Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

Protokoll för att undersöka värdvävnads Distribution, Transmission-mode, och påverkan på värd Fitness av ett Densovirus i Cotton bollworm

doi: 10.3791/55534 Published: April 12, 2017

Summary

Här presenterar vi ett protokoll för att undersöka fördelningen värd-vävnad, transmissionsmod, och effekt på värden lämplighet av en densovirus inom ordningen fjärilar arter, bomulls bollworm. Detta protokoll kan också användas för att studera interaktionen mellan andra oralt överförbara virus och deras insektsvärdar.

Abstract

Många nya virus har upptäckts i djurvärdar som använder nästa generations sekvenseringsteknologier. Tidigare rapporterade vi en mutualistisk virus, Helicoverpa armigera densovirus (HaDV2), i en fjärilsarter art, bomull bollworm, Helicoverpa armigera (Hubner). Här beskriver vi de protokoll som för närvarande används för att studera effekten av HaDV2 på sin värd. Först vi etablera en HaDV2 fritt bomull bollworm koloni från en enda avelspar. Då, vi oralt ympa några nyfödda larver avkomma med HaDV2-innehållande filtrerad vätska att producera två kolonier med samma genetiska bakgrund: en HaDV2-smittade, andra icke infekterade. Ett protokoll för att jämföra livstabellparametrarna (t ex larver, pupal, och vuxna perioder och fruktbarhet) mellan de HaDV2-infekterade och -uninfected individer är också presenteras, liksom protokollen för att bestämma fördelningen värd-vävnader och överföringseffektiviteten hos HaDV2. Dessa protokoll WOULD också vara lämpliga för att undersöka effekterna av andra oralt överförda virus på sina insektsvärdar, fjärils värdar i synnerhet.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Under de senaste årtiondena, har utvecklingen av sekvenseringsteknologi, såsom nästa generations sekvensering (NGS) underlättas upptäckten av många nya DNA och RNA-virus, i synnerhet icke-patogena virus, men också nya isolat av tidigare kända virus 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12. I modellorganism Drosophila melanogaster, har mer än 20 nya partiella virusgenom detekterats med användning metagenomic tekniker 13. Många virala sekvenser, inbegripet nya virus, har också identifierats i andra insekter, såsom honungsbin, mosquitoes, asiatiska citrusbladloppor, sländor, och flera av ordningen fjärilar arter 14, 15, 16, 17, 18, 19, 20, 21.

I framtiden kan det förväntas att fler nya virus kommer att upptäckas hos insekter med hjälp av dessa avancerad teknik; Därför kan vår förståelse av virusvärd interaktion ändras därefter 6, 9. Till exempel är virusvärdinteraktioner anses vara mer komplicerat än man tidigare trott, eftersom många nya virus definieras som mutualistisk partner snarare än strikt patogener 22. Till exempel mutualistisk densovirus DplDNV i Dysaphis plantaginea inducerar bevingade morph och ökar rörligheten, vilket underlättar spridning av värd liksom viruset 23. Dessutom har mutualistisk virus har beskrivits med avseende på däggdjurs hälsa, torka och kyla tolerans av växter, och effekterna av bakterieinfektioner 24. Seneca dal virus-001 visas för att mediera selektiv cytotoxicitet mot tumörceller med neuroendokrin cancer har 25. Hepatit A-virusinfektioner trycka hepatit C-virus-replikation och kan leda till återhämtning från hepatit C-26. Herpesvirus latens ger symbiotiskt skydd mot bakteriell infektion 27. Höljesglykoproteinet av mänsklig endogen retrovirus HERV-W inducerar cellulär resistens mot mjältnekrosvirus 28. Curvularia termisk tolerans virus (CThTV) från en svamp entofyt är involverad i mutualistisk interaktionen mellan denna svamp och en tropisk panik gräsref "> 29. Därför kunskap om samspelet mellan de nyfunna virus och deras värdar ska generera nya perspektiv på deras biologi och förvaltning. De nya virus, särskilt de hemliga virus visar inga tydliga tecken som är typiska för akut infektion, har sällan undersökts, och vi behöver en pipeline och protokoll för att undersöka effekterna av de nyfunna virus på sina värdar.

Tidigare har vi rapporterat förekomsten en ny monosense densovirus Helicoverpa armigera densovirus (HaDV2) i bomulls bollworm, Helicoverpa armigera och presenterade bevis för ett mutualistisk relation mellan HaDV2 och bomulls bollworm 30, 31. I denna uppsats kommer vi att beskriva laboratoriet protokollet för att i detalj studera interaktionen mellan HaDV2 och dess bomulls bollworm värd. Protokollet presenteras här kan också vara mycket relevant för forskare som undersöker role av andra oralt överförbara virus, särskilt i skadedjur av ordningen fjärilar.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Konstruktion av HaDV2 fria Cotton bollworm Colony

  1. Bakre bomull bollworm larver (H. armigera) på en konstgjord diet 32 i en kontrollerad tillväxt rum eller en artificiell klimatkammare vid 25 ± 1 ° C, med 14 h ljus / 10 h mörker och 60% relativ fuktighet.
  2. Stöd enkelpar parning av nyligen eclosed nattfjärilar med hjälp av en plastbur per par (10 cm höjd, 5 cm i diameter) täcktes med gasväv för att säkerställa god ventilation och för att tjäna som en äggläggning substrat. För att öka sannolikheten för att erhålla en virusfri koloni, använder minst 30 par enkelpar parningar. Matnings vuxna nattfjärilar med en 10% socker och 2% vitaminlösning 32 indränkt på en bomullstuss och fylls dagligen.
  3. Som kvinnliga vuxna lägger sina ägg på gasväv ca 2 dagar efter parning, ändra gasväv dagligen. Samla in och bevara gasväv som innehåller ägg i samma tillväxtrummet (eller artificiella klimat chamBER) som vuxna nattfjärilar tills äggen kläcks.
  4. Överför omedelbart nykläckta larver till nya 24-brunnars plattor, med en individ per brunn.
  5. Fem dagar efter den första äggläggning datum, samla modernattfjärilar och förvara dem i flytande kväve.
    OBS: Samla nattfjärilar 5 dagar efter den första ägg värpdagen säkerställer att föräldrarna lever vid tidpunkten för insamling och därför undviker eventuella konsekvenser av att använda döda malar på DNA-extraktion noggrannhet.
  6. Isolera genomiskt DNA från dessa prover med användning av en DNA-extraktion kit enligt tillverkarens instruktioner.
    1. Amplifiera ett 574-bp-fragment av aktin-genen med primrar aktin F / aktin R (aktin F: 5-CATCTACGAGGGTTACGC-3 och aktin R: 5-CATCTGTTGGAAGGTGGA-3). Visualisera polymeraskedjereaktionen (PCR) produkter med hjälp av agarosgelelektrofores enligt standardprotokoll; den framgångsrika amplifieringen av aktin-genen säkerställer att DNA är av god kvalitet.
    2. bedöma than närvaro av HaDV2 i modernattfjärilar med hjälp av PCR med specifika primers: DVVPF (GGATTGGCCTGGGAAATGAC) och DVVPR (CGTTGTTTTTATATCCGAGG) 31.
  7. När väl en ren par har identifierats, bakre avkomma från denna enda HaDV2-oinfekterade avelspar i minst fem generationer och upprätthålla detta som HaDV2 fria koloni (NONINF-stam); den HaDV2-infekterade koloni definieras som INF-stam.
  8. För att bekräfta HaDV2 infektionsstatus i NONINF-stam (och utesluta effekten av kända bakterier eller virus på värd utveckling), utvärdera infektionsstatus för HaDV2, Wolbachia och H. armigera nukleopolyedervirus (HaNPV) i åtta slumpvis utvalda larver individer av NONINF-stam med användning av PCR (med specifika primers: DVVPF / DVVPR för HaDV2, NPVF / NNK för HaNPV och 81f / 691R för Wolbachia 31, 33).
    OBS: Det är känt att vissa virus kan vara för sentnt i den infekterade värden, med en nivå oidentifierbart även när du använder en PCR-baserad teknik. NGS-teknik kan användas för att bekräfta att inga virala sekvenser finns närvarande i de genomiska DNA-prover.

2. Framställning av HaDV2-innehållande vätskeformiga fluider

OBS: Vi har visat att försök till rening av viruspartiklar HaDV2 hämmar deras smittsamhet och aktivitet 31; därför följande protokoll utförs för att uppnå den infektiva HaDV2 lösningen genom filtrering av de HaDV2-infekterade individer.

  1. Samla vuxna nattfjärilar individuellt och omedelbart lagra dem i flytande kväve.
  2. Helt mala de uppsamlade enskilda nattfjärilar i flytande kväve med användning av en steriliserad mortel och mortelstöt. Överföra cirka 10 pg av skräp till ett rent 1,5-ml rör. Överföra den återstående skräp till ett nytt rör och omedelbart lagra dem vid -80 ° C.
  3. Extrahera DNA från 10 | j, g av skräp, follovinge de protokoll som tillhandahålls av tillverkaren. När mal-DNA har isolerats, ta för HaDV2 användning av protokollet, såsom beskrivet i steg 1,6.
  4. Enligt de resultat som erhållits i steg 2,3, dela upp återstående skräp i två grupper: HaDV2-positiva och HaDV2-negativa, beroende på deras infektionsstatus. Lägg 1 ml fosfatbuffrad saltlösning (PBS; 137 mM NaCl, 2,7 mM KCl, 8 mM Na 2 HPO 4, och 1,5 mM KH 2 PO 4; pH 7,5) till varje individ för att fullständigt lösa den återstående larver skräp.
  5. Centrifugera homogenatet (från steg 2,4) vid 6500 x g under 15 min vid 4 ° C. Filtrera den flytande supernatanten med en 0,22-pm membranfilter. Samla de filtrerade vätskorna (200 pl per rör) och omedelbart lagra dem vid -80 ° C.
    OBS: Den 0,22-pm membranfilter kommer att filtrera bort det mesta av den icke önskvärda partiklar, bakterier och svamp. Först förkyla centrifugen till 4 ° C. Utför alla protokoll involving driften av filtrerad vätska på is för att förhindra homogenatet från brunfärgning och koagulering.

3. Konstruktion av HaDV2-infekterade Cotton bollworm Colony

  1. Horisontell överföring förmåga HaDV2
    1. Generera en HaDV2 standardkurva.
      1. Amplifiera fragmenten innehållande primrarna (VPF: CTGGTGAGGCGATGGACATG; VPR: TGACAAGATCCAGCGTAGACATC) och prob (VP-probe: GCCACCACTAGAGGACCCACCAGATG), som används för kvantifiering av HaDV2 virus, med de novo primrar (PF: GGACAATGCTGGTGAGGC; PR: AATCCTCTTTGTCCGTTATCTATG). Använda följande program: 30 s vid 94 ° C, 30 s vid 53 ° C, och 60 s vid 72 ° C under 40 cykler på en PCR-maskin 31. Tillsätt 1 pl av genomiskt DNA innehållande HaDV2 genomet (steg 2,3) till 25-mikroliter PCR-reaktion som templat-DNA. Klona de amplifierade fragmenten in i en kloningsvektor enligt tillverkarens protokoll.
      2. Beräkna antalet kopior avplasmider med hjälp av följande ekvation: kopior / pl = (N A x C) / (n x M x 10 9), där N A är Avogadros tal (6.02 x 10 23 molekyler / mol); C är masskoncentrationen av plasmider (ng / | il), som kan mätas med hjälp av mikrospektrofotometri; n är längden av rekombinant plasmid innehållande PCR-produkten (5195 bp); och M är molekylvikten för en genomsnittlig baspar av dubbelsträngad DNA (660 g / mol).
      3. Framställa sex 10-faldiga serieutspädningar i 1,5-ml mikrocentrifugrör, med koncentrationer av 1,5 x 10 9, 1,5 x 10 8, 1,5 x 10 7, 1,5 x 10 6, 1,5 x 10 5, och 1,5 x 10 4 kopietal / iL.
      4. Utföra realtidskvantitativ polymeraskedjereaktion (qPCR) med användning av specifika primrar (VPF / VPR) och en sond (VP-sond) för att generera cykel threshold (CT) värdena för de plasmider som beskrivits i steg 3.1.1.3. Utför tre oberoende tekniska replikat och i genomsnitt dem för ytterligare beräkningar.
      5. Med användning av de ovanstående resultaten, generera en standardkurva som korrelerar log2-transformerad HaDV2 koncentrationer till de tillhörande medelvärdes CT-värden.
    2. Kvantifiera HaDV2 i de filtrerade vätskeformiga fluider.
      1. Pipettera en 100-ul testprov av filtrerad vätska vätska (steg 2,6) innehållande HaDV2 för DNA-extraktion.
      2. Använd realtid-qPCR att erhålla CT-värdena för flytande vätskor och beräkna antalet kopior med hjälp av standardkurvan i steg 3.1.1.
    3. Bestämma den orala infektionseffektivitet med HaDV2-infekterade filtrerade vätskor med olika koncentrationer.
      1. Utspäda flytande vätska innehållande HaDV2 till följande koncentrationer: 10 8, 10 7, 10 6, 10 5, 10 4, och 0 kopietal / uL.
      2. Sprid artificiella diet jämnt på en 9 cm diameter Petri-skål innan stelning. Jämnt fördelad HaDV2-innehållande filtrerad vätska (200 | il) för varje koncentration på ytan av den fasta artificiell diet. Gör detta i ett dragskåp.
      3. Överföra 100 färsk-kläckta larverna till HaDV2 innehållande artificiell diet i en petriskål. knock försiktigt bomullsgasväv (inklusive nyligen-kläckta larver) för att överföra larver från gasväv till ett ark av vitt papper. Vispa papperet försiktigt så att larverna spin silke och "ballong" utanför papperet. Använd steriliserade pincett röra silke och flytta larverna till en petriskål.
      4. Efter 48 h, överföra larverna på den konstgjorda dieten till 24-brunnars plattor (en individ per brunn).
      5. Bakre larver ympas med HaDV2 på ovanstående koncentrationer till vuxenstadiet.
      6. Samla de vuxna nattfjärilar, extrahera DNA, och detektera HaDV2 med användning av PCR, såsom beskrivs i steg 1,5.
        OBS: Här erhålla en 100% HaDV2 infektion hastighet cotton bollworms som använder 10 8 kopietal / pl och sålunda etablera HaDV2 infekterade koloni (INF-stam).
  2. Vertikal överföring förmåga HaDV2
    1. Utvalda vuxna nattfjärilar från NONINF och INF-stammar för att generera enkel par av ♀- / ♂-, ♀ + / ♂-, ♀- / ♂ + och ♀ + / ♂ + (+: positiv för HaDV2 infektion; -: negativ för HaDV2 infektion).
    2. Överföra avkomman från ovanstående paren till virusfria 24-brunnars plattor; bak larverna till den tredje stadiet.
    3. Extrahera DNA från det uppsamlade tredje stadiet larver som ska användas som mall för att bestämma närvaron av HaDV2, som beskrivs i steg 1,5.

4. Vävnadsfördelning av HaDV2

  1. För att förhindra förorening från virus och bakterier, sterilisera pincett och sax i 75% etanol tre gånger och sedan värma dem i lågan från en alkohol lampa.
    OBS: Tång sterilization är nödvändigt när kontaminering sker.
  2. Med användning av en analytisk våg, väga de tomma hylsorna som skall användas för att lagra vävnaderna.
  3. Placera larver och vuxna nattfjärilar från INF-stam på is under ungefär 5 minuter.
  4. Dissekera följande vävnader under ett stereomikroskop i larver, vuxna kvinnor, och vuxna män i en ren petriskål med PBS-buffert.
    1. För larver, pipett hemolymfa och dissekera foregut, midgut, hindgut, fett-kroppen, och malpighian tubuli (Figur 1A). omedelbart överföra varje vävnad till rören i flytande kväve.
      1. Fixera den frusna larver på cystosepiment användning av två insektspinnar (200 | j, m i diameter, 20 mm i längd), insättning i intersegmental membranen nära huvudet och den sista buken segmentet (Figur 1A).
      2. Skär proleg i den bakre buk larver så att larverna hemolymph rinner ut. Pipett larver hemolymfa inom 10 s med användning av en microPipette att förhindra att bryna och koagulering av hemolymph.
        OBS: fenyltiokarbamid (50 | ig / ml) kunde blandas vid en 01:20 vol / vol-förhållande med hemolymfa att förhindra melanin.
      3. Med användning av en sax, gör ett snitt i nagelband som sträcker sig från den sista intersegmental membranet till huvudet. Dissekera alla återstående vävnader under ett stereomikroskop med användning av två pincett; bilden för varje vävnad visas i figur 1A.
      4. Blanda vävnadsprover från tre individer tillsammans som en replikera.
      5. För att förhindra kontaminering av de återstående vävnader med hemolymfa under dissektionen, tvätta de dissekerade vävnaderna i PBS-buffert tre gånger. Sedan testa HaDV2-infektionsstatus av PBS som används för tvätt. Om den slutliga tvättbufferten är HaDV2-fri, bör vävnaden vara ren från kontaminering med hemolymfa.
    2. För vuxna kvinnor, dissekera huvudet (hjärnan), muskler, fett-kropp, gut, malpighian tubuli och äggstockar (Figur 1B) under ett stereomikroskop i PBS-buffert. För vuxna män, dissekera huvudet (hjärnan), muskler, fett-kropp, gut, malpighian tubuli, och testiklar (figur 1C) under ett stereomikroskop i PBS-buffert. omedelbart överföra varje vävnad till rören i flytande kväve.
      1. Med hjälp av pincett och sax, ta bort vingarna av den vuxna nattfjärilar och tvätta den återstående kroppen tre gånger för att rensa vågen.
      2. Separera huvudet, bröstkorgen och buken med hjälp av sax.
      3. Avlägsna endoskelettet av bröstkorgen och samla muskeln.
      4. Med hjälp av pincett, ta bort nagelbanden av buken och dissekera de andra vävnader följande figurer 1B och 1C.
      5. Blanda vävnadsprover från tre individer tillsammans som en replikera. Tvätta de dissekerade vävnaderna i PBS-buffert tre gånger.
  5. Väg rören och ovanstående vävnaderna när de har varit frysta och se till att måsnor i olika vävnader är nästan lika.
    Massa (vävnader) = massan (rör / vävnadsprov) - massa (endast rör)
  6. Extrahera DNA från dessa vävnader och utför qPCR, som beskrivs i steg 3.1.2.
  7. Beräkna kopieantalet per mg av varje vävnad med användning av standardkurvan som genereras i steg 3.1.1. Använda virustiter per massenhet för att korrigera för provets förspänning som förorsakas av eventuell skillnad i mängden av vävnad som används för DNA-extraktion.
  8. Beräkna den procentuella HaDV2 i den specifika vävnaden som följer: procent av HaDV2 för varje vävnad = HaDV2 kopieantal per mg testad vävnad / (summan av kopietalet per mg alla vävnader).

5. Bioanalyser testa effekten av HaDV2 på Host utveckling

  1. Plats minst 100 puppor eller nyligen uppstått vuxna nattfjärilar härledda från NONINF-stam i ett bomulls-gasväv-täckt, 5-L, wire-mesh bur. Efter 2 dagar kommer parade vuxna kvinnor börjar lägga ägg på gasväv. Samla in och bevaraden bomullsgasväv innehållande äggen; äggen kläcks i cirka tre dagar.
  2. Ympning av nyfödda larver med HaDV2.
    1. Överföra den neonatala larver av NONINF-stammen till den konstgjorda diet innehållande HaDV2 (10 8 kopietal / | il) för att upprätta INF-stam.
    2. På liknande sätt, överföra nyfödda larver till den konstgjorda dieten täckt med HaDV2 fria filtrerade vätskan (steg 2,4) för att upprätta kontrollgrupperna (NONINF-stam). Omfatta minst 240 larver i varje behandling (figur 2A).
      OBS: Larver som används för att konstruera NONINF- och INF-stammar härledda från samma moder kohort och lucka på samma gång, vilket garanterar samma genetiska bakgrund. Se till att de NONINF- och INF-stammar hålls i samma klimatkammare (vid 25 ± 1 ° C, med 14 h ljus / 10 h mörker och 60% relativ fuktighet) under en synkron hastighet av utveckling; hastigheten kan variera beroende på temperatur och fuktighet. Hantera delicåt larver försiktigt.
  3. Efter 48 h, överföra larverna individuellt till 24-brunnars plattor (en enskilda per brunn) (figur 2B).
    1. Sekventiellt nummer varje larv i varje brunn och registrera instar scenen och överlevnad status dagligen.
    2. Cirka 5 dagar senare, när den konstgjorda diet försämras, samtidigt överföra dessa individer till en ny 24-brunnar innehåller färsk artificiell diet (figur 2C).
    3. Väg larverna från dag 7 till 11 efter kläckning med användning av en analytisk våg med en precision av 0,0001 g. Efter vägning, individuellt återgå larverna till 24-brunnsplatta.
  4. Vid ömsat till femte instar efter fjärde ecdysis (cirka tio dagar efter kläckning), överför larverna till glasrör (10 cm höjd, 2 cm i diameter) (Figur 2D); femte instar larver kan också identifieras genom bredden av huvudet kapseln (ca 2,6 mm).
    OBS: Överför individernatill glasröret vid samma tidpunkt varje dag.
    1. Kod varje larv med sin ursprungliga referensnumret på glasröret med användning av färg eller markörer. Anteckna larver status dagligen; i glasrör, kommer larverna förpuppas efter cirka fem dagar, puppor stadium varar ca 11 dagar.
    2. Anteckna puppor och eclosion dag för varje individ i glasröret. Spela massan av 3 dagar gamla puppor.
  5. Efter eclosion, sätta en kvinnlig och en manlig till en enda bur med 10% sackaros och 2% vitaminlösning (Figur 2E). Fyll sackaroslösningen varje dag. Anteckna dödsdatum för varje mal.
  6. När äggen läggs ändrar bomullsgasväv dagligen. Räkna antalet ägg omedelbart. Räkna nykläckta avkomma medan de kläcks.
  7. Under bioanalyser, slumpmässigt välja åtta personer för varje behandling för att bekräfta infektionen status HaDV2. Extrahera totalt RNA av dessa prover med användning kommersiella trypsin reagensenligt tillverkarens protokoll. Syntetisera den första cDNA-strängen genom att följa tillverkarens protokoll och använda den som en mall för att testa om de virus framgångsrikt transkriberas.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Avkommor från föräldrarna som var HaDV2 fria (figur 3A) föddes upp som NONINF-stam. Vi amplifierade framgångsrikt aktingenen med användning av samma DNA-mallar, vilket antyder att de DNA-mallar var av god kvalitet (figur 3B). Dessutom är de slumpmässigt utvalda åtta avkommorna var också fria från HaDV2 (figur 3C), HaNPV (Figur 3D), och Wolbachia (figur 3E). Igen, drog vi slutsatsen att de DNA-prover av avkommorna var av god kvalitet, eftersom en del av aktin-genen amplifierades framgångsrikt för alla testade prover (Figur 3F).

En standardkurva som definierar sambandet mellan log för kvaliteten av utgångsmaterial och de vunnits CT-värden genererades, såsom i figur 4. En stark linjär korrelation (R (Figur 4).

Nyligen kläckta larverna inokulerades med en punkt standardkurva för HaDV2 vätskeformiga fluider med användning av 10-faldiga seriespädningar mellan 10 4 och 10 8 kopietal / uL. Vi erhöll en linjär korrelation mellan infektionsfrekvensen och koncentrationerna av de HaDV2 vätskeformiga fluider; 10 8 kopietal / il gav 100% infektion för bomulls bollworm, men andra koncentrationer inte (se även et al. Xu 31). De HaDV2 infektion frekvenserna för avkommorna från de föräldrar med olika HaDV2 infektionsstatus var som följer: 100% för ♀ + / ♂-, 78% för ♀- / ♂ +, och 100% för ♀ + / ♂ + (se även Xu et al. 31).

till correct för individuella skillnader i HaDV2 titer, beräknade vi HaDV2 kopietal per mg av varje vävnad och den procentuella andelen av den totala HaDV2 titern för den specifika vävnaden. Resultaten avslöjade att HaDV2 huvudsakligen distribuerades i fettkroppen (Figur 5, se även et al Xu 31.). Jämförelser av de livstabellparametrarna, inklusive larv perioder, puppor perioder, vuxna längd och fruktsamhet, visas i tabell 1 (se även Xu et al. 31). Larv och PUPP massorna var såsom publicerad av Xu et al. 31. De HaDV2 infektionsstatus i både NONINF-stammen och INF-stam bestämdes genom PCR (resultat publicerade av et al. Xu 31).

Figur 1
Figur 1. dissekerades Vävnader för (A) Larver, (B) enKvinnlig vuxen, och (C) en vuxen man. H, huvud (hjärnan); Han, hemolymph; FB, fett kroppen; Mt, Malpighian tubuli; G, gut; FG, foregut; MG, midgut; HG, hindgut; Mu, muskler; O, äggstock; T, testikel. Klicka här för att se en större version av denna siffra.

figur 2
Figur 2. Bioassay förfarande för att fastställa effekterna av HaDV2 på Cotton bollworm. (A) Inokulering av den nyligen kläckta larverna med HaDV2. (B) Överföringen av de HaDV2-infekterade och HaDV2-fria individer till 24-brunnsplattor efter 48 timmar. (C) Olika storlekar av HaDV2-infekterade och -fria individer. (D) Överföring av femte larv till nya glasrör (10 cm höjd, 2 cm diameter). (E) Placeringen av enkvinnlig och en manlig mal i samma bur att bestämma vuxen livslängd, äggproduktion, och kläckningsfrekvens. Klicka här för att se en större version av denna siffra.

figur 3
Figur 3. infektionsstatus för HaDV2, HaNPV eller Wolbachia i HaDV2-infekterade och HaDV2 fria kolonierna. HaDV2 infektionsstatus i de kvinnliga och manliga föräldrar (A). Infektionsstatus av HaDV2 (C), HaNPV (D), och Wolbachia (E) i de slumpmässigt utvalda avkommor. Att kontrollera kvaliteten av genomiskt DNA, var housekeepinggen aktin också amplifieras för föräldrarna (B) och avkommor (F). Lane M visar DL2000 markör (2000 bp, 1000 bp, 750 bp, 500 bp, 250 bp, ettd 100 bp). Bana 1: kvinnliga förälder. Spår 2: male förälder. Lane 3-10: avkommor. Klicka här för att se en större version av denna siffra.

figur 4
Figur 4. standardkurvan korrelering Log 2-transformerade HaDV2 Koncentrationer till cykeltröskel (CT) Värden. Klicka här för att se en större version av denna siffra.

figur 5
Figur 5. Värd-vävnads Fördelning av HaDV2 i Larver (A), Vuxen Kvinna (B), och Adult Male (C) Bomulls Bollworms. Procent (%) = förhållandet mellan HaDV2 i olika vävnader (per mg), såsom beskrivits in steg 4,7 Data analyserades statistiskt med användning av variansanalys (ANOVA) och Tukeys test (larver: n = 7; vuxna män: n = 6; vuxna kvinnor: n = 6). Medelvärden ± SE. Resultaten publicerades av Xu et al. 31. Klicka här för att se en större version av denna siffra.

Livshistorie parametrar HaDV2 + HaDV2- t-värde df P-värde
Larver period (dagar) Manlig 16,51 (± 0,72) 16,93 (± 1,21) 4,147 379 <0,001
Kvinna 16,51 (± 0,79) 16,80 (± 1,05) 2,732 312 0,0067
PUPP period (dagar) Manlig 13,02 (± 0,68) 13,31 (± 0,69) 4,057 379 <0,001
Kvinna 11,62 (± 0,67) 12,00 (± 0,63) 5,1 312 <0,001
Livslängd vuxen (dagar) Manlig 10,69 (± 1,98) 10,93 (± 2,46) 0,915 367 0,36
Kvinna 9,07 (± 1,98) 8,51 (± 1,58) 2,992 367 0,003
Antal ägg som produceras per hona 482 (± 174) 403 (± 180) 2,172 93 0,032
Antal kläckningar per hona 207 (± 108) 143 (± 99) 3,026 93 0,0032

Tabell 1. Livshistorie Parametrar för HaDV2 + och HaDV2 bomulls Bollworms. T-test används för att bestämma nivån på betydelse. Medelvärden ± SE visas. Data som presenteras i denna tabell publicerades av Xu et al. 31.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Under de senaste årtiondena har de flesta studier på insektsvirusinteraktioner fokuserat på honungsbiet hälsa 34, 35, 36, vektorer för mänskliga sjukdomar 37, virus växt 38, och vissa insekter patogena virus som har stor potential som biologiska bekämpningsmedel 39. Lite uppmärksamhet har ägnats åt hemliga virus hos insekter, särskilt i skadedjur av ordningen fjärilar. Här presenterar vi ett protokoll för att studera samspelet mellan en hemlig virus och dess värd insekt. En jämförelse av livstabellparametrarna för virusinfekterade och virusfria värd individer bör helst utesluta någon effekt av skillnader i värd genetisk bakgrund. För att studera viral fenotyp har många tidigare studier jämförde livstabellparametrarna för antingen naturligt infekterade eller oinfekterade individer i samma koloni eller individer ympadegenom mikroinjektion, men detta arbete är tidskrävande 23, 40. Den orala inokulering av bomulls bollworms med HaDV2, som beskrivs här, tjänar som ett enkelt och effektivt medel för att analysera virala fenotyper. Detta förfarande säkerställer också samma genetiska bakgrunden till HaDV2-infekterade och HaDV2-oinfekterade kolonier.

Virus inokulat kan beredas på många sätt. Rening av viruspartiklar med användning av höghastighetscentrifugering inhiberar virussmittsamhet, vilket resulterar i låg infektivitet; följaktligen var virusinnehållande filtrerad vätska användes för att infektera bomulls bollworm larver 31. Det faktum att 0,22-pm membran kan filtrera bort de flesta svamp- och bakteriepartiklar från HaDV2-innehållande filtrerad vätska och att HaDV2 fria filtrerade vätskan användes som kontroll kunde utesluta effekten av andra virus på våra resultat. Men vi kan inte utesluta möjligheten att bioassay resultat kan enLSO vara förspänd av oupptäckta virus. Därmed bör HaDV2 partiklar med hög infektivitet idealt renas i framtiden för att erhålla robusta resultat.

Viruskoncentrationen positivt korrelerade med virus smittsamhet; hence, var vi intresserade i att bestämma HaDV2 koncentration som kommer att ge 100% infektion. Våra resultat visade att 10 8 kopietal / pL kunde användas för virusen inokulering för att erhålla denna infektion hastighet. Otvivelaktigt bör studeras sambandet mellan virus titer och infektionsfrekvensen för andra virusvärdinteraktioner studeras i framtiden. Dessutom bör virustitern av varje individ i området också undersökas. Därför kunde vi sedan simulera effekten av virus på individer inom området.

Den milda hanteringen av den känsliga larver under de första dagarna efter att de kläcks är mycket viktigt, eftersom de är lätt dödligt skadade. Dessutom HaDV2-oinfekterade colony bör hållas separat i växthus för att förhindra HaDV2 kontamination-infektionen hastigheten för HaDV2 har befunnits vara mycket hög, både i fält och i laboratoriet 31.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Författarna förklarar att de inte har några konkurrerande ekonomiska intressen.

Acknowledgments

Detta arbete stöddes av National Key Basic Research Program of China (nr 2013CB127602) och Science fonden för Creative forskargrupper National Science Foundation of China (nr 31.321.004).

Materials

Name Company Catalog Number Comments
24-well plate Corning 07-200-740 Multiple suppliers available.
DNA extraction kit TIANGEN DP304-03 Multiple suppliers available.
thermal cycler Veriti; Applied Biosystems 4375786
PBS Corning 21-040-CV
0.22 µm membrane filter Millipore SLGS025NB
pEASY-T Cloning Vector TransGen, Beijing, China CT301-02
Tweezers IDEAL-TEK 2.SA
Premix Ex Taq (Probe qPCR) Takara RR390A
Probes Invitrogen Custom order
Primers Invitrogen Custom order
microspectrophotometry NanoDrop 2000c  Thermo scientific  not available
7500 Real-Time PCR system Applied Biosystems not available
stereomicroscope SZX-16 Olympus not available
sucrose Multiple suppliers available.
vitamin complex Multiple suppliers available.

DOWNLOAD MATERIALS LIST

References

  1. Tang, P., Chiu, C. Metagenomics for the discovery of novel human viruses. Future Microbiol. 5, 177-189 (2010).
  2. Rosario, K., Breitbart, M. Exploring the viral world through metagenomics. Curr. Opin. Virol. 1, 289-297 (2011).
  3. Hugenholtz, P., Tyson, G. W. Microbiology - metagenomics. Nature. 455, 481-483 (2008).
  4. Kristensen, D. M., Mushegian, A. R., Dolja, V. V., Koonin, E. V. New dimensions of the virus world discovered through metagenomics. Trends Microbiol. 18, 11-19 (2010).
  5. Kleiner, M., Hooper, L. V., Duerkop, B. A. Evaluation of methods to purify virus-like particles for metagenomic sequencing of intestinal viromes. BMC Genomics. 16, 7 (2015).
  6. Ho, T., Tzanetakis, I. E. Development of a virus detection and discovery pipeline using next generation sequencing. Virology. 471, 54-60 (2014).
  7. Marx, C. J. Can you sequence ecology? Metagenomics of adaptive diversification. PLoS Biol. 11, e1001487 (2013).
  8. Radford, A. D., et al. Application of next-generation sequencing technologies in virology. J. Gen. Virol. 93, 1853-1868 (2012).
  9. Liu, S. J., Chen, Y. T., Bonning, B. C. RNA virus discovery in insects. Curr. Opin. Insect Sci. 8, 54-61 (2015).
  10. Mokili, J. L., Rohwer, F., Dutilh, B. E. Metagenomics and future perspectives in virus discovery. Curr. Opin. Virol. 2, 63-77 (2012).
  11. Liu, S. J., Vijayendran, D., Bonning, B. C. Next generation sequencing technologies for insect virus discovery. Viruses-Basel. 3, 1849-1869 (2011).
  12. Cook, S., et al. Novel virus discovery and genome reconstruction from field RNA samples reveals highly divergent viruses in Dipteran hosts. PLoS ONE. 8, e80720 (2013).
  13. Webster, C. L., et al. The discovery, distribution, and evolution of viruses associated with Drosophila melanogaster. PLoS Biol. 13, e1002210 (2015).
  14. Granberg, F., et al. Metagenomic detection of viral pathogens in spanish honeybees: co-infection by aphid lethal paralysis, israel acute paralysis and lake sinai viruses. PLoS ONE. 8, e57459 (2013).
  15. Runckel, C., et al. Temporal analysis of the honey bee microbiome reveals four novel viruses and seasonal prevalence of known viruses, Nosema, and Crithidia. PLoS ONE. 6, 20656 (2011).
  16. Cox-Foster, D. L., et al. A metagenomic survey of microbes in honey bee colony collapse disorder. Science. 318, 283-287 (2007).
  17. Chandler, J. A., Liu, R. M., Bennett, S. N. RNA shotgun metagenomic sequencing of northern California (USA) mosquitoes uncovers viruses, bacteria, and fungi. Front. Microbiol. 6, 185 (2015).
  18. Shi, C. Y., et al. A metagenomic survey of viral abundance and diversity in mosquitoes from Hubei province. PLoS ONE. 10, e0129845 (2015).
  19. Nouri, S., Salem, N., Nigg, J. C., Falk, B. W. Diverse array of new viral sequences identified in worldwide populations of the Asian citrus psyllid (Diaphorina citri) using viral metagenomics. J. Virol. 90, 2434-2445 (2016).
  20. Dayaram, A., et al. Identification of diverse circular single-stranded DNA viruses in adult dragonflies and damselflies (Insecta Odonata) of Arizona and Oklahoma, USA. Infect. Genet. Evol. 30, 278-287 (2015).
  21. Jakubowska, A. K., et al. Simultaneous occurrence of covert infections with small RNA viruses in the lepidopteran Spodoptera exigua. J.Invert. Pathol. 121, 56-63 (2014).
  22. Roossinck, M. J. Move over, Bacteria! Viruses make their mark as mutualistic microbial symbionts. J. Virol. 89, 6532-6535 (2015).
  23. Ryabov, E. V., Keane, G., Naish, N., Evered, C., Winstanley, D. Densovirus induces winged morphs in asexual clones of the rosy apple aphid, Dysaphis plantaginea. Proc. Natl. Acad. Sci. USA. 106, 8465-8470 (2009).
  24. Roossinck, M. J. The good viruses: viral mutualistic symbioses. Nat. Rev. Microbiol. 9, 99-108 (2011).
  25. Venkataraman, S., et al. Structure of seneca valley virus-001: an oncolytic picornavirus representing a new genus. Structure. 16, 1555-1561 (2008).
  26. Deterding, K., et al. Hepatitis a virus infection suppresses hepatitis c virus replication and may lead to clearance of hcv. J. Hepatol. 45, 770-778 (2007).
  27. Barton, E. S., et al. Herpesvirus latency confers symbiotic protection from bacterial infection. Nature. 447, 326-329 (2007).
  28. Ponferrada, V. G., Mauck, B. S., Wooley, D. P. The envelope glycoprotein of human endogenous retrovirus herv-w induces cellular resistance to spleen necrosis virus. Arch. Virol. 148, 659-675 (2003).
  29. Márquez, L. M., Redman, R. S., Rodriguez, R. J., Roossinck, M. J. A virus in a fungus in a plant: three-way symbiosis required for thermal tolerance. Science. 315, 513-515 (2007).
  30. Xu, P. J., et al. Complete genome sequence of a monosense densovirus infecting the cotton bollworm, Helicoverpa armigera. J. Virol. 86, 10909-10909 (2012).
  31. Xu, P. J., Liu, Y. Q., Graham, R. I., Wilson, K., Wu, K. M. Densovirus is a mutualistic symbiont of a global crop pest (Helicoverpa armigera) and protects against a baculovirus and Bt biopesticide. PLoS Pathog. 10, e1004490 (2014).
  32. Liang, G. M., Tan, W. J., Guo, Y. Y. An improvement in the technique of artificial rearing cotton bollworm. Plant Protec. 25, 15-17 (1999).
  33. Zhou, W. G., Rousset, F., O'Neill, S. Phylogeny and PCR-based classification of Wolbachia strains using wsp gene sequences. P. Roy. Soc. B-Biol. Sci. 265, 509-515 (1998).
  34. Mondet, F., de Miranda, J. R., Kretzschmar, A., Le Conte, Y., Mercer, A. R. On the front line: quantitative virus dynamics in honeybee (Apis mellifera L.) colonies along a new expansion front of the parasite Varroa destructor. PLoS Pathog. 10, e1004323 (2014).
  35. Chen, Y. P., et al. Israeli acute paralysis virus: epidemiology, pathogenesis and implications for honey bee health. PLoS Pathog. 10, e1004261 (2014).
  36. Hunter, W., et al. Large-scale field application of RNAi technology reducing israeli acute paralysis virus disease in honey bees (Apis mellifera, Hymenoptera: Apidae). PLoS Pathog. 6, e1001160 (2010).
  37. Halstead, S. B. Dengue virus - mosquito interactions. Annu. Rev. Entomol. 53, 273-291 (2008).
  38. Whitfield, A. E., Falk, B. W., Rotenberg, D. Insect vector-mediated transmission of plant viruses. Virology. 479-480, 278-289 (2015).
  39. Moscardi, F. Assessment of the application of baculoviruses for control of Lepidoptera. Annu. Rev. Entomol. 44, 257-289 (1999).
  40. Szelei, J., et al. Susceptibility of North-American and European crickets to Acheta domesticus densovirus (AdDNV) and associated epizootics. J. Invert. Pathol. 106, 394-399 (2011).
Protokoll för att undersöka värdvävnads Distribution, Transmission-mode, och påverkan på värd Fitness av ett Densovirus i Cotton bollworm
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Yang, X., Xu, P., Graham, R. I., Yuan, H., Wu, K. Protocols for Investigating the Host-tissue Distribution, Transmission-mode, and Effect on the Host Fitness of a Densovirus in the Cotton Bollworm. J. Vis. Exp. (122), e55534, doi:10.3791/55534 (2017).More

Yang, X., Xu, P., Graham, R. I., Yuan, H., Wu, K. Protocols for Investigating the Host-tissue Distribution, Transmission-mode, and Effect on the Host Fitness of a Densovirus in the Cotton Bollworm. J. Vis. Exp. (122), e55534, doi:10.3791/55534 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter