Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

بروتوكولات للتحقيق في توزيع الأنسجة المضيف، نقل واسطة، وتأثير ذلك على الرشاقة المضيف من Densovirus في دودة اللوز القطن

doi: 10.3791/55534 Published: April 12, 2017

Summary

هنا، نقدم بروتوكول للتحقيق في توزيع المضيف الأنسجة، واسطة نقل، والتأثير على اللياقة البدنية المضيف لdensovirus ضمن الأنواع حرشفية الأجنحة، ودودة القطن. ويمكن أيضا أن هذا البروتوكول أن تستخدم لدراسة التفاعل بين الفيروسات التي تنتقل عن طريق الفم الأخرى والمضيفين الحشرات بها.

Abstract

وقد تم اكتشاف العديد من الفيروسات الجديدة في تستضيف الحيوانات باستخدام تقنيات التسلسل من الجيل التالي. سابقا، أبلغنا فيروس المنفعة المتبادلة، Helicoverpa armigera densovirus (HaDV2)، في الأنواع حرشفية الأجنحة، ودودة القطن، Helicoverpa armigera (هوبنر). هنا، نحن تصف البروتوكولات التي تستخدم حاليا لدراسة تأثير HaDV2 على مضيفه. أولا، ونحن إنشاء مستعمرة القطن دودة اللوز خال من HaDV2 من زوج تربية واحد. ثم، فإننا تطعيم شفويا بعض ذرية اليرقات حديثي الولادة مع HaDV2 التي تحتوي على السائل التي تمت تصفيتها لإنتاج مستعمرتين مع نفس الخلفية الوراثية: واحد HaDV2 المصابة، والآخر غير مصاب. بروتوكول للمقارنة بين المعلمات جدول الحياة (على سبيل المثال، اليرقات، العذراء، وفترات الكبار والخصوبة) بين وتقدم أيضا الأفراد المصابة HaDV2 و-uninfected، وكذلك البروتوكولات لتحديد التوزيع المضيف الأنسجة وكفاءة انتقال HaDV2. هذه البروتوكولات التعليم الجامعييونيتبول أيضا تكون مناسبة للتحقيق في آثار الفيروسات الأخرى التي تنتقل عن طريق الفم على المضيفين الحشرات، وتستضيف حرشفية الأجنحة على وجه الخصوص.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

في العقود القليلة الماضية، وتطوير تكنولوجيا التسلسل مثل الجيل المقبل من التسلسل (خ ع) سهلت اكتشاف العديد من DNA و RNA الفيروسات الجديدة والفيروسات وخاصة غير مسببة، ولكن أيضا عزلة جديدة من الفيروسات المعروفة سابقا 10، 11، 12. في نموذج حي ذبابة الفاكهة، تم اكتشاف أكثر من 20 جينوم فيروس جزئية جديدة باستخدام تقنيات ميتاجينومية 13. العديد من متواليات الفيروسية، بما في ذلك الفيروسات الجديدة، كما تم التعرف في غيرها من الحشرات، مثل النحل والعسل، ومosquitoes، psyllids الحمضيات الآسيوية، اليعسوب، والأنواع حرشفية الأجنحة متعددة 14 و 15 و 16 و 17 و 18 و 19 و 20 و 21.

في المستقبل، فإنه يمكن توقع أن أكثر الفيروسات رواية سوف يتم اكتشافها في الحشرات باستخدام هذه التقنيات المتقدمة. وبالتالي، لدينا فهم التفاعل فيروس المضيف قد تتغير وفقا ل6 و 9. على سبيل المثال، تعتبر التفاعلات الفيروسات المضيف أن تكون أكثر تعقيدا مما كان يعتقد سابقا، لأنه يتم تعريف العديد من الفيروسات الجديدة كشركاء المنفعة المتبادلة بدلا من مسببات الأمراض صارمة (22). على سبيل المثال، DplDNV densovirus المنفعة المتبادلة في Dysaphis plantaginea الحث على ضعهن المجنح و يزيد التنقل، وتسهيل تشتت المضيفة، وكذلك الفيروس 23. وعلاوة على ذلك، وقد وصفت الفيروسات المنفعة المتبادلة فيما يتعلق بالصحة الثدييات، والجفاف وتحمل البرودة من النباتات، وتأثير الالتهابات البكتيرية (24). يظهر سينيكا ادي فيروس-001 للتوسط سمية الخلايا انتقائية تجاه الخلايا السرطانية مع سرطان الغدد الصم العصبية يضم 25. التهاب الكبد A العدوى بالفيروس قمع تكرار التهاب الكبد الوبائي وقد تؤدي إلى الشفاء من التهاب الكبد C 26. هربس الكمون يمنح الحماية التكافلية من عدوى بكتيرية 27. بروتين سكري مغلف الإنسان الارتجاعي الذاتية هيرفي-W يدفع المقاومة الخلوية لالطحال فيروس نخر 28. ويشارك Curvularia التسامح الحراري فيروس (CThTV) من نابوت داخلي الفطرية في التفاعل المنفعة المتبادلة بين هذه الفطريات والأعشاب الذعر الاستوائيةالمرجع "> 29. وبالتالي، معرفة التفاعلات بين الفيروسات المكتشفة حديثا ومضيفيهم أن يولد وجهات نظر جديدة في علم الأحياء وإدارتها. ومع ذلك، فإن فيروسات جديدة، وخاصة الفيروسات سرية تظهر أي علامات واضحة نموذجية من العدوى الحادة، يكون نادرا تم التحقيق فيها، ونحن بحاجة إلى خطوط الأنابيب وبروتوكولات للتحقيق في آثار الفيروسات المكتشفة حديثا على مضيفيهم.

سابقا، لدينا الإبلاغ عن انتشار جديدة monosense densovirus Helicoverpa armigera densovirus (HaDV2) في دودة اللوز القطن، Helicoverpa armigera، وقدم أدلة على وجود علاقة المنفعة المتبادلة بين HaDV2 ودودة القطن 30 و 31. في هذه الورقة، فإننا سوف تصف البروتوكول مختبر لدراسة بالتفصيل التفاعل بين HaDV2 والمضيف القطن دودة اللوز لها. قد يكون بروتوكول المعروضة هنا أيضا ذات أهمية كبيرة للباحثين دراسة صأوله من الفيروسات الأخرى التي تنتقل عن طريق الفم، وخاصة في الآفات حرشفية الأجنحة.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. بناء HaDV2 خالية القطن دودة اللوز مستعمرة

  1. القطن الخلفية دودة اللوز اليرقات (H. armigera) على النظام الغذائي الاصطناعي 32 في غرفة النمو تسيطر عليها أو غرفة المناخ الاصطناعي في 25 ± 1 ° C، مع 14 ساعة ضوء / 10 ساعة الظلام والرطوبة النسبية 60٪.
  2. مساعدة-زوج واحد التزاوج من العث eclosed حديثا باستخدام قفص البلاستيك لكل زوج (10 سم ارتفاع، 5 سم القطر) مغطاة بشاش القطن لضمان التهوية الجيدة ولتكون بمثابة الركيزة وضع البيض. لزيادة احتمال الحصول على مستعمرة خالية من الفيروسات، واستخدام لا يقل عن 30 زوجا من التزاوج بين زوج واحد. العث تغذية الكبار مع 10٪ من السكر و 2٪ فيتامين حل 32 غارقة على كرة القطن وتتجدد يوميا.
  3. كما الإناث البالغين تضع بيضها على الشاش القطن حوالي 2 يوما بعد التزاوج، تغيير الشاش يوميا. جمع والحفاظ على الشاش التي تحتوي على البيض في غرفة النمو نفسها (أو الاصطناعي شام المناخالبر) مثل العث الكبار حتى يفقس البيض.
  4. على الفور نقل اليرقات حديثة الفقس إلى 24 لوحات جيدا جديدة، مع فرد واحد لكل بئر.
  5. بعد خمسة أيام من تاريخ أول وضع البيض، وجمع الفراشات الأم وتخزينها في النيتروجين السائل.
    ملاحظة: جمع الفراشات بعد 5 أيام من تاريخ أول وضع البيض يضمن أن الآباء والأمهات على قيد الحياة عند نقطة جمع، وبالتالي يتجنب أي آثار المحتملة لاستخدام العث الميت على دقة استخراج الحمض النووي.
  6. عزل الحمض النووي الجيني من هذه العينات باستخدام مجموعة استخراج الحمض النووي وفقا لتعليمات الشركة الصانعة.
    1. تضخيم شظية 574-BP من الجين الأكتين مع الاشعال الأكتين F / R الأكتين (الأكتين F: 5 CATCTACGAGGGTTACGC-3 و الأكتين R: 5 CATCTGTTGGAAGGTGGA-3). تصور سلسلة تفاعل البلمرة (PCR) المنتجات التي تستخدم الاغاروز الكهربائي للهلام وفقا لبروتوكولات موحدة. التضخيم ناجحة من الجينات الأكتين يضمن أن الحمض النووي هو من نوعية جيدة.
    2. تقييم رانه جود HaDV2 في العث الأم باستخدام PCR مع الاشعال محددة: DVVPF (GGATTGGCCTGGGAAATGAC) وDVVPR (CGTTGTTTTTATATCCGAGG) 31.
  7. مرة واحدة وقد تم التعرف على زوج نظيفة، ذرية الخلفي من هذا الزوج تربية المعافين HaDV2-واحد لخمسة أجيال على الأقل والحفاظ على هذا كمستعمرة خالية من HaDV2 (NONINF سلالة)؛ يتم تعريف مستعمرة المصابين HaDV2-كما INF سلالة.
  8. لتأكيد حالة الإصابة HaDV2 في NONINF سلالة (واستبعاد تأثير البكتيريا المعروفة أو فيروسات على التنمية المضيف)، وتقييم حالة عدوى لHaDV2، الولبخية، وH. armigera nucleopolyhedrovirus (HaNPV) في ثمانية أفراد اليرقات تم اختيارها عشوائيا من NONINF سلالة باستخدام PCR (مع الاشعال محددة: DVVPF / DVVPR لHaDV2، NPVF / NPVR لHaNPV، و81F / 691R لالولبخية 31، 33).
    ملاحظة: من المعروف أن بعض الفيروسات يمكن أن يكون في وقت متأخرالإقليم الشمالي في المضيف المصاب، مع مستوى لا يمكن الكشف عنها حتى عند استخدام تقنية PCR القائم. ويمكن استخدام تقنيات NGS لتأكيد أنه لا يوجد تسلسل الفيروسية موجودة في عينات من الحمض النووي الجيني.

2. إعداد HaDV2 التي تحتوي على السائل السوائل

ملاحظة: لقد أظهرنا أن حاول تنقية جزيئات الفيروس HaDV2 يمنع العدوى والنشاط 31؛ وبالتالي، يتم تنفيذ البروتوكول التالي لتحقيق حل HaDV2 عدوى من خلال تصفية الأفراد المصابين HaDV2.

  1. جمع الفراشات الكبار بشكل فردي وعلى الفور تخزينها في النيتروجين السائل.
  2. طحن تماما العث الفردية التي تم جمعها في النيتروجين السائل باستخدام هاون ومدقة تعقيمها. نقل حوالي 10 ميكروغرام من الحطام إلى أنبوب 1.5 مل نظيف. نقل الحطام المتبقي لأنبوب جديد وتخزينها على الفور في -80 ° C.
  3. استخراج الحمض النووي من ميكروغرام 10 من الحطام، واتباعهجناح البروتوكولات المقدمة من قبل الشركة المصنعة. مرة واحدة وقد تم عزل DNA العثة، تحقق من HaDV2 باستخدام بروتوكول، كما هو موضح في الخطوة 1.6.
  4. ووفقا لنتائج التي تم الحصول عليها في الخطوة 2.3، تقسيم الحطام المتبقي إلى مجموعتين: HaDV2 إيجابية وHaDV2 سلبية، وهذا يتوقف على حالة الإصابة بها. إضافة 1 مل من الفوسفات مخزنة المالحة (PBS، 137 مم كلوريد الصوديوم، و 2.7 ملي بوكل، 8 ملي نا 2 هبو و 1.5 ملي KH 2 PO ودرجة الحموضة 7.5) لكل فرد أن يحل تماما الحطام اليرقات المتبقية.
  5. الطرد المركزي جناسة (من الخطوة 2.4) في 6500 × ز لمدة 15 دقيقة على 4 درجات مئوية. تصفية طاف السائل مع فلتر الغشاء 0.22 ميكرون. جمع السوائل التي تمت تصفيتها (200 ميكرولتر في أنبوب) وتخزينها على الفور في -80 ° C.
    ملاحظة: سوف مرشح غشاء 0.22 ميكرون تصفية معظم الجسيمات غير مرغوب فيه، والبكتيريا، والفطريات. precool أول أجهزة الطرد المركزي إلى 4 درجات مئوية. تنفيذ كافة البروتوكولات involviنانوغرام تشغيل السائل التي تمت تصفيتها على الجليد لمنع جناسة من تحول البني والتخثر.

3. بناء المصابين HaDV2 القطن دودة اللوز مستعمرة

  1. قدرة نقل الأفقية HaDV2
    1. توليد منحنى القياسية HaDV2.
      1. تضخيم أجزاء تحتوي على الاشعال (VPF: CTGGTGAGGCGATGGACATG، VPR: TGACAAGATCCAGCGTAGACATC) والتحقيق (VP-التحقيق: GCCACCACTAGAGGACCCACCAGATG)، والتي تستخدم لتقدير حجم الفيروس HaDV2، مع دي نوفو الاشعال (PF: GGACAATGCTGGTGAGGC، PR: AATCCTCTTTGTCCGTTATCTATG). استخدام البرنامج التالي: 30 ثانية في 94 درجة مئوية، 30 ثانية في 53 ° C، و60 ثانية عند 72 درجة مئوية لمدة 40 دورة على جهاز PCR 31. إضافة 1 ميكرولتر من الحمض النووي الجيني الذي يحتوي على جينوم HaDV2 (الخطوة 2.3) إلى رد فعل 25 ميكرولتر PCR كما DNA القالب. استنساخ شظايا تضخيم الى ناقلات الاستنساخ وفقا لبروتوكولات الشركة المصنعة.
      2. حساب عدد نسخة منالبلازميدات مع المعادلة التالية: نسخ / ميكرولتر = (N A × C) / × M × 10 9)، حيث N (أ) هو عدد أفوجادرو (6.02 × 10 23 جزيئات / مول)؛ C هو تركيز كتلة من البلازميدات (نانوغرام / ميكرولتر)، والتي يمكن قياسها باستخدام microspectrophotometry. ن هو طول البلازميد المؤتلف الذي يحتوي على المنتج PCR (5195 سنة مضت). وM هو الوزن الجزيئي للمتوسط الزوج قاعدة DNA المزدوج تقطعت بهم السبل (660 جم / مول).
      3. إعداد ستة التخفيفات المسلسل 10 أضعاف في أنابيب microcentrifuge 1.5 مل، مع تركيزات 1.5 × 10 1.5 × 10 1.5 × 10 7 و 1.5 × 10 1.5 × 10 و 1.5 × 10 4 عدد نسخ / ميكرولتر.
      4. أداء في الوقت الحقيقي البلمرة المتسلسل الكمي رد فعل (QPCR) باستخدام بادئات محددة (VPF / VPR) والتحقيق (VP-التحقيق) لتوليد دورة ثلاث،شولد (CT) قيم البلازميدات هو موضح في الخطوة 3.1.1.3. تنفيذ ثلاث مكررات فنية مستقلة والمتوسط ​​لهم لمزيد من العمليات الحسابية.
      5. استخدام النتائج المذكورة أعلاه، وتوليد منحنى القياسية ربط تركيزات HaDV2-تحولت log2 إلى القيم CT المتوسط ​​ذات الصلة.
    2. تحديد HaDV2 في السوائل السائلة التي تمت تصفيتها.
      1. الماصة اختبار العينة 100 ميكرولتر من السائل السائل المصفى (الخطوة 2.6) تحتوي على HaDV2 لاستخراج الحمض النووي.
      2. استخدام الحقيقي الوقت QPCR للحصول على القيم CT للسوائل السائلة وحساب عدد النسخ باستخدام المنحنى القياسي في الخطوة 3.1.1.
    3. تحديد كفاءة العدوى عن طريق الفم مع السوائل التي تمت تصفيتها المصابين HaDV2 من تركيزات مختلفة.
      1. تمييع السائل السائل يحتوي على HaDV2 إلى التركيزات التالية: 10 10 10 العدد 10 10 و0 نسخ / ميكرولتر.
      2. نشر دي الاصطناعيوآخرون بالتساوي على 9 سم القطر طبق بيتري قبل التصلب. موزعة بالتساوي السائل تحتوي على HaDV2 تصفيتها (200 ميكرولتر) لكل تركيز على السطح من النظام الغذائي الاصطناعي الصلبة. القيام بذلك في غطاء الدخان.
      3. نقل 100 اليرقات الطازجة إلى النظام الغذائي الاصطناعي HaDV2 التي تحتوي في طبق بتري. ضرب بلطف الشاش القطن (بما في ذلك اليرقات طازجة) لنقل اليرقات من الشاش لورقة بيضاء. تغلب على الورق برفق بحيث الحرير اليرقات تدور و "البالون" قبالة الورق. استخدام ملقط معقم للمس الحرير ونقل اليرقات إلى طبق بيتري.
      4. بعد 48 ساعة، ونقل اليرقات على النظام الغذائي الاصطناعي إلى 24 لوحات جيدا (فرد واحد لكل بئر).
      5. الخلفي اليرقات الملقحة مع HaDV2 في تركيزات أعلاه إلى مرحلة البلوغ.
      6. جمع الفراشات الكبار، استخراج DNA، وكشف HaDV2 باستخدام PCR، كما هو موضح في الخطوة 1.5.
        ملاحظة: هنا، للحصول على 100٪ HaDV2 معدل إصابة المشتركدودة tton باستخدام 10 8 نسخة رقم / ميكرولتر وبالتالي تأسيس مستعمرة المصابين HaDV2 (INF سلالة).
  2. القدرة الانتقال الرأسي من HaDV2
    1. اختر العث الكبار من NONINF وINF-سلالات لتوليد أزواج واحدة من ♀- / ♂-، ♀ + / ♂-، ♀- / ♂ + و♀ + / ♂ + (+: إيجابية للعدوى HaDV2؛ -: سلبية ل HaDV2 العدوى).
    2. نقل ذرية من أزواج أعلاه إلى 24 لوحات جيدا خالية من الفيروسات. الخلفي اليرقات إلى الطور الثالث.
    3. استخراج الحمض النووي من جمع يرقات العمر الثالث لاستخدام القالب لتحديد وجود HaDV2، كما هو موضح في الخطوة 1.5.

4. توزيع الأنسجة من HaDV2

  1. لمنع التلوث من الفيروسات والبكتيريا وتعقيم ملقط ومقص في 75٪ من الإيثانول ثلاث مرات ثم تسخينها في لهيب مصباح الكحول.
    ملاحظة: sterilizatio ملقطn غير الضروري عندما يحدث التلوث.
  2. باستخدام ميزان تحليلي، وزن الأنابيب الفارغة التي سيتم استخدامها لتخزين الأنسجة.
  3. وضع اليرقات والكبار العث من INF سلالة على الجليد لمدة حوالي 5 دقائق.
  4. تشريح الأنسجة التالية تحت مجهر تشريحي في اليرقات، الإناث الكبار، والذكور البالغين في طبق بيتري نظيفة تحتوي على العازلة في برنامج تلفزيوني.
    1. ليرقات، الدملمف الماصة وتشريح المعى الأمامي، المعي المتوسط، المعى المؤخر، والدهون الجسم، والأنابيب المالبيغية (الشكل 1A). على الفور نقل كل الأنسجة للأنابيب في النيتروجين السائل.
      1. إصلاح اليرقات المجمدة على cystosepiment باستخدام اثنين من المسامير الحشرات (200 ميكرون في القطر، و 20 ملم في الطول)، إدراج في الأغشية بين القطع بالقرب من الرأس وآخر قطعة البطن (الشكل 1A).
      2. قطع proleg في البطن الخلفي من اليرقات بحيث يتدفق الدملمف اليرقات خارج. ماصة الدملمف اليرقات داخل 10 ثانية باستخدام micropipette لمنع الاحمرار والتخثر من الدملمف.
        ملاحظة: الفنيل (50 ميكروغرام / مل) يمكن أن تكون مختلطة في 1:20 المجلد نسبة / المجلد مع الدملمف لمنع التصبغ.
      3. باستخدام زوج من مقص، وجعل شق في إهاب تتراوح بين الغشاء بين القطع الماضي في الرأس. تشريح جميع الأنسجة المتبقية تحت مجهر تشريحي باستخدام اثنين من ملقط. ويظهر في الصورة لكل الأنسجة في الشكل 1A.
      4. مزيج عينات الأنسجة من ثلاثة أشخاص معا في تكرار واحد.
      5. لمنع التلوث من الأنسجة المتبقية مع الدملمف أثناء تشريح، وغسل الأنسجة تشريح في برنامج تلفزيوني العازلة ثلاث مرات. ثم، اختبار حالة HaDV2 العدوى من PBS تستخدم لغسل. إذا كان المخزن المؤقت غسل النهائي هو HaDV2 خالية، ينبغي أن الأنسجة تكون نظيفة من التلوث مع الدملمف.
    2. لالإناث البالغات، تشريح الرأس (الدماغ)، والعضلات، والدهون الجسم، القناة الهضمية، الأنابيب المالبيغية، والمبيض (الشكل 1B) تحت مجهر تشريحي في العازلة في برنامج تلفزيوني. للذكور البالغين، تشريح الرأس (الدماغ)، والعضلات، والدهون الجسم، القناة الهضمية، الأنابيب المالبيغية، والخصيتين (الشكل 1C) تحت مجهر تشريحي في العازلة في برنامج تلفزيوني. على الفور نقل كل الأنسجة للأنابيب في النيتروجين السائل.
      1. باستخدام ملقط ومقص، وإزالة أجنحة الفراشات الكبار وغسل الجسم المتبقي ثلاث مرات لمسح المقاييس.
      2. فصل الرأس والصدر، والبطن باستخدام مقص.
      3. إزالة هيكل داخلي من القفص الصدري وجمع العضلات.
      4. باستخدام ملقط، إزالة بشرة البطن وتشريح الأنسجة الأخرى التالية أرقام 1B و1C.
      5. مزيج من عينات الأنسجة من ثلاثة أشخاص معا في تكرار واحد. غسل الأنسجة تشريح في برنامج تلفزيوني العازلة ثلاث مرات.
  5. وزن الأنابيب والأنسجة المذكورة أعلاه عندما جمدت والتأكد من أن مالحمير من الأنسجة المختلفة متساوية تقريبا.
    كتلة (الأنسجة) = كتلة (أنابيب / عينة الأنسجة) - كتلة (أنبوب فقط)
  6. استخراج الحمض النووي من هذه الأنسجة وأداء QPCR، كما هو موضح في الخطوة 3.1.2.
  7. حساب عدد نسخة لكل ملغ من كل الأنسجة باستخدام المنحنى القياسي إنشاؤه في الخطوة 3.1.1. استخدام عيار الفيروس لكل وحدة كتلة لتصحيح التحيز عينة الناجمة عن أي اختلاف في كمية الأنسجة المستخدمة لاستخراج الحمض النووي.
  8. حساب النسبة المئوية من HaDV2 في الأنسجة محددة على النحو التالي: النسبة المئوية للHaDV2 لكل الأنسجة = HaDV2 نسخ العدد لكل ملغ من اختبار النسيج / (مجموع عدد نسخة لكل ملغ من جميع الأنسجة).

5. اختبارات بيولوجية اختبار تأثير من HaDV2 للتنمية المضيف

  1. مكان لا يقل عن 100 الشرانق أو العث الكبار ظهرت حديثا المستمدة من NONINF سلالة في، قفص مغطى القطن الشاش-5-L، سلك شبكة. بعد 2 يوما، وسوف الإناث البالغات تزاوج تبدأ في وضع البيض على الشاش القطن. جمع وصيانةالشاش القطن التي تحتوي على البيض. سوف يفقس البيض في حوالي ثلاثة أيام.
  2. تلقيح اليرقات الوليد مع HaDV2.
    1. نقل اليرقات الوليد من NONINF سلالة إلى النظام الغذائي الاصطناعي تحتوي على HaDV2 (10 8 نسخة رقم / ميكرولتر) لإنشاء INF سلالة.
    2. وبالمثل، نقل حديثي الولادة يرقات إلى النظام الغذائي الاصطناعي مغطاة السائل المصفى HaDV2 خالية (الخطوة 2.4) لإنشاء مجموعات المراقبة (NONINF سلالة). تشمل ما لا يقل عن 240 اليرقات في كل معاملة (الشكل 2A).
      ملاحظة: اليرقات التي تستخدم لبناء NONINF- وINF-سلالات مستمدة من نفس الفوج الأم ويفقس في نفس الوقت، وضمان نفس الخلفية الوراثية. تأكد من أن يتم الاحتفاظ NONINF- وINF-السلالات في نفس الغرفة المناخ (عند 25 ± 1 ° C، مع 14 ساعة ضوء / 10 ساعة الظلام و 60٪ الرطوبة النسبية) لمعدل متزامن للتنمية؛ معدل يمكن أن تختلف تبعا لدرجة الحرارة والرطوبة. التعامل مع ديليتشأكل يرقات بلطف.
  3. بعد 48 ساعة، ونقل اليرقات بشكل فردي إلى 24 لوحات جيدا (فرد واحد لكل بئر) (الشكل 2B).
    1. عدد بالتتابع كل يرقة في كل بئر وتسجل مرحلة الطور ووضع البقاء على قيد الحياة اليومية.
    2. بعد حوالي 5 أيام، عندما تدهور النظام الغذائي الاصطناعي، ونقل في وقت واحد هؤلاء الأفراد إلى 24 لوحة جيدا جديدة تحتوي على نظام غذائي الاصطناعي الطازجة (الشكل 2C).
    3. وزن اليرقات من يوم 7 إلى 11 بعد فتحة باستخدام الميزان التحليلي لدقة 0.0001 ز. بعد وزنها، والعودة بشكل فردي اليرقات إلى 24 لوحة جيدا.
  4. على طرح الريش إلى الطور الخامس بعد انسلاخ الرابع (حوالي عشرة أيام بعد الفقس)، ونقل اليرقات إلى أنابيب زجاجية (10 سم ارتفاع، 2 سم القطر) (الشكل 2D). ويمكن أيضا الكشف عن هويته الخامسة يرقات العمر قبل عرض الكبسولة الرأس (حوالي 2.6 مم).
    ملاحظة: نقل الأفرادإلى أنبوب زجاجي في نفس الوقت كل يوم.
    1. الرمز في كل يرقة مع رقمه المرجعي الأصلي على أنبوب الزجاج باستخدام الطلاء أو علامات. تسجيل حالة اليرقات يوميا؛ في أنابيب زجاجية، فإن اليرقات تخدر تصبح خادرة بعد حوالي خمسة أيام مرحلة الشرانق تستغرق حوالي 11 يوما.
    2. تسجيل الشرانق وeclosion تاريخ لكل فرد في أنبوب زجاجي. تسجيل كتلة الشرانق القديم لمدة 3 أيام.
  5. بعد eclosion، وضعت امرأة واحدة ورجل واحد في قفص واحد مع 10٪ سكروز وحل فيتامين 2٪ (الشكل 2E). تجديد محلول السكروز كل يوم. تسجيل تاريخ وفاة لكل العثة.
  6. عندما وضعت البيض، وتغيير الشاش القطن يوميا. حساب عدد البيض على الفور. عدد الأبناء فقست حديثا في حين تفقس.
  7. خلال اختبارات بيولوجية، باختيار عشوائي ثمانية أفراد لكل معاملة لتأكيد حالة إصابة HaDV2. استخراج الحمض النووي الريبي مجموع هذه العينات باستخدام كاشف التربسين التجاريبعد بروتوكول الشركة المصنعة. توليف [كدنا أول حبلا التالية بروتوكول الشركة المصنعة واستخدامه كنموذج لاختبار ما إذا كان يتم نسخه الفيروسات بنجاح.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

وقد تربى السلالات من الآباء والأمهات التي كانت خالية من HaDV2 (الشكل 3A) كما NONINF سلالة. نحن تضخيم بنجاح الجين الأكتين باستخدام نفس القوالب DNA، مما يشير إلى أن القوالب DNA كانت ذات نوعية جيدة (الشكل 3B). وبالإضافة إلى ذلك، فإن تم اختيارها عشوائيا ثمانية السلالات خالية من HaDV2 (الشكل 3C)، HaNPV (الشكل 3D)، والولبخية (الشكل 3E) أيضا. مرة أخرى، استنتجنا أن عينات DNA من السلالات كانت من نوعية جيدة، لأنه جزء من الجينات الأكتين تم تضخيم بنجاح لجميع العينات المختبرة (الشكل 3F).

تم إنشاء منحنى قياسي تحديد العلاقة بين السجل من نوعية المواد ابتداء والقيم CT المكتسبة، كما في الشكل (4). وهناك ارتباط خطي قوي (R (الشكل 4).

حديثا تم تلقيح اليرقات مع المنحنى القياسي نقطة HaDV2 السوائل السائلة باستخدام التخفيفات المسلسل 10 أضعاف ما بين 10 و 10 4 8 نسخة رقم / ميكرولتر. حصلنا على علاقة خطية بين تردد العدوى وتركيزات السوائل السائلة HaDV2. 10 8 عدد نسخ / أسفرت عن إصابة ميكرولتر 100٪ لدودة اللوز القطن، ولكن تركيزات الأخرى لم (انظر أيضا شو وآخرون. 31). وكانت الترددات العدوى HaDV2 من السلالات من الآباء والأمهات مع مختلف الحالات العدوى HaDV2 على النحو التالي: 100٪ لل♀ + / ♂-، و 78٪ ل♀- / ♂ +، و 100٪ لل♀ + / ♂ + (انظر أيضا شو وآخرون 31).

لجorrect الفروق الفردية في عيار HaDV2، حسبنا عدد النسخ HaDV2 في ملغ من كل الأنسجة والنسبة المئوية من إجمالي عيار HaDV2 للأنسجة محددة. وكشفت النتائج أن HaDV2 وقد وزعت بشكل رئيسي في الدهون في الجسم (الشكل 5؛ انظر أيضا شو وآخرون 31). وقد أظهرت المقارنات من المعلمات جدول الحياة، بما في ذلك فترات اليرقات، وفترات الشرانق، طول الكبار، والخصوبة، في الجدول 1 (انظر أيضا شو وآخرون. 31). وكانت الجماهير اليرقات والعذارى والتي نشرتها شو وآخرون. 31. تم تحديد الحالات العدوى HaDV2 في كل من NONINF سلالة وINF سلالة بواسطة PCR (النتائج التي نشرتها شو وآخرون. 31).

شكل 1
الشكل 1. تشريح الأنسجة ل(A) يرقات، (B) لالكبار للإناث، و (C) وذكر الكبار. H، الرأس (الدماغ)؛ و، الدملمف. FB، الدهون في الجسم. طن متري، الأنابيب مالبيغي. G، القناة الهضمية. FG، المعى الأمامي. MG، المعي المتوسط. HG، المعى المؤخر. مو والعضلات. O، المبيض. T، الخصية. الرجاء انقر هنا لمشاهدة نسخة أكبر من هذا الرقم.

الشكل 2
الشكل 2. إجراء الأحيائي لتحديد آثار HaDV2 على دودة اللوز القطن. (A) التلقيح من اليرقات حديثا مع HaDV2. (B) نقل الأفراد المصابة HaDV2 وHaDV2 خالية إلى 24 لوحات جيدا بعد 48 ساعة. (C) مختلفة الأحجام من الأفراد المصابة HaDV2 وخالية. (D) نقل يرقات الطور الخامس لأنابيب زجاجية جديدة (10 سم ارتفاع، 2 سم القطر). (E) ووضع واحدالإناث والذكور فراشة واحدة في نفس القفص لتحديد طول العمر البالغين، إنتاج البيض، ونسبة فقس. الرجاء انقر هنا لمشاهدة نسخة أكبر من هذا الرقم.

الشكل (3)
الشكل 3. الحالة العدوى لHaDV2، HaNPV، أو الولبخية في المستعمرات المصابة HaDV2 وHaDV2 خالية. HaDV2 حالة عدوى في الآباء والأمهات من الإناث والذكور (A). حالة عدوى من HaDV2 (C)، HaNPV (D)، والولبخية (E) في السلالات تم اختيارها عشوائيا. للتحقق من نوعية الحمض النووي الجيني، تم تضخيم الأكتين التدبير المنزلي الجينات أيضا للوالدين (B) والسلالات (F). حارة M يظهر علامة DL2000 (2000 بي بي، بي بي 1000، 750 سنة مضت، و 500 نقطة أساس و 250 نقطة أساس، لد 100 سنة مضت). حارة 1: الأم الإناث. 2 لين: الأم الذكور. لين 3-10: السلالات. الرجاء انقر هنا لمشاهدة نسخة أكبر من هذا الرقم.

الشكل (4)
الشكل 4. المعيار منحنى ربط دخول 2-تحويل HaDV2 تركيزات لدورة عتبة (CT) القيم. الرجاء انقر هنا لمشاهدة نسخة أكبر من هذا الرقم.

الرقم 5
الشكل 5. توزيع الأنسجة المضيف من HaDV2 في يرقات (A)، الكبار أنثى (B)، والذكور البالغين (C) القطن ديدان اللوز. النسبة المئوية (٪) = نسبة HaDV2 في الأنسجة المختلفة (لكل ملغ)، كما هو موضح ط(:؛ الذكور البالغين ن = 7: يرقات ن = 6؛ الإناث البالغات: ن = 6) تم تحليل ن خطوة 4.7 البيانات إحصائيا باستخدام تحليل التباين (ANOVA) واختبار توكي لل. يعني ± SE. ونشرت النتائج وفقا لشو وآخرون. 31. الرجاء انقر هنا لمشاهدة نسخة أكبر من هذا الرقم.

المعلمات الحياة التاريخ HaDV2 + HaDV2- قيمة ر مدافع قيمة P
فترة اليرقات (أيام) الذكر 16.51 (± 0.72) 16.93 (± 1.21) 4.147 379 <0.001
إناثا 16.51 (± 0.79) 16.80 (± 1.05) 2.732 312 0.0067
فترة العذراء (أيام) الذكر 13.02 (± 0.68) 13.31 (± 0.69) 4.057 379 <0.001
إناثا 11.62 (± 0.67) 12.00 (± 0.63) 5.1 312 <0.001
طول العمر من الكبار (أيام) الذكر 10.69 (± 1.98) 10.93 (± 2.46) 0.915 367 0.36
إناثا 9.07 (± 1.98) 8.51 (± 1.58) 2.992 367 0.003
عدد البويضات المنتجة لكل أنثى 482 (± 174) 403 (± 180) 2.172 93 0.032
عدد hatchings لكل أنثى 207 (± 108) 143 (± 99) 3.026 93 0.0032

الجدول 1. معلمات الحياة التاريخ لHaDV2 + وديدان اللوز HaDV2 القطن. ويستخدم الطالب اختبار t لتحديد مستوى الدلالة. يعني ترد ± SE. ونشرت البيانات الواردة في هذا الجدول من قبل شو وآخرون. 31.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

في العقود القليلة الماضية، ركزت معظم الدراسات على التفاعلات الحشرات الفيروسات على الصحة عسل النحل 34، 35، 36، ناقلات الأمراض للإنسان 37، مصنع الفيروسات 38، وبعض الفيروسات المسببة للأمراض الحشرات التي لديها إمكانات كبيرة كما عوامل المكافحة البيولوجية 39. تم دفع القليل من الاهتمام للفيروسات سرية في الحشرات، وخاصة في الآفات حرشفية الأجنحة. هنا، نقدم بروتوكول لدراسة التفاعلات بين فيروس السري والحشرات المضيفة لها. مقارنة بين المعلمات جدول الحياة للأفراد المضيفة المصابة بالفيروسات وخالية من الفيروسات يجب أن تستبعد بشكل مثالي أي تأثير الاختلافات في الخلفية الوراثية المضيفة. لدراسة النمط الظاهري الفيروسي، وقارن العديد من الدراسات السابقة المعلمات الجدول حياة الأفراد المصابين إما طبيعيا أو غير مصاب في نفس مستعمرة أو الأفراد تلقيحبواسطة حقن مكروي، ولكن هذا الجهد هو مضيعة للوقت 23، 40. التلقيح عن طريق الفم من دودة القطن مع HaDV2، الموصوفة هنا، بمثابة وسيلة بسيطة وفعالة لتحليل الظواهر الفيروسية. كما يضمن هذا الإجراء الخلفية الوراثية نفسها للمستعمرات المصابة HaDV2 وغير مصاب HaDV2.

قيحة الفيروس يمكن أن تكون على استعداد في نواح كثيرة. تنقية جزيئات الفيروس باستخدام عالية السرعة الطرد المركزي يمنع العدوى بالفيروس، مما أدى إلى العدوى منخفضة؛ وبالتالي، كان يستخدم السائل التي تمت تصفيتها التي تحتوي على الفيروس تصيب القطن دودة اللوز يرقات 31. والحقيقة أن الغشاء 0.22 ميكرون يمكن تصفية معظم الفطرية والبكتيرية الجزيئات من السائل تحتوي على HaDV2 تصفيتها والتي كانت تستخدم لتصفية السائل HaDV2 خالية مثل السيطرة قد استبعاد تأثير الفيروسات الأخرى على نتائجنا. ومع ذلك، لا يمكننا استبعاد احتمال أن نتائج الأحيائي يمكن ليكون متحيزا ليسوتو عن طريق الفيروسات غير المكتشفة. وبالتالي، والجسيمات HaDV2 مع العدوى عالية ينبغي من الناحية المثالية أن تنقيته في المستقبل للحصول على نتائج قوية.

تركيز الفيروس ارتباطا إيجابيا مع العدوى بالفيروس. وبالتالي، نحن مهتمون في تحديد تركيز HaDV2 من شأنها أن تسفر عن إصابة 100٪. وأظهرت النتائج التي توصلنا إليها 10 عدد 8 نسخ / ميكرولتر يمكن أن تستخدم للتلقيح الفيروسات للحصول على هذا معدل الإصابة. مما لا شك فيه، فإن العلاقة بين عيار الفيروس ومعدل الإصابة ينبغي دراسة للتفاعل الفيروس المضيفة الأخرى دراستها في المستقبل. وبالإضافة إلى ذلك، ينبغي أيضا استكشاف عيار الفيروس من كل فرد في هذا المجال. ومن هنا، يمكننا ثم محاكاة تأثير الفيروسات على الأفراد في هذا المجال.

التعامل مع طيف من اليرقات الحساسة خلال الأيام القليلة الأولى بعد أن يفقس مهم جدا، لأنهم بسهولة التالفة قاتلة. وعلاوة على ذلك، العقيد المعافين HaDV2-بنيويورك يجب أن تبقى منفصلة في الاحتباس الحراري لمنع التلوث HaDV2-معدل إصابة HaDV2 تم العثور على أن تكون مرتفعة للغاية، سواء في الميدان أو في المختبر 31.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

الكتاب تعلن أنه ليس لديهم مصالح مالية المتنافسة.

Acknowledgments

وأيد هذا العمل من قبل البرنامج الوطني مفتاح الأساسي بحوث الصين (رقم 2013CB127602) وصندوق العلوم للالمجموعات البحثية الإبداعية من مؤسسة العلوم الوطنية الصينية (رقم 31321004).

Materials

Name Company Catalog Number Comments
24-well plate Corning 07-200-740 Multiple suppliers available.
DNA extraction kit TIANGEN DP304-03 Multiple suppliers available.
thermal cycler Veriti; Applied Biosystems 4375786
PBS Corning 21-040-CV
0.22 µm membrane filter Millipore SLGS025NB
pEASY-T Cloning Vector TransGen, Beijing, China CT301-02
Tweezers IDEAL-TEK 2.SA
Premix Ex Taq (Probe qPCR) Takara RR390A
Probes Invitrogen Custom order
Primers Invitrogen Custom order
microspectrophotometry NanoDrop 2000c  Thermo scientific  not available
7500 Real-Time PCR system Applied Biosystems not available
stereomicroscope SZX-16 Olympus not available
sucrose Multiple suppliers available.
vitamin complex Multiple suppliers available.

DOWNLOAD MATERIALS LIST

References

  1. Tang, P., Chiu, C. Metagenomics for the discovery of novel human viruses. Future Microbiol. 5, 177-189 (2010).
  2. Rosario, K., Breitbart, M. Exploring the viral world through metagenomics. Curr. Opin. Virol. 1, 289-297 (2011).
  3. Hugenholtz, P., Tyson, G. W. Microbiology - metagenomics. Nature. 455, 481-483 (2008).
  4. Kristensen, D. M., Mushegian, A. R., Dolja, V. V., Koonin, E. V. New dimensions of the virus world discovered through metagenomics. Trends Microbiol. 18, 11-19 (2010).
  5. Kleiner, M., Hooper, L. V., Duerkop, B. A. Evaluation of methods to purify virus-like particles for metagenomic sequencing of intestinal viromes. BMC Genomics. 16, 7 (2015).
  6. Ho, T., Tzanetakis, I. E. Development of a virus detection and discovery pipeline using next generation sequencing. Virology. 471, 54-60 (2014).
  7. Marx, C. J. Can you sequence ecology? Metagenomics of adaptive diversification. PLoS Biol. 11, e1001487 (2013).
  8. Radford, A. D., et al. Application of next-generation sequencing technologies in virology. J. Gen. Virol. 93, 1853-1868 (2012).
  9. Liu, S. J., Chen, Y. T., Bonning, B. C. RNA virus discovery in insects. Curr. Opin. Insect Sci. 8, 54-61 (2015).
  10. Mokili, J. L., Rohwer, F., Dutilh, B. E. Metagenomics and future perspectives in virus discovery. Curr. Opin. Virol. 2, 63-77 (2012).
  11. Liu, S. J., Vijayendran, D., Bonning, B. C. Next generation sequencing technologies for insect virus discovery. Viruses-Basel. 3, 1849-1869 (2011).
  12. Cook, S., et al. Novel virus discovery and genome reconstruction from field RNA samples reveals highly divergent viruses in Dipteran hosts. PLoS ONE. 8, e80720 (2013).
  13. Webster, C. L., et al. The discovery, distribution, and evolution of viruses associated with Drosophila melanogaster. PLoS Biol. 13, e1002210 (2015).
  14. Granberg, F., et al. Metagenomic detection of viral pathogens in spanish honeybees: co-infection by aphid lethal paralysis, israel acute paralysis and lake sinai viruses. PLoS ONE. 8, e57459 (2013).
  15. Runckel, C., et al. Temporal analysis of the honey bee microbiome reveals four novel viruses and seasonal prevalence of known viruses, Nosema, and Crithidia. PLoS ONE. 6, 20656 (2011).
  16. Cox-Foster, D. L., et al. A metagenomic survey of microbes in honey bee colony collapse disorder. Science. 318, 283-287 (2007).
  17. Chandler, J. A., Liu, R. M., Bennett, S. N. RNA shotgun metagenomic sequencing of northern California (USA) mosquitoes uncovers viruses, bacteria, and fungi. Front. Microbiol. 6, 185 (2015).
  18. Shi, C. Y., et al. A metagenomic survey of viral abundance and diversity in mosquitoes from Hubei province. PLoS ONE. 10, e0129845 (2015).
  19. Nouri, S., Salem, N., Nigg, J. C., Falk, B. W. Diverse array of new viral sequences identified in worldwide populations of the Asian citrus psyllid (Diaphorina citri) using viral metagenomics. J. Virol. 90, 2434-2445 (2016).
  20. Dayaram, A., et al. Identification of diverse circular single-stranded DNA viruses in adult dragonflies and damselflies (Insecta Odonata) of Arizona and Oklahoma, USA. Infect. Genet. Evol. 30, 278-287 (2015).
  21. Jakubowska, A. K., et al. Simultaneous occurrence of covert infections with small RNA viruses in the lepidopteran Spodoptera exigua. J.Invert. Pathol. 121, 56-63 (2014).
  22. Roossinck, M. J. Move over, Bacteria! Viruses make their mark as mutualistic microbial symbionts. J. Virol. 89, 6532-6535 (2015).
  23. Ryabov, E. V., Keane, G., Naish, N., Evered, C., Winstanley, D. Densovirus induces winged morphs in asexual clones of the rosy apple aphid, Dysaphis plantaginea. Proc. Natl. Acad. Sci. USA. 106, 8465-8470 (2009).
  24. Roossinck, M. J. The good viruses: viral mutualistic symbioses. Nat. Rev. Microbiol. 9, 99-108 (2011).
  25. Venkataraman, S., et al. Structure of seneca valley virus-001: an oncolytic picornavirus representing a new genus. Structure. 16, 1555-1561 (2008).
  26. Deterding, K., et al. Hepatitis a virus infection suppresses hepatitis c virus replication and may lead to clearance of hcv. J. Hepatol. 45, 770-778 (2007).
  27. Barton, E. S., et al. Herpesvirus latency confers symbiotic protection from bacterial infection. Nature. 447, 326-329 (2007).
  28. Ponferrada, V. G., Mauck, B. S., Wooley, D. P. The envelope glycoprotein of human endogenous retrovirus herv-w induces cellular resistance to spleen necrosis virus. Arch. Virol. 148, 659-675 (2003).
  29. Márquez, L. M., Redman, R. S., Rodriguez, R. J., Roossinck, M. J. A virus in a fungus in a plant: three-way symbiosis required for thermal tolerance. Science. 315, 513-515 (2007).
  30. Xu, P. J., et al. Complete genome sequence of a monosense densovirus infecting the cotton bollworm, Helicoverpa armigera. J. Virol. 86, 10909-10909 (2012).
  31. Xu, P. J., Liu, Y. Q., Graham, R. I., Wilson, K., Wu, K. M. Densovirus is a mutualistic symbiont of a global crop pest (Helicoverpa armigera) and protects against a baculovirus and Bt biopesticide. PLoS Pathog. 10, e1004490 (2014).
  32. Liang, G. M., Tan, W. J., Guo, Y. Y. An improvement in the technique of artificial rearing cotton bollworm. Plant Protec. 25, 15-17 (1999).
  33. Zhou, W. G., Rousset, F., O'Neill, S. Phylogeny and PCR-based classification of Wolbachia strains using wsp gene sequences. P. Roy. Soc. B-Biol. Sci. 265, 509-515 (1998).
  34. Mondet, F., de Miranda, J. R., Kretzschmar, A., Le Conte, Y., Mercer, A. R. On the front line: quantitative virus dynamics in honeybee (Apis mellifera L.) colonies along a new expansion front of the parasite Varroa destructor. PLoS Pathog. 10, e1004323 (2014).
  35. Chen, Y. P., et al. Israeli acute paralysis virus: epidemiology, pathogenesis and implications for honey bee health. PLoS Pathog. 10, e1004261 (2014).
  36. Hunter, W., et al. Large-scale field application of RNAi technology reducing israeli acute paralysis virus disease in honey bees (Apis mellifera, Hymenoptera: Apidae). PLoS Pathog. 6, e1001160 (2010).
  37. Halstead, S. B. Dengue virus - mosquito interactions. Annu. Rev. Entomol. 53, 273-291 (2008).
  38. Whitfield, A. E., Falk, B. W., Rotenberg, D. Insect vector-mediated transmission of plant viruses. Virology. 479-480, 278-289 (2015).
  39. Moscardi, F. Assessment of the application of baculoviruses for control of Lepidoptera. Annu. Rev. Entomol. 44, 257-289 (1999).
  40. Szelei, J., et al. Susceptibility of North-American and European crickets to Acheta domesticus densovirus (AdDNV) and associated epizootics. J. Invert. Pathol. 106, 394-399 (2011).
بروتوكولات للتحقيق في توزيع الأنسجة المضيف، نقل واسطة، وتأثير ذلك على الرشاقة المضيف من Densovirus في دودة اللوز القطن
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Yang, X., Xu, P., Graham, R. I., Yuan, H., Wu, K. Protocols for Investigating the Host-tissue Distribution, Transmission-mode, and Effect on the Host Fitness of a Densovirus in the Cotton Bollworm. J. Vis. Exp. (122), e55534, doi:10.3791/55534 (2017).More

Yang, X., Xu, P., Graham, R. I., Yuan, H., Wu, K. Protocols for Investigating the Host-tissue Distribution, Transmission-mode, and Effect on the Host Fitness of a Densovirus in the Cotton Bollworm. J. Vis. Exp. (122), e55534, doi:10.3791/55534 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter