia (E) nas progénies seleccionados aleatoriamente. Para verificar a qualidade de ADN genómico, o gene de manutenção actina também foi amplificado para os pais (B) e progénies (F). Pista M mostra o marcador DL2000 (2000 pb, 1000 pb, 750 pb, 500 pb, 250 pb, umd 100 pb). Pista 1: progenitor feminino. Pista 2: progenitor masculino. Pista 3-10: progénies. Por favor clique aqui para ver uma versão maior desta figura.

Figura 4
Figura 4. As concentrações HaDV2 Curva padrão correlacionando Log 2-transformadas para Valores limite de ciclos (CT). Por favor clique aqui para ver uma versão maior desta figura.

Figura 5
Figura 5. Hospedeiro tecido Distribuição de HaDV2 em Larvas (A), da fêmea adulta (B), e do macho adulto (C) As lagartas do algodão. Percentagem (%) = a proporção de HaDV2 em diferentes tecidos (por mg), tal como descrito in passo 4.7 Os dados foram analisados ​​estatisticamente por análise de variância (ANOVA) e teste de Tukey (larvas: n = 7; adultos machos: n = 6; fêmeas adultas: n = 6). Médias ± SE. Os resultados foram publicados por Xu et al. 31. Por favor clique aqui para ver uma versão maior desta figura.

parâmetros a história de vida HaDV2 + HaDV2- valor t df valor P
período larval (dias) Masculino 16.51 (± 0.72) 16.93 (± 1.21) 4.147 379 <0,001
Fêmea 16.51 (± 0.79) 16,80 (± 1,05) 2.732 312 0,0067
período de pupa (dias) Masculino 13.02 (± 0.68) 13.31 (± 0.69) 4,057 379 <0,001
Fêmea 11.62 (± 0.67) 12.00 (± 0.63) 5.1 312 <0,001
A longevidade do adulto (dias) Masculino 10.69 (± 1.98) 10.93 (± 2.46) 0,915 367 0,36
Fêmea 9,07 (± 1,98) 8,51 (± 1,58) 2.992 367 0,003
Número de ovos produzidos por fêmea 482 (± 174) 403 (± 180) 2.172 93 0,032
Número de eclosões por fêmea 207 (± 108) 143 (± 99) 3.026 93 0,0032

Tabela 1. Parâmetros a história de vida para HaDV2 + e As lagartas HaDV2 de algodão. Teste t de Student é usado para determinar o nível de significância. Médias ± SE são mostrados. Os dados apresentados nesta tabela foram publicado por Xu et al. 31.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Nas últimas poucas décadas, a maioria dos estudos sobre as interacções-virus de insecto têm-se centrado na abelha do mel saúde 34, 35, 36, os vectores de doenças humanas 37, planta vírus 38, e alguns vírus patogénicos de insectos que têm um grande potencial como agentes de controle biológico 39. Pouca atenção tem sido dada ao vírus secretas em insetos, especialmente em pragas de lepidópteros. Aqui, nós apresentamos um protocolo para o estudo das interacções entre um vírus encobertos e seu insecto hospedeiro. A comparação dos parâmetros de tabela de vida para os indivíduos hospedeiras infectadas por vírus e livre de vírus deve idealmente excluir qualquer efeito das diferenças de acolhimento fundo genético. Para estudar o fenótipo viral, diversos estudos anteriores compararam os parâmetros da tabela de vida tanto indivíduos naturalmente infectados ou não infectados da mesma colónia ou indivíduos inoculadospor microinjeção, mas esse esforço é demorado 23, 40. A inoculação oral de lagartas do algodão com HaDV2, descritos aqui, serve como um meio simples e eficaz para analisar fenótipos virais. Este procedimento também garante o mesmo fundo genético para colónias HaDV2-infectadas e não infectadas HaDV2.

inóculo de vírus pode ser preparado de várias maneiras. A purificação de partículas do vírus que utilizam a centrifugação de alta velocidade inibe a infectividade do vírus, resultando em baixa infectividade; daí, o líquido filtrado contendo o vírus foi utilizado para infectar a lagarta do algodão 31 larvas. O facto da membrana de 0,22 mícrons pode filtrar a maior parte dos fungos e as partículas bacterianas de líquido HaDV2 contendo filtrada e que o líquido filtrado HaDV2-livre foi usada como controlo pode excluir o efeito de outros vírus em nossos resultados. No entanto, não podemos excluir a possibilidade de que os resultados de bioensaios poderia umlso ser polarizado por vírus desconhecidos. Assim, partículas HaDV2 com elevada infecciosidade devem, idealmente, ser purificado no futuro, para a obtenção de resultados consistentes.

A concentração de vírus positivamente correlacionados com a infectividade do vírus; daí, estávamos interessados ​​na determinação da concentração HaDV2 que irá produzir infecção% 100. Os nossos resultados mostraram que o 10 número de 8 cópias / mL podia ser utilizado para a inoculação do vírus para obter esta taxa de infecção. Sem dúvida, a correlação entre o título do vírus e a taxa de infecção deve ser estudado para outras interacções vírus-hospedeiro estudados no futuro. Além disso, o título de vírus de cada indivíduo no campo, também devem ser exploradas. Assim, poderíamos então simular o efeito de vírus sobre os indivíduos no campo.

O manuseio suave das larvas delicado durante os primeiros dias depois que chocam é muito importante, porque são facilmente fatalmente danificados. Além disso, a col HaDV2 não infectadasony devem ser mantidos separadamente na estufa para evitar a contaminação HaDV2-a taxa de infecção de HaDV2 foi encontrado ser muito elevada, tanto no campo e no laboratório 31.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Os autores declaram que não têm interesses financeiros concorrentes.

Acknowledgments

Este trabalho foi apoiado pelo Programa Nacional Key Pesquisa Básica da China (No. 2013CB127602) e do Fundo de Ciência para Grupos pesquisa criativa da National Science Foundation da China (No. 31321004).

Materials

Name Company Catalog Number Comments
24-well plate Corning 07-200-740 Multiple suppliers available.
DNA extraction kit TIANGEN DP304-03 Multiple suppliers available.
thermal cycler Veriti; Applied Biosystems 4375786
PBS Corning 21-040-CV
0.22 µm membrane filter Millipore SLGS025NB
pEASY-T Cloning Vector TransGen, Beijing, China CT301-02
Tweezers IDEAL-TEK 2.SA
Premix Ex Taq (Probe qPCR) Takara RR390A
Probes Invitrogen Custom order
Primers Invitrogen Custom order
microspectrophotometry NanoDrop 2000c  Thermo scientific  not available
7500 Real-Time PCR system Applied Biosystems not available
stereomicroscope SZX-16 Olympus not available
sucrose Multiple suppliers available.
vitamin complex Multiple suppliers available.

DOWNLOAD MATERIALS LIST

References

  1. Tang, P., Chiu, C. Metagenomics for the discovery of novel human viruses. Future Microbiol. 5, 177-189 (2010).
  2. Rosario, K., Breitbart, M. Exploring the viral world through metagenomics. Curr. Opin. Virol. 1, 289-297 (2011).
  3. Hugenholtz, P., Tyson, G. W. Microbiology - metagenomics. Nature. 455, 481-483 (2008).
  4. Kristensen, D. M., Mushegian, A. R., Dolja, V. V., Koonin, E. V. New dimensions of the virus world discovered through metagenomics. Trends Microbiol. 18, 11-19 (2010).
  5. Kleiner, M., Hooper, L. V., Duerkop, B. A. Evaluation of methods to purify virus-like particles for metagenomic sequencing of intestinal viromes. BMC Genomics. 16, 7 (2015).
  6. Ho, T., Tzanetakis, I. E. Development of a virus detection and discovery pipeline using next generation sequencing. Virology. 471, 54-60 (2014).
  7. Marx, C. J. Can you sequence ecology? Metagenomics of adaptive diversification. PLoS Biol. 11, e1001487 (2013).
  8. Radford, A. D., et al. Application of next-generation sequencing technologies in virology. J. Gen. Virol. 93, 1853-1868 (2012).
  9. Liu, S. J., Chen, Y. T., Bonning, B. C. RNA virus discovery in insects. Curr. Opin. Insect Sci. 8, 54-61 (2015).
  10. Mokili, J. L., Rohwer, F., Dutilh, B. E. Metagenomics and future perspectives in virus discovery. Curr. Opin. Virol. 2, 63-77 (2012).
  11. Liu, S. J., Vijayendran, D., Bonning, B. C. Next generation sequencing technologies for insect virus discovery. Viruses-Basel. 3, 1849-1869 (2011).
  12. Cook, S., et al. Novel virus discovery and genome reconstruction from field RNA samples reveals highly divergent viruses in Dipteran hosts. PLoS ONE. 8, e80720 (2013).
  13. Webster, C. L., et al. The discovery, distribution, and evolution of viruses associated with Drosophila melanogaster. PLoS Biol. 13, e1002210 (2015).
  14. Granberg, F., et al. Metagenomic detection of viral pathogens in spanish honeybees: co-infection by aphid lethal paralysis, israel acute paralysis and lake sinai viruses. PLoS ONE. 8, e57459 (2013).
  15. Runckel, C., et al. Temporal analysis of the honey bee microbiome reveals four novel viruses and seasonal prevalence of known viruses, Nosema, and Crithidia. PLoS ONE. 6, 20656 (2011).
  16. Cox-Foster, D. L., et al. A metagenomic survey of microbes in honey bee colony collapse disorder. Science. 318, 283-287 (2007).
  17. Chandler, J. A., Liu, R. M., Bennett, S. N. RNA shotgun metagenomic sequencing of northern California (USA) mosquitoes uncovers viruses, bacteria, and fungi. Front. Microbiol. 6, 185 (2015).
  18. Shi, C. Y., et al. A metagenomic survey of viral abundance and diversity in mosquitoes from Hubei province. PLoS ONE. 10, e0129845 (2015).
  19. Nouri, S., Salem, N., Nigg, J. C., Falk, B. W. Diverse array of new viral sequences identified in worldwide populations of the Asian citrus psyllid (Diaphorina citri) using viral metagenomics. J. Virol. 90, 2434-2445 (2016).
  20. Dayaram, A., et al. Identification of diverse circular single-stranded DNA viruses in adult dragonflies and damselflies (Insecta Odonata) of Arizona and Oklahoma, USA. Infect. Genet. Evol. 30, 278-287 (2015).
  21. Jakubowska, A. K., et al. Simultaneous occurrence of covert infections with small RNA viruses in the lepidopteran Spodoptera exigua. J.Invert. Pathol. 121, 56-63 (2014).
  22. Roossinck, M. J. Move over, Bacteria! Viruses make their mark as mutualistic microbial symbionts. J. Virol. 89, 6532-6535 (2015).
  23. Ryabov, E. V., Keane, G., Naish, N., Evered, C., Winstanley, D. Densovirus induces winged morphs in asexual clones of the rosy apple aphid, Dysaphis plantaginea. Proc. Natl. Acad. Sci. USA. 106, 8465-8470 (2009).
  24. Roossinck, M. J. The good viruses: viral mutualistic symbioses. Nat. Rev. Microbiol. 9, 99-108 (2011).
  25. Venkataraman, S., et al. Structure of seneca valley virus-001: an oncolytic picornavirus representing a new genus. Structure. 16, 1555-1561 (2008).
  26. Deterding, K., et al. Hepatitis a virus infection suppresses hepatitis c virus replication and may lead to clearance of hcv. J. Hepatol. 45, 770-778 (2007).
  27. Barton, E. S., et al. Herpesvirus latency confers symbiotic protection from bacterial infection. Nature. 447, 326-329 (2007).
  28. Ponferrada, V. G., Mauck, B. S., Wooley, D. P. The envelope glycoprotein of human endogenous retrovirus herv-w induces cellular resistance to spleen necrosis virus. Arch. Virol. 148, 659-675 (2003).
  29. Márquez, L. M., Redman, R. S., Rodriguez, R. J., Roossinck, M. J. A virus in a fungus in a plant: three-way symbiosis required for thermal tolerance. Science. 315, 513-515 (2007).
  30. Xu, P. J., et al. Complete genome sequence of a monosense densovirus infecting the cotton bollworm, Helicoverpa armigera. J. Virol. 86, 10909-10909 (2012).
  31. Xu, P. J., Liu, Y. Q., Graham, R. I., Wilson, K., Wu, K. M. Densovirus is a mutualistic symbiont of a global crop pest (Helicoverpa armigera) and protects against a baculovirus and Bt biopesticide. PLoS Pathog. 10, e1004490 (2014).
  32. Liang, G. M., Tan, W. J., Guo, Y. Y. An improvement in the technique of artificial rearing cotton bollworm. Plant Protec. 25, 15-17 (1999).
  33. Zhou, W. G., Rousset, F., O'Neill, S. Phylogeny and PCR-based classification of Wolbachia strains using wsp gene sequences. P. Roy. Soc. B-Biol. Sci. 265, 509-515 (1998).
  34. Mondet, F., de Miranda, J. R., Kretzschmar, A., Le Conte, Y., Mercer, A. R. On the front line: quantitative virus dynamics in honeybee (Apis mellifera L.) colonies along a new expansion front of the parasite Varroa destructor. PLoS Pathog. 10, e1004323 (2014).
  35. Chen, Y. P., et al. Israeli acute paralysis virus: epidemiology, pathogenesis and implications for honey bee health. PLoS Pathog. 10, e1004261 (2014).
  36. Hunter, W., et al. Large-scale field application of RNAi technology reducing israeli acute paralysis virus disease in honey bees (Apis mellifera, Hymenoptera: Apidae). PLoS Pathog. 6, e1001160 (2010).
  37. Halstead, S. B. Dengue virus - mosquito interactions. Annu. Rev. Entomol. 53, 273-291 (2008).
  38. Whitfield, A. E., Falk, B. W., Rotenberg, D. Insect vector-mediated transmission of plant viruses. Virology. 479-480, 278-289 (2015).
  39. Moscardi, F. Assessment of the application of baculoviruses for control of Lepidoptera. Annu. Rev. Entomol. 44, 257-289 (1999).
  40. Szelei, J., et al. Susceptibility of North-American and European crickets to Acheta domesticus densovirus (AdDNV) and associated epizootics. J. Invert. Pathol. 106, 394-399 (2011).
Protocolos para investigar a distribuição Host-tecido, de modo Transmissão e Efeito sobre a aptidão do host de um densovírus na lagarta do algodão
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Yang, X., Xu, P., Graham, R. I., Yuan, H., Wu, K. Protocols for Investigating the Host-tissue Distribution, Transmission-mode, and Effect on the Host Fitness of a Densovirus in the Cotton Bollworm. J. Vis. Exp. (122), e55534, doi:10.3791/55534 (2017).More

Yang, X., Xu, P., Graham, R. I., Yuan, H., Wu, K. Protocols for Investigating the Host-tissue Distribution, Transmission-mode, and Effect on the Host Fitness of a Densovirus in the Cotton Bollworm. J. Vis. Exp. (122), e55534, doi:10.3791/55534 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter