Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

Protokoller til Undersøgelse af Host-væv Distribution, Transmission-tilstand, og Effekt på Host Fitness af en densovirus i bomuldsfrøkapselorm

doi: 10.3791/55534 Published: April 12, 2017

Summary

Her præsenterer vi en protokol til at undersøge vært-væv distribution, transmission tilstand og effekt på værten egnethed af en densovirus inden for sommerfugle arter, den bomuldsfrøkapselorm. Denne protokol kan også anvendes til undersøgelse af interaktionen mellem andre oralt overførte vira og deres insekt værter.

Abstract

Mange nye vira er blevet opdaget i animalske værter ved hjælp af næste generation sekventering teknologier. Tidligere har vi rapporteret en mutualistisk virus, Helicoverpa armigera densovirus (HaDV2), i en sommerfugle arter, den bomuldsfrøkapselorm, Helicoverpa armigera (Hubner). Her beskriver vi de protokoller, der i øjeblikket anvendes til at undersøge effekten af ​​HaDV2 på sin vært. Først, vi etablere en HaDV2-fri bomuldsfrøkapselorm koloni fra et enkelt ynglende par. Derefter, vi oralt pode nogle nyfødte larve afkom med HaDV2-holdig filtrerede væske at frembringe to kolonier med samme genetiske baggrund: en HaDV2-smittet, anden ikke-inficerede. En protokol til at sammenligne livet tabelparametrene (fx larvestadiet, puppe og voksne perioder og frugtbarhed) mellem HaDV2-inficerede og -uninfected individer ligeledes vist, som er protokollerne for bestemmelse af værten-vævsfordeling og sendeeffektivitet HaDV2. Disse protokoller WOuld også være egnet til at undersøge virkningerne af andre oralt overførte virus på deres insekt værter, lepidoptera værter i særdeleshed.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

I de seneste årtier har udviklingen af sekventering teknologi såsom næste generation sekventering (NGS) lettet opdagelsen af mange hidtil ukendte DNA og RNA-vira, især ikke-patogene vira, men også hidtil ukendte isolater af tidligere kendte virus 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12. I modelorganismen Drosophila melanogaster er der påvist mere end 20 nye partielle virusgenomer anvendelse metagenomisk teknikker 13. Mange virale sekvenser, herunder hidtil ukendte vira, er også blevet identificeret i andre insekter, såsom honningbier mosquitoes, asiatiske citrus psyllids, guldsmede, og flere lepidoptera arter 14, 15, 16, 17, 18, 19, 20, 21.

I fremtiden kan det forventes, at flere nye virus vil blive opdaget i insekter ved hjælp af disse avancerede teknologier; derfor kan vores forståelse af virus-vært interaktion ændres tilsvarende 6, 9. For eksempel er virus-værtssammenspil anses for at være mere kompliceret end hidtil antaget, fordi mange hidtil ukendte vira defineres som mutualistic partnere snarere end strenge patogener 22. For eksempel mutualistisk densovirus DplDNV i Dysaphis plantaginea inducerer vingede morph og øger mobiliteten, lette spredning af værten samt virus 23. Desuden har mutualistic vira blevet beskrevet med hensyn til pattedyr sundhed, tørke og kulde tolerance af planter, og virkningen af bakterieinfektioner 24. Seneca dal virus-001 er vist at mediere selektiv cytotoksicitet i retning tumorceller med neuroendokrin kræft features 25. Hepatitis A virus infektioner undertrykke hepatitis C-virus-replikation og kan føre til bedring fra hepatitis C 26. Herpesvirus latens bibringer symbiotisk beskyttelse mod bakterieinfektion 27. Kappeglycoproteinet af human endogen retrovirus HERV-W inducerer cellulær resistens over for miltnekrosevirus 28. Curvularia termisk tolerance virus (CThTV) fra en fungal endofyt er involveret i mutualistisk interaktionen mellem denne svamp og et tropisk panik græsref "> 29. Derfor kendskab til samspillet mellem de nyligt fundne vira og deres værter skal generere nye perspektiver på deres biologi og ledelse. Men den nye virus, især de hemmelige virus viser ingen tydelige tegn typiske for akut infektion, har sjældent været undersøgt, og vi har brug for en rørledning og protokoller til at undersøge virkningerne af de nyligt fundne virus på deres værter.

Vi har tidligere rapporteret forekomsten af en ny monosense densovirus Helicoverpa armigera densovirus (HaDV2) i bomuldsfrøkapselorm, Helicoverpa armigera, og præsenterede beviser på en mutualistisk forhold mellem HaDV2 og bomuldsfrøkapselorm 30, 31. I dette papir vil vi beskrive laboratorieprotokol at studere i detaljer interaktionen mellem HaDV2 og dens bomuldsfrøkapselorm vært. Protokollen præsenteres her, kan også være yderst relevante for forskere undersøger role andre oralt overførte vira, især i skadelige sommerfugle.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Konstruktion af HaDV2-fri bomuldsfrøkapselorm Colony

  1. Bageste bomuldsfrøkapselorm larver (H. armigera) på en kunstig diæt 32 på kontrolleret vækst rum eller et kunstigt klimakammer ved 25 ± 1 ° C, med 14 h lys / 10 timer mørke og 60% relativ fugtighed.
  2. Sag single-pair parring af nyligt eclosed møl ved anvendelse af et plastbur per par (10 cm højde, 5 cm i diameter), dækket med bomuldsgaze at sikre god ventilation og at tjene som en oviposition substrat. For at forøge sandsynligheden for at opnå en virus-fri koloni, udnytte mindst 30 par enkelt-pair parringer. Foder voksne møl med en 10% sukker og 2% vitaminopløsning 32 gennemvædet på et stykke vat og genopfyldes dagligt.
  3. Som kvindelige voksne lægger deres æg på bomuldsgaze ca. 2 dage efter parring, ændre gaze dagligt. Indsamler og opbevarer gaze indeholdende æg i samme vækstrummet (eller kunstig klima chamber) som de voksne møl indtil æggene udklækkes.
  4. overdrage nyklækkede larver til nye plader med 24 brønde, med et individ pr brønd.
  5. Fem dage efter den første æglægning dato, indsamle forælder møl og gemme dem i flydende nitrogen.
    BEMÆRK: Indsamling møl 5 dage efter den første æglægning dato sikrer, at forældrene er i live på tidspunktet for indsamling og undgår derfor eventuelle konsekvenser af at anvende døde møl på DNA-ekstraktion nøjagtighed.
  6. Isolere genomisk DNA fra disse prøver ved anvendelse af et DNA ekstraktionskit ifølge producentens anvisninger.
    1. Amplificere et 574 bp fragment af actin-genet med primerne actin F / actin R (actin F: 5-CATCTACGAGGGTTACGC-3 og actin R: 5-CATCTGTTGGAAGGTGGA-3). Visualisere polymerasekædereaktionen (PCR) produkter ved hjælp af agarosegelelektroforese ifølge standardprotokoller; den vellykkede amplifikation af actin-genet sikrer, at DNA'et er af god kvalitet.
    2. vurdere than tilstedeværelse af HaDV2 i de stiftende møl anvendelse af PCR med specifikke primere: DVVPF (GGATTGGCCTGGGAAATGAC) og DVVPR (CGTTGTTTTTATATCCGAGG) 31.
  7. Når en ren par er blevet identificeret, bageste afkom fra denne ene HaDV2-uinficerede ynglende par i mindst fem generationer og opretholde dette som HaDV2-fri koloni (NONINF-stamme); den HaDV2-inficerede koloni defineres som INF-stamme.
  8. For at bekræfte infektionen status HaDV2 i NONINF-stammen (og udelukke effekten af kendte bakterier eller virus på vært udvikling), evaluere status infektion for HaDV2, Wolbachia, og H. armigera nucleopolyhedrovirus (HaNPV) i otte tilfældigt udvalgte larver individer af NONINF-stamme under anvendelse af PCR (med specifikke primere: DVVPF / DVVPR for HaDV2, NPVF / NPVR for HaNPV, og 81F / 691R for Wolbachia 31, 33).
    BEMÆRK: Det er kendt, at nogle vira kunne være sentnt i den inficerede vært, med et niveau målbart selv når du bruger en PCR-baseret teknik. NGS teknologier kan anvendes til at bekræfte, at der ikke virale sekvenser er til stede i de genomiske DNA-prøver.

2. Fremstilling af HaDV2 væske Væsker

BEMÆRK: Vi har vist, at den forsøgte oprensning af HaDV2 viruspartikler hæmmer deres infektivitet og aktivitet 31; Derfor er den følgende protokol udført for at opnå den infektiøse HaDV2 opløsning ved filtrering af HaDV2-inficerede individer.

  1. Indsamle voksne møl individuelt og straks gemme dem i flydende nitrogen.
  2. Helt slibe de opsamlede individuelle møl i flydende nitrogen ved anvendelse af en steriliseret morter og støder. Overfør ca. 10 ug affald til en ren 1,5-ml rør. Overfør det resterende affald til et nyt rør og straks opbevares ved -80 ° C.
  3. Uddrag DNA fra 10 ug snavs, følgenfløj protokollerne leveret af producenten. Når møl-DNA er blevet isoleret, tjekke for HaDV2 under anvendelse af protokollen, som beskrevet i trin 1.6.
  4. Ifølge resultaterne opnået i trin 2.3, opdele resterende snavs i to grupper: HaDV2-positive og HaDV2-negativ, afhængigt af deres infektion status. Tilsæt 1 ml phosphatbufret saltvand (PBS; 137 mM NaCl, 2,7 mM KCI, 8 mM Na2HPO 4, og 1,5 mM KH 2PO 4, pH 7,5) til hver enkelt til fuldstændig opløsning af resterende larvernes debris.
  5. Centrifuge homogenatet (fra trin 2.4) ved 6.500 x g i 15 minutter ved 4 ° C. Filtrere den flydende supernatant med et 0,22 um membranfilter. Indsamle de filtrerede væsker (200 uL pr rør) og straks opbevares ved -80 ° C.
    BEMÆRK: 0,22-pm membranfilter vil frafiltrere det meste af det uønskede partikler, bakterier og svampe. Først forkøling centrifugen til 4 ° C. Udfør alle protokoller involving driften af ​​filtrerede væske på is for at forhindre homogenatet dreje brun og koagulering.

3. Konstruktion af den HaDV2-inficerede bomuldsfrøkapselorm Colony

  1. Vandret transmission evne HaDV2
    1. Generere en HaDV2 standardkurve.
      1. Opformere fragmenterne indeholdende primere (VPF: CTGGTGAGGCGATGGACATG; VPR: TGACAAGATCCAGCGTAGACATC) og probe (VP-probe: GCCACCACTAGAGGACCCACCAGATG), som anvendes til kvantificering af HaDV2 virus, med de novo primere (PF: GGACAATGCTGGTGAGGC; PR: AATCCTCTTTGTCCGTTATCTATG). Brug følgende program: 30 sekunder ved 94 ° C, 30 sekunder ved 53 ° C og 60 s ved 72 ° C i 40 cykler på en PCR-maskine 31. Tilsæt 1 pi af genomisk DNA indeholdende HaDV2 genom (trin 2.3) til 25-pi PCR-reaktion som template-DNA. Klone amplificerede fragmenter i en kloningsvektor ifølge producentens protokoller.
      2. Beregn antal kopier afplasmider med den følgende ligning: kopier / pi = (N A × C) / (n × M × 10 9), hvor N A er Avogadros tal (6,02 × 10 23 molekyler / mol); C er massekoncentrationen af plasmider (ng / pi), som kan måles ved mikrospektrofotometri; n er længden af rekombinant plasmid indeholdende PCR-produktet (5.195 bp); og M er molekylvægten af en gennemsnitlig basepar af dobbeltstrenget DNA (660 g / mol).
      3. Forberede seks 10-foldige seriefortyndinger i 1,5 ml-mikrocentrifugerør, med koncentrationer på 1,5 × 10 9, 1,5 x 10 8, 1,5 x 10 7, 1,5 x 10 6, 1,5 x 10 5 og 1,5 x 10 4 kopiantal / uL.
      4. Udføre real-time kvantitativ polymerasekædereaktion (qPCR) under anvendelse af specifikke primere (VPF / VPR) og en probe (VP-sonde) til at generere cyklus threerstatningen (CT) for de beskrevne plasmider i trin 3.1.1.3. Udfør tre uafhængige tekniske gentagelser og gennemsnittet dem til yderligere beregninger.
      5. Ved anvendelse af ovenstående resultater, at danne en standardkurve korrelerer log2-transformerede HaDV2 koncentrationer til de tilhørende midlede CT-værdier.
    2. Kvantificere HaDV2 i de filtrerede flydende væsker.
      1. Pipetter en 100 pi testprøve af filtrerede væske væske (trin 2.6) indeholdende HaDV2 til DNA-ekstraktion.
      2. Bruge realtid-qPCR at opnå CT-værdierne for de flydende fluider og beregne kopitallet ved hjælp af standardkurven i trin 3.1.1.
    3. Bestemme den orale infektionseffektivitet med HaDV2-inficerede filtrerede væsker med forskellige koncentrationer.
      1. Fortynde flydende væske indeholdende HaDV2 til følgende koncentrationer: 10 8, 10 7, 10 6, 10 5, 10 4, og 0 kopiantal / pl.
      2. Spred den kunstige diet jævnt på en 9 cm diameter petriskål før størkning. Jævnt fordelt HaDV2-indeholdende filtrerede væske (200 pi) for hver koncentration på overfladen af ​​den faste kunstigt foder. Gør dette i et stinkskab.
      3. Overfør 100 frisk klækkede larver til HaDV2-holdige kunstig kost i en petriskål. banke forsigtigt bomuldsgaze (herunder frisk-klækkede larver) at overføre larverne fra gaze til et ark hvidt papir. Pisk papiret let, så larverne spin-silke og "ballon" off papiret. Brug steriliserede pincet til at røre ved silke og flytte larverne til en petriskål.
      4. Efter 48 timer, overføres larverne på den kunstige kost til plader med 24 brønde (et individ pr brønd).
      5. Bageste larverne podet med HaDV2 ved de ovennævnte koncentrationer til voksne stadium.
      6. Indsamle de voksne møl, ekstrahere DNA og påvise HaDV2 anvendelse af PCR, som beskrevet i trin 1.5.
        BEMÆRK: Her opnå en 100% HaDV2 infektion sats af cotton bollworms hjælp af 10 8 kopiantal / pi og dermed fastslå HaDV2-inficerede koloni (INF-stamme).
  2. Vertikal overførsel evne HaDV2
    1. Vælg voksne møl fra NONINF og INF-stammer til at generere enkelt par af ♀- / ♂-, ♀ + / ♂-, ♀- / ♂ + og ♀ + / ♂ + (+: positiv for HaDV2 infektion; -: negativ for HaDV2 infektion).
    2. Overfør afkommet fra ovennævnte par til virusfri 24-brønds plader; bageste larverne til den tredie stadium.
    3. Ekstrahere DNA fra den opsamlede tredje stadie larver skal bruges som skabelon til at bestemme tilstedeværelsen af ​​HaDV2, som beskrevet i trin 1.5.

4. Vævsfordeling af HaDV2

  1. At forhindre forurening fra virus og bakterier, sterilisere pincet og saks i 75% ethanol tre gange og derefter opvarme dem i flammen af ​​en alkohol lampe.
    BEMÆRK: Tang sterilization er nødvendig, når der forekommer forurening.
  2. Ved hjælp af en analysevægt, vejer de tomme rør, der skal bruges til at gemme væv.
  3. Placer larver og voksne møl fra INF-stammen på is i ca. 5 min.
  4. Dissekere følgende væv under et stereomikroskop i larver, voksne hunner, og voksne hanner i en ren petriskål indeholdende PBS-buffer.
    1. For larver, pipette hæmolymfe og dissekere fortarm, midttarm, bagtarm, fedt-organ, og Malpighian tubuli (figur 1A). overdrage hvert væv til rørene i flydende nitrogen.
      1. Fastsætte den frosne larver på cystosepiment anvendelse af to insekt stifter (200 um i diameter, 20 mm i længde), indsættelse i intersegmental membraner nær hovedet og den sidste maven segment (figur 1A).
      2. Skær proleg i den bageste del af maven af ​​larverne, så larverne hæmolymfe strømmer ud. Pipette larve hæmolymfe inden 10 s under anvendelse af en microPipette at forhindre brunfarvning og koagulerende af hemolymph.
        BEMÆRK: phenylthiourinstof (50 ug / ml) kunne blandes ved 1:20 volumen / volumen-forhold med hæmolymfe at forhindre melanin.
      3. Ved anvendelse af en saks, foretage et snit i overhuden i området fra den sidste intersegmental membran til hovedet. Dissekere alle resterende væv under et stereomikroskop ved hjælp af to tænger; billedet for hvert væv er vist i figur 1A.
      4. Bland vævsprøver fra tre individer sammen som én gentagelse.
      5. At forebygge forurening af de resterende væv med hæmolymfen under dissektion, vaske dissekerede væv i PBS-buffer tre gange. Derefter teste HaDV2-infektion status PBS anvendes til vask. Hvis den endelige vaskepuffer er HaDV2-fri, bør vævet være ren fra kontaminering med hæmolymfe.
    2. For voksne hunner, dissekere hovedet (hjernen), muskler, fedt-krop, tarm, Malpighian tubuli, og æggestok (Figur 1 B) under et stereomikroskop i PBS-buffer. For voksne mænd, dissekere hovedet (hjernen), muskler, fedt-organ, tarmen, Malpighian tubuli, og testikler (figur 1C) under et stereomikroskop i PBS-buffer. overdrage hvert væv til rørene i flydende nitrogen.
      1. Ved hjælp af pincet og saks, fjerne vinger de voksne møl og vask den resterende krop tre gange for at rydde vægten.
      2. Adskil hovedet, brystkasse, og maven med en saks.
      3. Fjern endoskelettet af brystkassen og indsamle musklen.
      4. Med pincet, fjern kutikula af maven og dissekere de andre væv følgende figurer 1B og 1C.
      5. Bland vævsprøver fra tre individer sammen som én gentagelse. Vask de dissekerede væv i PBS-buffer tre gange.
  5. Afvej rørene og de ovennævnte væv, når de er blevet frosset og sikre, at mæsler i de forskellige væv er næsten ens.
    Masse (væv) = masse (rør / vævsprøve) - masse (rør kun)
  6. Ekstrahere DNA fra disse væv og udføre qPCR, som beskrevet i trin 3.1.2.
  7. Beregne kopitallet per mg hvert væv ved hjælp af standardkurven frembragt i trin 3.1.1. Brug virustiteren per masseenhed at korrigere for prøven forspænding forårsaget af nogen forskel i mængden af ​​væv, der anvendes til DNA-ekstraktion.
  8. Beregne procentdelen af ​​HaDV2 i det specifikke væv som følger: Procent af HaDV2 for hvert væv = HaDV2 kopiantal per mg testede væv / (summen af ​​kopiantal per mg alle væv).

5. Bioassays Test af Effekt af HaDV2 på Host Udvikling

  1. Sted mindst 100 pupper eller nyklækkede voksne møl afledt fra NONINF-stammen i en bomulds-gaze-dækket, 5-L, wire-mesh bur. Efter 2 dage, vil parret voksne kvinder begynder at lægge æg på bomuldsgaze. Indsamler og opbevarerden bomuldsgaze indeholdende æggene; klækkes æggene i omkring tre dage.
  2. Podning af den nyfødte larver med HaDV2.
    1. Overfør den nyfødte larver af den NONINF-stamme til den kunstige kost indeholder HaDV2 (10 8 kopi nummer / il) at etablere INF-stamme.
    2. Tilsvarende overføre nyfødte larver til den kunstige kost dækket med HaDV2-fri filtrerede væske (trin 2.4) for at etablere kontrolgrupperne (NONINF-stamme). Omfatte mindst 240 larver i hver behandling (figur 2A).
      BEMÆRK: Larver, der anvendes til at konstruere NONINF- og INF-stammer er afledt fra den samme forælder kohorte og luge samtidig sikre den samme genetiske baggrund. Sørge for, at NONINF- og INF-stammer er holdt i samme klimakammer (ved 25 ± 1 ° C, med 14 h lys / 10 timer mørke og 60% relativ fugtighed) i en synkron hastighed på udvikling; satsen kan variere afhængig af temperatur og fugtighed. Håndter delicspiste larver forsigtigt.
  3. Efter 48 timer, overføres larverne individuelt til plader med 24 brønde (en individuelle per brønd) (figur 2B).
    1. Sekventielt nummer hver larve i hver brønd og registrere instar scenen og overlevelse status dagligt.
    2. Ca. 5 dage senere, når den kunstige kost forringes, samtidigt overføre disse personer til en ny 24-brønds plade indeholdende frisk kunstig kost (figur 2C).
    3. Vejer larverne fra dag 7 til 11 efter klækning anvendelse af en analytisk balance en præcision på 0,0001 g. Efter vejning individuelt returnere larverne til 24-brønds plade.
  4. Ved molting til den femte stadium efter den fjerde skalskifte (omkring ti dage efter udklækning), overføre larverne til glasrør (10 cm højde, 2 cm diameter) (Figur 2D); femte stadiums larver kan også identificeres ved bredden af ​​hovedet kapslen (ca. 2,6 mm).
    BEMÆRK: Overfør de personertil glasrøret på samme tidspunkt hver dag.
    1. Kode hver larve med sin oprindelige referencenummer på glasrøret hjælp maling eller markører. Optag larve status dagligt; i rør, vil larverne forpupper efter ca. fem dager-pupperne fase varer ca. 11 dage.
    2. Notér pupper og eclosion dato for hver enkelt i glasrør. Optag massen af ​​3 dage gammel pupper.
  5. Efter eclosion, sætte en kvindelig og en mandlig i et enkelt bur med 10% saccharose og 2% vitamin-opløsning (figur 2E). Opfyld saccharoseopløsningen hver dag. Notér dato for død for hver møl.
  6. Når æggene er lagt, ændre bomuldsgaze dagligt. Tæl antallet af æg med det samme. Tæl nyligt udklækkede unger, mens de udklækkes.
  7. I løbet af bioassays, tilfældigt vælge otte personer til hver behandling for at bekræfte infektionen status HaDV2. Ekstrahere det totale RNA af disse prøver ved anvendelse af kommerciel trypsin reagensefter fabrikantens protokol. Syntetisere første-streng cDNA efter producentens protokol og bruge det som en skabelon til at teste, om virus bliver transskriberet.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Afkom fra forældre, der befandt HaDV2-fri (figur 3A) blev opdrættet som NONINF-stamme. Vi med succes amplificeret actin-genet ved anvendelse af de samme DNA-templates, hvilket antyder, at DNA-templates var af god kvalitet (figur 3B). Derudover tilfældigt udvalgte otte afkom var også fri for HaDV2 (figur 3C), HaNPV (figur 3D), og Wolbachia (figur 3E). Igen, konkluderede vi, at DNA-prøver af afkom var af god kvalitet, da en del af actin-genet med succes blev amplificeret for alle testede prøver (Fig 3F).

En standard kurve, der definerer forholdet mellem logaritmen af kvaliteten af udgangsmateriale og de opnåede CT-værdier blev dannet, som i figur 4. En stærk lineær korrelation (R (figur 4).

Frisk klækkede larver blev inokuleret med en punkt standardkurve for HaDV2 væskeformige fluider anvendelse af 10-foldige seriefortyndinger mellem 10 4 og 10 8 kopiantal / pl. Vi opnåede en lineær sammenhæng mellem infektion frekvens og koncentrationerne af de HaDV2 flydende væsker; 10 8 kopiantal / pl gav 100% infektion for bomuldsfrøkapselorm, men andre koncentrationer ikke (se også Xu et al. 31). De HaDV2 infektion frekvenser af afkommet fra forældre med forskellige HaDV2 infektion status var som følger: 100% for ♀ + / ♂-, 78% for ♀- / ♂ +, og 100% for ♀ + / ♂ + (også se Xu et al. 31).

Til correct for individuelle forskelle i HaDV2 titer, vi beregnet HaDV2 kopiantal per mg hvert væv og procentdelen af ​​det samlede HaDV2 titer for det specifikke væv. Resultaterne viste, at HaDV2 hovedsagelig blev fordelt i fedt kroppen (figur 5; også se Xu et al. 31). Sammenligninger af liv tabelparametre, herunder larval perioder, pupper perioder, voksen længde og frugtbarhed, er vist i tabel 1 (se også Xu et al. 31). De larve- og puppe Masserne var som publiceret af Xu et al. 31. De HaDV2 infektion status i både NONINF-stammen og INF-stammen blev bestemt ved PCR (resultater offentliggjort af Xu et al. 31).

figur 1
Figur 1. dissekeret væv for (A) Larver, (B) enKvindelige voksen, og (C) en Mand Voksen. H, hovedet (hjernen); Han, hemolymph; FB, fedt kroppen; Mt, Malpighian tubuli; G, gut; FG, fortarm; MG, midttarmen; HG, stortarmen; Mu, muskler; O, ovarie; T, testikel. Klik her for at se en større version af dette tal.

figur 2
Figur 2. Bioassay Procedure til bestemmelse af virkningerne af HaDV2 på bomuldsfrøkapselorm. (A) Podning af frisk udklækkede larver med HaDV2. (B) Overførslen af HaDV2-inficerede og HaDV2-frie individer til plader med 24 brønde efter 48 timer. (C) Forskellige størrelser af HaDV2-smittede og -Gratis individer. (D) Overførsel af femte-larver til nye glasrør (10 cm højde, 2 cm i diameter). (E) anbringelse af enkvindelig og en mandlig møl i samme bur for at bestemme voksen levetid, ægproduktion, og Udklækningsgraden. Klik her for at se en større version af dette tal.

figur 3
Figur 3. Infektion status for HaDV2, HaNPV eller Wolbachia i HaDV2-inficerede og HaDV2-fri kolonier. HaDV2 infektion status i de kvindelige og mandlige forældre (A). Infektion status HaDV2 (C), HaNPV (D), og Wolbachia (E) i de tilfældigt udvalgte afkom. At kontrollere kvaliteten af genomisk DNA blev husholdningsgen actin også amplificeret til forældrene (B) og afkom (F). Bane M viser DL2000 markør (2000 bp, 1000 bp, 750 bp, 500 bp, 250 bp, etd 100 bp). Bane 1: kvindelig forælder. Bane 2: hanforælder. Bane 3 - 10: afkom. Klik her for at se en større version af dette tal.

figur 4
Figur 4. standardkurven korrelere Log 2-transformerede HaDV2 Koncentrationer i Cycle Threshold (CT) Værdier. Klik her for at se en større version af dette tal.

figur 5
Figur 5. Vært-vævsfordelingen af HaDV2 i Larver (A), Adult Kvinde (B), og Voksen Mand (C) Bomuld Bollworms. Procent (%) = forholdet mellem HaDV2 i forskellige væv (per mg), som beskrevet in trin 4.7 Data blev analyseret statistisk ved anvendelse af variansanalyse (ANOVA) og Tukeys test (larver: n = 7; voksne mænd: n = 6; voksne kvinder: n = 6). Middelværdier ± SE. Resultater blev publiceret af Xu et al. 31. Klik her for at se en større version af dette tal.

Life-historie parametre HaDV2 + HaDV2- t-værdi df P-værdi
Larver periode (dage) Han 16.51 (± 0,72) 16,93 (± 1,21) 4,147 379 <0,001
Kvinde 16.51 (± 0,79) 16,80 (± 1,05) 2,732 312 0,0067
Puppe periode (dage) Han 13.02 (± 0,68) 13,31 (± 0,69) 4,057 379 <0,001
Kvinde 11,62 (± 0,67) 12,00 (± 0,63) 5.1 312 <0,001
Holdbarhed af voksne (dage) Han 10,69 (± 1,98) 10.93 (± 2,46) 0,915 367 0,36
Kvinde 9,07 (± 1,98) 8,51 (± 1,58) 2,992 367 0.003
Antal æg produceret pr kvindelige 482 (± 174) 403 (± 180) 2,172 93 0,032
Antal skraveringer pr kvindelige 207 (± 108) 143 (± 99) 3,026 93 0,0032

Tabel 1. livshistorie Parametre for HaDV2 + og HaDV2 bomuld Bollworms. T-test bruges til at bestemme niveauet af signifikans. Middelværdier ± SE er vist. Data præsenteret i denne tabel blev udgivet af Xu et al. 31.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

I de seneste årtier har de fleste undersøgelser af insekt-virus interaktioner med fokus på honningbien sundhed 34, 35, 36, vektorer for sygdomme hos mennesker 37, plante virus 38, og nogle insekt sygdomsfremkaldende vira, der har et stort potentiale som biologiske bekæmpelsesmidler 39. Lidt opmærksomhed er blevet betalt til hemmelige virus i insekter, især i skadelige sommerfugle. Her præsenteres en protokol for studiet af samspillet mellem en skjult virus og dens vært insekt. En sammenligning af livet table parametre for virusinficerede og virus-fri vært individer bør ideelt udelukke nogen effekt af forskelle i vært genetiske baggrund. At studere virale fænotype, har mange tidligere undersøgelser sammenlignedes liv tabelparametrene af enten naturligt inficeret eller ikke-inficerede individer i samme koloni eller enkeltpersoner inokuleretved mikroinjektion, men denne indsats er tidskrævende 23, 40. Den orale podning af bomuld bollworms med HaDV2, der er beskrevet her, tjener som et enkelt og effektivt middel til at analysere virale fænotyper. Denne fremgangsmåde sikrer også den samme genetiske baggrund for HaDV2-smittede og HaDV2-ikke-inficerede kolonier.

Virus inokulum kan fremstilles på mange måder. Oprensningen af ​​viruspartikler under anvendelse højhastighedscentrifugering inhiberer virus infektivitet, hvilket resulterer i lav infektivitet; derfor blev virusholdige filtrerede væske anvendt til at inficere den bomuldsfrøkapselorm larver 31. Den omstændighed, at 0,22-um membran kan foretage de fleste svampe- og bakterielle partikler fra HaDV2-indeholdende filtrerede væske, og at HaDV2-fri filtrerede væske blev anvendt som kontrol kunne udelukke virkningen af ​​andre vira på vores resultater. Men vi kan ikke udelukke, at de bioassay resultater kunne enLSO være forspændt ved uopdagede vira. Derfor bør HaDV2 partikler med høj infektivitet ideelt oprenses i fremtiden at opnå pålidelige resultater.

Viruskoncentrationen positivt korreleret med virus infektivitet; derfor var vi interesserede i fastsættelsen af ​​HaDV2 koncentration, der vil give 100% infektion. Vores resultater viste, at 10 8 kopi nummer / uL kunne bruges til virus podning for at opnå denne infektion sats. Utvivlsomt, bør sammenhængen mellem virustiter og infektionsrate blive undersøgt for andre virus-værtssammenspil studeret i fremtiden. Desuden bør det virustiteren af ​​hver enkelt på området også blive undersøgt. Derfor kunne vi derefter simulere effekten af ​​virus på individer i marken.

Den blide håndtering af den fine larver i løbet af de første par dage efter de udklækkes er meget vigtigt, fordi de let bliver dødeligt beskadiget. Desuden HaDV2-uinficerede colony bør holdes adskilt i drivhuset for at forhindre HaDV2 kontaminering-infektionen på HaDV2 har vist sig at være meget høj, både i marken og i laboratoriet 31.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne erklærer, at de ikke har nogen konkurrerende finansielle interesser.

Acknowledgments

Dette arbejde blev støttet af National Key Basic Research Program for Kina (nr 2013CB127602) og Science Fund for Creative Research Grupper af National Science Foundation of China (nr 31.321.004).

Materials

Name Company Catalog Number Comments
24-well plate Corning 07-200-740 Multiple suppliers available.
DNA extraction kit TIANGEN DP304-03 Multiple suppliers available.
thermal cycler Veriti; Applied Biosystems 4375786
PBS Corning 21-040-CV
0.22 µm membrane filter Millipore SLGS025NB
pEASY-T Cloning Vector TransGen, Beijing, China CT301-02
Tweezers IDEAL-TEK 2.SA
Premix Ex Taq (Probe qPCR) Takara RR390A
Probes Invitrogen Custom order
Primers Invitrogen Custom order
microspectrophotometry NanoDrop 2000c  Thermo scientific  not available
7500 Real-Time PCR system Applied Biosystems not available
stereomicroscope SZX-16 Olympus not available
sucrose Multiple suppliers available.
vitamin complex Multiple suppliers available.

DOWNLOAD MATERIALS LIST

References

  1. Tang, P., Chiu, C. Metagenomics for the discovery of novel human viruses. Future Microbiol. 5, 177-189 (2010).
  2. Rosario, K., Breitbart, M. Exploring the viral world through metagenomics. Curr. Opin. Virol. 1, 289-297 (2011).
  3. Hugenholtz, P., Tyson, G. W. Microbiology - metagenomics. Nature. 455, 481-483 (2008).
  4. Kristensen, D. M., Mushegian, A. R., Dolja, V. V., Koonin, E. V. New dimensions of the virus world discovered through metagenomics. Trends Microbiol. 18, 11-19 (2010).
  5. Kleiner, M., Hooper, L. V., Duerkop, B. A. Evaluation of methods to purify virus-like particles for metagenomic sequencing of intestinal viromes. BMC Genomics. 16, 7 (2015).
  6. Ho, T., Tzanetakis, I. E. Development of a virus detection and discovery pipeline using next generation sequencing. Virology. 471, 54-60 (2014).
  7. Marx, C. J. Can you sequence ecology? Metagenomics of adaptive diversification. PLoS Biol. 11, e1001487 (2013).
  8. Radford, A. D., et al. Application of next-generation sequencing technologies in virology. J. Gen. Virol. 93, 1853-1868 (2012).
  9. Liu, S. J., Chen, Y. T., Bonning, B. C. RNA virus discovery in insects. Curr. Opin. Insect Sci. 8, 54-61 (2015).
  10. Mokili, J. L., Rohwer, F., Dutilh, B. E. Metagenomics and future perspectives in virus discovery. Curr. Opin. Virol. 2, 63-77 (2012).
  11. Liu, S. J., Vijayendran, D., Bonning, B. C. Next generation sequencing technologies for insect virus discovery. Viruses-Basel. 3, 1849-1869 (2011).
  12. Cook, S., et al. Novel virus discovery and genome reconstruction from field RNA samples reveals highly divergent viruses in Dipteran hosts. PLoS ONE. 8, e80720 (2013).
  13. Webster, C. L., et al. The discovery, distribution, and evolution of viruses associated with Drosophila melanogaster. PLoS Biol. 13, e1002210 (2015).
  14. Granberg, F., et al. Metagenomic detection of viral pathogens in spanish honeybees: co-infection by aphid lethal paralysis, israel acute paralysis and lake sinai viruses. PLoS ONE. 8, e57459 (2013).
  15. Runckel, C., et al. Temporal analysis of the honey bee microbiome reveals four novel viruses and seasonal prevalence of known viruses, Nosema, and Crithidia. PLoS ONE. 6, 20656 (2011).
  16. Cox-Foster, D. L., et al. A metagenomic survey of microbes in honey bee colony collapse disorder. Science. 318, 283-287 (2007).
  17. Chandler, J. A., Liu, R. M., Bennett, S. N. RNA shotgun metagenomic sequencing of northern California (USA) mosquitoes uncovers viruses, bacteria, and fungi. Front. Microbiol. 6, 185 (2015).
  18. Shi, C. Y., et al. A metagenomic survey of viral abundance and diversity in mosquitoes from Hubei province. PLoS ONE. 10, e0129845 (2015).
  19. Nouri, S., Salem, N., Nigg, J. C., Falk, B. W. Diverse array of new viral sequences identified in worldwide populations of the Asian citrus psyllid (Diaphorina citri) using viral metagenomics. J. Virol. 90, 2434-2445 (2016).
  20. Dayaram, A., et al. Identification of diverse circular single-stranded DNA viruses in adult dragonflies and damselflies (Insecta Odonata) of Arizona and Oklahoma, USA. Infect. Genet. Evol. 30, 278-287 (2015).
  21. Jakubowska, A. K., et al. Simultaneous occurrence of covert infections with small RNA viruses in the lepidopteran Spodoptera exigua. J.Invert. Pathol. 121, 56-63 (2014).
  22. Roossinck, M. J. Move over, Bacteria! Viruses make their mark as mutualistic microbial symbionts. J. Virol. 89, 6532-6535 (2015).
  23. Ryabov, E. V., Keane, G., Naish, N., Evered, C., Winstanley, D. Densovirus induces winged morphs in asexual clones of the rosy apple aphid, Dysaphis plantaginea. Proc. Natl. Acad. Sci. USA. 106, 8465-8470 (2009).
  24. Roossinck, M. J. The good viruses: viral mutualistic symbioses. Nat. Rev. Microbiol. 9, 99-108 (2011).
  25. Venkataraman, S., et al. Structure of seneca valley virus-001: an oncolytic picornavirus representing a new genus. Structure. 16, 1555-1561 (2008).
  26. Deterding, K., et al. Hepatitis a virus infection suppresses hepatitis c virus replication and may lead to clearance of hcv. J. Hepatol. 45, 770-778 (2007).
  27. Barton, E. S., et al. Herpesvirus latency confers symbiotic protection from bacterial infection. Nature. 447, 326-329 (2007).
  28. Ponferrada, V. G., Mauck, B. S., Wooley, D. P. The envelope glycoprotein of human endogenous retrovirus herv-w induces cellular resistance to spleen necrosis virus. Arch. Virol. 148, 659-675 (2003).
  29. Márquez, L. M., Redman, R. S., Rodriguez, R. J., Roossinck, M. J. A virus in a fungus in a plant: three-way symbiosis required for thermal tolerance. Science. 315, 513-515 (2007).
  30. Xu, P. J., et al. Complete genome sequence of a monosense densovirus infecting the cotton bollworm, Helicoverpa armigera. J. Virol. 86, 10909-10909 (2012).
  31. Xu, P. J., Liu, Y. Q., Graham, R. I., Wilson, K., Wu, K. M. Densovirus is a mutualistic symbiont of a global crop pest (Helicoverpa armigera) and protects against a baculovirus and Bt biopesticide. PLoS Pathog. 10, e1004490 (2014).
  32. Liang, G. M., Tan, W. J., Guo, Y. Y. An improvement in the technique of artificial rearing cotton bollworm. Plant Protec. 25, 15-17 (1999).
  33. Zhou, W. G., Rousset, F., O'Neill, S. Phylogeny and PCR-based classification of Wolbachia strains using wsp gene sequences. P. Roy. Soc. B-Biol. Sci. 265, 509-515 (1998).
  34. Mondet, F., de Miranda, J. R., Kretzschmar, A., Le Conte, Y., Mercer, A. R. On the front line: quantitative virus dynamics in honeybee (Apis mellifera L.) colonies along a new expansion front of the parasite Varroa destructor. PLoS Pathog. 10, e1004323 (2014).
  35. Chen, Y. P., et al. Israeli acute paralysis virus: epidemiology, pathogenesis and implications for honey bee health. PLoS Pathog. 10, e1004261 (2014).
  36. Hunter, W., et al. Large-scale field application of RNAi technology reducing israeli acute paralysis virus disease in honey bees (Apis mellifera, Hymenoptera: Apidae). PLoS Pathog. 6, e1001160 (2010).
  37. Halstead, S. B. Dengue virus - mosquito interactions. Annu. Rev. Entomol. 53, 273-291 (2008).
  38. Whitfield, A. E., Falk, B. W., Rotenberg, D. Insect vector-mediated transmission of plant viruses. Virology. 479-480, 278-289 (2015).
  39. Moscardi, F. Assessment of the application of baculoviruses for control of Lepidoptera. Annu. Rev. Entomol. 44, 257-289 (1999).
  40. Szelei, J., et al. Susceptibility of North-American and European crickets to Acheta domesticus densovirus (AdDNV) and associated epizootics. J. Invert. Pathol. 106, 394-399 (2011).
Protokoller til Undersøgelse af Host-væv Distribution, Transmission-tilstand, og Effekt på Host Fitness af en densovirus i bomuldsfrøkapselorm
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Yang, X., Xu, P., Graham, R. I., Yuan, H., Wu, K. Protocols for Investigating the Host-tissue Distribution, Transmission-mode, and Effect on the Host Fitness of a Densovirus in the Cotton Bollworm. J. Vis. Exp. (122), e55534, doi:10.3791/55534 (2017).More

Yang, X., Xu, P., Graham, R. I., Yuan, H., Wu, K. Protocols for Investigating the Host-tissue Distribution, Transmission-mode, and Effect on the Host Fitness of a Densovirus in the Cotton Bollworm. J. Vis. Exp. (122), e55534, doi:10.3791/55534 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter