Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

Protokoller for Gransker Host-vev distribusjon, overføring-modus, og innvirkning på vertsmaskinen Fitness av en Densovirus i Cotton Bollworm

doi: 10.3791/55534 Published: April 12, 2017

Summary

Her presenterer vi en protokoll for å undersøke vertsvevet distribusjon, overføring modus, og effekt på verts egnethet av en densovirus løpet av sommerfugl-arter, bomull bollworm. Denne protokollen kan også bli anvendt for å studere interaksjonen mellom andre oralt overfør virus og deres insekt verter.

Abstract

Mange nye virus har blitt oppdaget i dyre verter som bruker neste generasjons sekvensering teknologi. Tidligere rapporterte vi en mutualistic virus, pestfagerfly densovirus (HaDV2), i en sommerfugl-arter, bomull bollworm, pestfagerfly (Hubner). Her beskriver vi protokollene som er brukt for å studere effekten av HaDV2 på sin vert. Først etablerer vi en HaDV2 fritt bomull bollworm koloni fra en enkelt avl par. Da vi oral inokulering av noen nyfødte larver avkom med HaDV2 holdig filtrerte væske for å fremstille to kolonier med det samme genetiske bakgrunn: en HaDV2-infiserte, ikke-infiserte den andre. En protokoll for å sammenligne liv tabell parametere (f.eks larve, puppe, og voksen perioder og fecundity) mellom de HaDV2-infiserte individer og -uninfected blir også presentert, som er protokollene for å bestemme vertsvevet fordeling og overføring effektivitet av HaDV2. Disse protokollene would også være egnet for undersøkelse av virkningene av andre oralt overfør virus på sine insekt verter, sommerfugl-verter i særdeleshet.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

I de siste tiårene, har utviklingen av sekvenseringsteknologi slik som neste generasjons sekvensering (NGS) lettes oppdagelsen av mange nye DNA og RNA-virus, spesielt ikke-patogene virus, men også nye isolater av tidligere kjente virus 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12. I modellorganisme Drosophila melanogaster, har mer enn 20 nye partielle virusgenomene blitt detektert ved bruk av teknikker metagenomic 13. Mange virussekvenser, inkludert nye virus, har også blitt identifisert i andre insekter, så som honningbier, mosquitoes, asiatisk sitrus psyllids, øyenstikkere, og flere sommerfugl-arter 14, 15, 16, 17, 18, 19, 20, 21.

I fremtiden kan det forventes at flere nye virus blir oppdaget i insekter som bruker disse avanserte teknologier; dermed kan vår forståelse av virus og vert interaksjon endres tilsvarende 6, 9. For eksempel er virus-vert interaksjoner anses å være mer komplisert enn tidligere antatt, fordi mange nye virus blir definert som mutualistic partnere fremfor strenge patogener 22. For eksempel, den mutualistic densovirus DplDNV i Dysaphis plantaginea induserer den bevingede morf og øker mobiliteten, som letter spredning av verten, så vel som viruset 23. Dessuten har mutualistic virus blitt beskrevet med hensyn til pattedyr helse, tørke og kulde toleranse av planter, og virkningen av bakterielle infeksjoner 24. Seneca dal virus-001 er vist å mediere selektiv cytotoksisitet mot tumorceller med nevroendokrine kreft funksjoner 25. Hepatitt A virusinfeksjoner undertrykke hepatitt C-virusreplikasjon, og kan føre til utvinning av hepatitt C-26. Herpesvirus latens confers symbiotisk beskyttelse mot bakteriell infeksjon 27. Konvolutten glykoprotein of human endogenous retrovirus Herv-W induserer cellulær resistens overfor milten nekrosevirus 28. Curvularia termisk toleranse virus (CThTV) fra en sopp endophyte er involvert i den mutualistic interaksjonen mellom denne soppen og en tropisk panikk gressref "> 29. Derfor er kunnskap om samspillet mellom de nylig funnet virus og deres verter skal generere nye perspektiver på deres biologi og forvaltning. Men nye virus, spesielt de skjulte virus viser ingen åpenbare tegn typisk for akutt infeksjon, har sjelden vært etterforsket, og vi trenger en rørledning og protokoller for å undersøke konsekvensene av de nylig funnet virus på sine verter.

Tidligere har vi rapportert prevalens en ny monosense densovirus pestfagerfly densovirus (HaDV2) i bomull bollworm, pestfagerfly, og presenterte bevis for en mutualistic forholdet mellom HaDV2 og bomull bollworm 30, 31. I denne artikkelen vil vi beskrive laboratoriet protokollen til å studere i detalj samspillet mellom HaDV2 og dens bomull bollworm vert. Protokollen som presenteres her kan også være svært relevant for forskere undersøker role andre oralt overfør virus, spesielt i sommerfugl-skadedyr.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Bygging av HaDV2 frie Cotton Bollworm Colony

  1. Bakre bomulls bollworm med larver (H. armigera) på en kunstig diett 32 i et kontrollert vekst rom eller en kunstig klimakammer ved 25 ± 1 ° C, med 14 timers lys / 10 timers mørke og 60% relativ fuktighet.
  2. Hjelpe til enkeltparet parring av nylig eclosed møll ved hjelp av en plast bur pr par (10 cm høyde, diameter 5 cm) som er dekket med bomullsgas for å sikre god ventilasjon og for å tjene som et substrat egglegging. For å øke sannsynligheten for å oppnå et virusfritt koloni, anvende minst 30 par av enkelt-pair parringer. Fôr voksen møll med en 10% sukker og 2% vitamin løsning 32 gjennomvåt på en bomullsdott og etterfylles daglig.
  3. Som kvinnelige voksne legge sine egg på bomull gasbind ca 2 dager etter parring, endre gasbind daglig. Samle og vedlikeholde gasbind inneholder egg i samme vekstrommet (eller kunstig klima chamBER) som den voksne møll inntil eggene klekkes.
  4. Umiddelbart overføre nyklekte larvene til nye 24-brønners plater, med ett individ per brønn.
  5. Fem dager etter den første egglegging dato, samle foreldre møll og lagre dem i flytende nitrogen.
    MERK: Samle møll 5 dager etter den første egglegging dato sikrer at foreldrene er i live på det punktet av samlingen og unngår derfor eventuelle konsekvenser ved bruk av døde sommerfugler på DNA-ekstraksjon nøyaktighet.
  6. Isolere genomisk DNA fra disse prøver ved anvendelse av en DNA-ekstraksjon sett i overensstemmelse med produsentens instruksjoner.
    1. Amplifisere et 574 bp-fragment av aktin-genet med primere aktin F / aktin R (aktin F: 5-CATCTACGAGGGTTACGC-3 og aktin R: 5-CATCTGTTGGAAGGTGGA-3). Visual polymerase kjedereaksjon (PCR) produkter ved hjelp av agarose-gel-elektroforese i henhold til standard fremgangsmåter; vellykket amplifikasjon av aktin-genet sikrer at DNA er av god kvalitet.
    2. vurdere than nærvær av HaDV2 i foreldre møllene ved hjelp av PCR med spesifikke primere: DVVPF (GGATTGGCCTGGGAAATGAC) og DVVPR (CGTTGTTTTTATATCCGAGG) 31.
  7. Når en ren par er blitt identifisert, bakre avkom fra en enkelt HaDV2-uinfisert avl par i minst fem generasjoner og opprettholde dette som HaDV2-fri koloni (NONINF-stamme); den HaDV2-infiserte koloni definert som INF-stammen.
  8. For å bekrefte HaDV2 infeksjonsstatus i den NONINF-stammen (og for å utelukke virkningen av kjente bakterier eller virus i verten utvikling), evaluere infeksjonsstatus for HaDV2, Wolbachia, og H. armigera nucleopolyhedrovirus (HaNPV) i åtte tilfeldig valgte larver individer av den NONINF-stammen ved hjelp av PCR (med spesifikke primere: DVVPF / DVVPR for HaDV2, NPVF / NPVR for HaNPV, og 81F / 691R for Wolbachia 31, 33).
    MERK: Det er kjent at noen virus kan være for sentnt i den infiserte vert, med et nivå umulig å oppdage selv ved bruk av en PCR-basert teknikk. NGS-teknologier kan brukes for å bekrefte at ingen virale sekvenser er til stede i de genomiske DNA-prøver.

2. Fremstilling av HaDV2 holdig væske Fluids

MERK: Vi har vist at det forsøkt rensing av de HaDV2 viruspartiklene hemmer deres aktivitet smittsomhet og 31; Derfor er den følgende protokoll utført for å oppnå den infiserende HaDV2 løsningen ved filtrering av HaDV2-infiserte individer.

  1. Samle voksen møll individuelt og straks lagre dem i flytende nitrogen.
  2. Fullstendig slipe de oppsamlede enkelte møll i flytende nitrogen under anvendelse av en sterilisert morter og støter. Overfør omtrent 10 ug av avfall til en ren 1,5 ml rør. Overfør den gjenværende rester til et nytt rør og straks lagre dem ved -80 ° C.
  3. Ekstrahere DNA fra de 10 pg av rusk, føfløyen protokollene fra produsenten. Når møll DNA er blitt isolert, sjekk for HaDV2 ved anvendelse av protokollen som beskrevet i trinn 1.6.
  4. I henhold til de resultater som ble oppnådd i trinn 2.3, deler den gjenværende rester i to grupper: HaDV2-positive og HaDV2-negativ, avhengig av deres infeksjon status. Tilsett 1 ml fosfat-bufret saltvann (PBS; 137 mM NaCl, 2,7 mM KCl, 8 mM Na 2HPO 4, og 1,5 mM KH 2PO 4; pH 7,5) til hvert individ for fullstendig å oppløse de gjenværende larve rusk.
  5. Sentrifuger av homogenatet (fra trinn 2,4) ved 6500 x g i 15 minutter ved 4 ° C. Filtrer den flytende supernatant med et 0,22 um membranfilter. Samle de filtrerte væske (200 mL per rør) og umiddelbart lagre dem ved -80 ° C.
    MERK: 0,22 mikrometer membranfilter filtrerer ut mesteparten av de uønskede partikler, bakterier og sopp. Først forkjøle sentrifugen til 4 ° C. Utfør alle protokoller involving driften av filtrert væske på is for å forhindre at homogenatet blir brun og koagulere.

3. Bygging av HaDV2 infiserte Cotton Bollworm Colony

  1. Horisontal overføringsevne av HaDV2
    1. Generere en HaDV2 standardkurve.
      1. Amplifisere fragmenter som inneholder primere (VPF: CTGGTGAGGCGATGGACATG; VPR: TGACAAGATCCAGCGTAGACATC) og sonden (VP-probe: GCCACCACTAGAGGACCCACCAGATG), som brukes for kvantifisering av HaDV2 virus, med de novo-primere (PF: GGACAATGCTGGTGAGGC; PR: AATCCTCTTTGTCCGTTATCTATG). Bruk følgende program: 30 s ved 94 ° C, 30 s ved 53 ° C og 60 s ved 72 ° C i 40 sykluser på en PCR-maskin 31. Tilsett 1 pl av genomisk DNA som inneholdt HaDV2 genomet (trinn 2.3) til det 25 pl PCR-reaksjon som templat-DNA. Klone de amplifiserte fragmenter i en kloningsvektor i henhold til forhandlerens protokoller.
      2. Beregn kopi antallplasmider med følgende ligning: kopier / pl = (N A x C) / (n x M x 10 9), hvor N A er Avogadros tall (6,02 x 10 23 molekyler / mol); C er den massekonsentrasjon av plasmider (ng / ul), som kan måles ved hjelp av microspectrophotometry; n er lengden av rekombinant plasmid som inneholdt PCR-produktet (5195 bp); og M er molekylvekten av en gjennomsnittlig basepar av dobbelttrådet DNA (660 g / mol).
      3. Forbered seks 10-gangers seriefortynninger i 1,5 ml mikrosentrifugerør, med konsentrasjoner på 1,5 x 10 9, 1,5 x 10 8 1,5 x 10 7, 1,5 x 10 6, 1,5 x 10 5, og 1,5 x 10 4 kopiantall / mL.
      4. Utføre sanntids kvantitativ polymerasekjedereaksjon (qPCR) ved anvendelse av spesifikke primere (VPF / VPR) og en sonde (VP-probe) for å generere syklus trelagshold (CT) verdiene av de plasmider som er beskrevet i trinn 3.1.1.3. Utfør tre uavhengige tekniske replikater og gjennomsnittlig dem for videre beregninger.
      5. Ved hjelp av de ovenfor angitte resultater generere en standardkurve som korrelerer log2-transform HaDV2 konsentrasjonene til de tilhørende gjennomsnittsverdier CT.
    2. Kvantifisere HaDV2 i de filtrerte flytende væsker.
      1. Pipetter en 100 ul prøve av filtrert væske væske (trinn 2.6) inneholdende HaDV2 for DNA-ekstraksjon.
      2. Bruk sanntid-qPCR å oppnå de Ct-verdiene for de flytende væsker og beregne antall kopier ved hjelp av standardkurven i trinn 3.1.1.
    3. Bestemme oral infeksjon effektivitet med HaDV2-infiserte filtrerte væsker med forskjellige konsentrasjoner.
      1. Fortynn den flytende væske som inneholder HaDV2 til de følgende konsentrasjoner: 10 8, 10 7, 10 6, 10 5, 10 4, og 0 kopiantall / pl.
      2. Spre kunstig diet jevnt på en 9 cm diameter petriskål før størkning. Jevnt fordelt HaDV2 holdig filtrerte væske (200 pl) for hver konsentrasjon på overflaten av det faste kunstig diett. Gjør dette i en avtrekkshette.
      3. Overfør 100 nylig klekket larver til HaDV2 holdige kunstig diett i en petriskål. Forsiktig banke bomullsgas (inkludert fersk-skravert larver) til å overføre larvene fra gasen til et ark av hvitt papir. Beat papiret forsiktig slik at larvene spinner silke og "ballong" av papiret. Bruk sterilisert pinsett til å berøre silke og flytte larvene til en petriskål.
      4. Etter 48 timer, overføre larver på kunstig diett til 24-brønners plater (en individuell per brønn).
      5. Bakre larvene inokulert med HaDV2 på de ovennevnte konsentrasjoner til det voksne stadiet.
      6. Samle de voksne møll, ekstrahere DNA, og detektere HaDV2 ved hjelp av PCR, som er beskrevet i trinn 1.5.
        MERK: Her får en 100% HaDV2 infeksjon rate av cotton bollworms som bruker 10 8 kopiantall / pl og således etablere HaDV2-infiserte koloni (INF-stamme).
  2. Vertikal overføring evne HaDV2
    1. Velg voksen møll fra NONINF og INF-stammer til å generere enkle par av ♀- / ♂-, ♀ + / ♂-, ♀- / ♂ + og ♀ + / ♂ + (+: positiv for HaDV2 infeksjon; -: negativ for HaDV2 infeksjon).
    2. Overfør avkom fra de ovennevnte parene av virusfrie 24-brønners plater; bak larvene til tredje stadium.
    3. Ekstrahere DNA fra det oppsamlede tredje instar larver til å bruke som templat for å bestemme tilstedeværelsen av HaDV2, som beskrevet i trinn 1.5.

4. Tissue Distribution of HaDV2

  1. For å hindre forurensning fra virus og bakterier, sterilisere tenger og sakser i 75% etanol tre ganger og deretter oppvarme dem i flammen fra en alkoholbrenner.
    MERK: tang sterilization er nødvendig når smuss forekommer.
  2. Ved anvendelse av en analysevekt, veie de tomme rør som skal brukes til lagring av vev.
  3. Plasser larver og voksne møll fra INF-belastning på is i ca 5 min.
  4. Skjær følgende vevet under et stereomikroskop i larver, voksne hunner og hanner i en ren petriskål inneholdende PBS-buffer.
    1. For larver, pipette hemolymfe og dissekere den forutgående, mellomtarmen og hindgut, fett-legeme, og malpighian små rør (figur 1A). Umiddelbart overføre hvert vev til rør i flytende nitrogen.
      1. Feste den frosne larver på cystosepiment ved hjelp av to insekt tapper (200 um i diameter, 20 mm i lengde), å innføre i intersegmental membraner i nærheten av hodet og den siste del av magen segment (figur 1A).
      2. Skjær vortefot i bakre del av magen av larvene slik at larvene hemolymph renner ut. Pipetter larve hemolymfe i løpet av 10 s ved anvendelse av en micropipette å hindre bruning og koagulerende av hemolymph.
        MERK: fenyltiourea (50 mikrogram / ml) kan blandes ved en 1:20 volum / volum-forhold med hemolymfe for å forhindre melanization.
      3. Ved hjelp av en saks, gjøre et snitt i hårstråene som strekker seg fra den siste intersegmental membranen til hodet. Skjær alle de gjenværende vev under et stereomikroskop ved hjelp av to tenger; bilde for hvert vev er vist i figur 1A.
      4. Bland vevsprøver fra tre individer sammen som en replikere.
      5. For å forhindre forurensning av de gjenværende vev med den hemolymfe under disseksjonen, vask de dissekerte vev i PBS-buffer tre ganger. Deretter tester HaDV2-infeksjon status for PBS brukes til vask. Hvis den endelige vaskebuffer er HaDV2-fri, bør vev være ren for forurensning med hemolymfe.
    2. For voksne kvinner, dissekere hodet (hjerne), muskler, fettlegemet, gut, malpighian tubuli, og eggstokk (Figur 1B) under et stereomikroskop i PBS-buffer. For voksne hanner, dissekere hodet (hjerne), muskler, fettlegemet, gut, malpighian tubuli, og testikler (figur 1C) under et stereomikroskop i PBS-buffer. Umiddelbart overføre hvert vev til rør i flytende nitrogen.
      1. Bruk pinsett og saks, fjerne vingene av den voksne møll og vaske den resterende kroppen tre ganger for å fjerne vekter.
      2. Skill hodet, thorax og abdomen med saks.
      3. Fjern endoskeleton av thorax og samle muskelen.
      4. Ved hjelp av pinsett, fjerne skjellaget av magen og dissekere andre vev følgende figurer 1B og 1C.
      5. Bland vevsprøver fra tre individer sammen som en replikere. Vask de dissekerte vev i PBS-buffer tre ganger.
  5. Vei rørene og de ovenfor nevnte vev når de har vært frosset og sørge for at masses i ulike vev er nesten like.
    Masse (vev) = masse (rør / vevsprøve) - masse (rør only)
  6. Ekstrahere DNA fra disse vevene og utføre qPCR, som beskrevet i trinn 3.1.2.
  7. Beregn kopiantallet pr mg av hvert vev ved bruk av standardkurve dannet i trinn 3.1.1. Bruk virustiter pr masseenhet for å korrigere for prøve-bias forårsaket av en forskjell i mengden av vev som brukes for DNA-ekstraksjon.
  8. Beregne hvor stor andel av HaDV2 i spesifikke vev som følger: Prosent av HaDV2 for hvert vev = HaDV2 kopitall pr mg testet vev / (sum av kopiantallet pr mg alle vev).

5. Bioanalyser teste effekten av HaDV2 på Host Development

  1. Sted på minst 100 puppe eller nylig oppståtte voksen møll avledet fra NONINF-stammen i en bomull-gasbind-dekket, 5-L, maskenett buret. Etter 2 dager, vil parret voksne kvinner begynner å legge egg på bomull gasbind. Samle og vedlikeholdebomull gasbind som inneholder egg; eggene klekkes i ca tre dager.
  2. Inokulering av den nyfødte larvene med HaDV2.
    1. Overfør den nyfødte larver av NONINF-stammen til den kunstig diett inneholdende HaDV2 (10 8 kopiantall / ul) for å etablere den INF-stammen.
    2. Likeledes overfører nyfødte larver til den kunstig diett dekket med HaDV2-fri filtrerte væske (trinn 2.4) for å etablere kontrollgruppene (NONINF-stamme). Omfatte minst 240 larver i hver behandlings (figur 2A).
      MERK: Larver som er benyttet for å konstruere NONINF- og INF-stammer som er avledet fra den samme moder kohort og luke på samme tid, noe som sikrer den samme genetisk bakgrunn. Sørge for at NONINF- og INF-stammer som er holdt i den samme klimakammeret (ved 25 ± 1 ° C, med 14 timers lys / 10 timers mørke og 60% relativ fuktighet) til en synkron hastighet av utvikling; hastigheten kan variere avhengig av temperatur og fuktighet. Håndtere delicspiste larver forsiktig.
  3. Etter 48 timer, overføre larvene individuelt til 24-brønners plater (en enkelt per brønn) (figur 2B).
    1. Sekvensielt nummer hver larve i hver brønn og registrere stadiums trinnet og overlevelse status daglig.
    2. Ca 5 dager senere, når den kunstig diett forringes, samtidig overføre disse individer til en ny 24-brønners plate inneholdende frisk kunstig diett (figur 2C).
    3. Vei larvene fra dag 7-11 etter luke ved hjelp av en analytisk balanse til en nøyaktighet på 0,0001 g. Etter veiing individuelt tilbake larvene til 24-brønners plate.
  4. Ved å skifte ham til den femte stadium etter den fjerde ekdysen (et titalls dager etter klekking), overfører larvene til glassrør (10 cm høyde, 2 cm i diameter) (figur 2D); Larver i femte stadium kan også bli identifisert ved bredden av hodet kapselen (ca. 2,6 mm).
    MERK: Overfør personertil glassrøret på samme tid hver dag.
    1. Kode hver larve med sin opprinnelige referansenummer på glassrøret ved hjelp av maling eller markører. Spill larve status daglig; i glassrørene, vil larvene forpuppes etter omtrent fem dager-puppe trinnet varer ca 11 dager.
    2. Spill puppe og eklosjonshormon dato for hver enkelt i glassrør. Spill massen av tre dager gammel puppe.
  5. Etter eklosjonshormon, sette en kvinnelig og en mannlig inn i et enkelt bur med 10% sukrose og 2% vitaminløsning (figur 2E). Etterfyll sukroseoppløsningen hver dag. Spill dødsdato for hver møll.
  6. Når eggene er lagt, endre bomull gasbind daglig. Telle antall egg umiddelbart. Count nylig klekket avkom mens de klekkes.
  7. I løpet av de biologiske analyser, tilfeldig velge åtte personer for hver behandling for å bekrefte infeksjon status for HaDV2. Ekstraher det totale RNA i disse prøver ved å bruke kommersielt trypsin reagenså følge produsentens protokoll. Syntetisere den første-tråd cDNA ved å følge produsentens protokoll og bruke den som en mal for å teste hvorvidt virusene med suksess transkribert.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Progenies fra foreldrene som ble HaDV2-fri (figur 3A) er blitt oppdrettet som NONINF-stammen. Vi lykkes forsterket aktingenet med de samme DNA-maler, noe som tyder på at DNA-maler var av god kvalitet (figur 3B). I tillegg er de tilfeldig utvalgte åtte progenies var også fri for HaDV2 (figur 3C), HaNPV (figur 3D), og Wolbachia (figur 3E). Igjen, konkluderte vi at DNA-prøvene av avkommet var av god kvalitet, da en del av aktin-genet ble vellykket amplifisert for alle testede prøver (figur 3F).

En standardkurve som definerer sammenhengen mellom log av kvaliteten av utgangsmaterialet, og fått Ct-verdier ble generert, som vist på figur 4. En sterk lineær korrelasjon (R (figur 4).

Ferskt klekket larver ble inokulert med et punkt standardkurve av HaDV2 flytende væsker ved bruk av 10-gangers seriefortynninger mellom 10 4 og 10 8 kopiantall / pl. Vi har oppnådd en lineær korrelasjon mellom de infeksjonsfrekvens og konsentrasjonen av de HaDV2 flytende væsker; 10 8 kopiantall / pl ga 100% infeksjon for bomulls bollworm, men andre konsentrasjoner ikke (se også Xu et al. 31). De HaDV2 infeksjon frekvensene til avkommet fra foreldre med forskjellige HaDV2 infeksjonstilstander var som følger: 100% for ♀ + / ♂-, 78% for ♀- / ♂ +, og 100% for ♀ + / ♂ + (se også Xu et al. 31).

til correct for individuelle forskjeller i HaDV2 titer, beregnet vi HaDV2 kopiantallet pr mg av hvert vev og prosentandelen av den totale HaDV2 titer for det spesifikke vev. Resultatene viste at HaDV2 var hovedsakelig fordelt i fettlegemet (figur 5; se også Xu et al. 31). Sammenligninger av de liv tabell parametere, inkludert larve perioder, puppe perioder, voksen lengde, og fruktbarhet, er vist i tabell 1 (se også Xu et al. 31). Larve og pupal massene var som publisert av Xu et al. 31. De HaDV2 infeksjonstilstander i både NONINF-stammen og INF-stamme ble bestemt ved hjelp av PCR (resultatene publisert av Xu et al. 31).

Figur 1
Figur 1. dissekert vev for (A) Larver, (B) enKvinne Voksen, og (C) en mannlig voksen. H, hode (hjerne); He, hemolymph; FB, fett legeme; Mt, Malpighian tubuli; G, gut; FG, forutgående; MG, midgut; HG, hindgut; Mu, muskler; O, eggstokk; T, testis. Klikk her for å se en større versjon av dette tallet.

Figur 2
Figur 2. Bioassay Fremgangsmåte for å bestemme effektene av HaDV2 på bomulls bollworm. (A) Inokulering av den nylig klekket larver med HaDV2. (B) overføring av de HaDV2-infiserte og HaDV2-frie individer til 24-brønners plater etter 48 timer. (C) Forskjellige størrelser av HaDV2-infiserte og -fri individer. (D) overføring av femte instar larver til nye glassrør (10 cm høyde, 2 cm i diameter). (E) plassering av ettkvinnelig og en mannlig møll inn i det samme buret for å bestemme voksen lang levetid, eggproduksjon, og luke hastighet. Klikk her for å se en større versjon av dette tallet.

Figur 3
Figur 3. Infeksjon Status for HaDV2, HaNPV eller Wolbachia i HaDV2-infiserte og HaDV2-frie koloniene. HaDV2 infeksjonsstatus i kvinnelige og mannlige foreldre (A). Infeksjon status av HaDV2 (C), HaNPV (D), og Wolbachia (E) i de tilfeldig utvalgte etterkommere. For å kontrollere kvaliteten av genomisk DNA, ble husholdningsgenet aktin også amplifisert for foreldrene (B) og progenies (F). Felt M viser DL2000 markør (2000 bp, 1000 bp, 750 bp, 500 bp, 250 bp, end 100 bp). Felt 1: hunnen. Spor 2: hannen. Lane 3-10: progenies. Klikk her for å se en større versjon av dette tallet.

Figur 4
Figur 4. standardkurven korrelere Log 2-transform HaDV2 Konsentrasjoner til syklusterskel (CT) verdier. Klikk her for å se en større versjon av dette tallet.

Figur 5
Figur 5. Verts Vevsfordeling av HaDV2 i larver (A), voksen kvinne (B), og voksen hann (C) Bomulls bollworms. Prosentandel (%) = forholdet mellom HaDV2 i forskjellige vev (per mg), som beskrevet in trinn 4.7 Dataene ble analysert statistisk ved anvendelse av variansanalyse (ANOVA) og Tukeys test (larver: n = 7, voksne menn: n = 6; voksne hunner: n = 6). Betyr ± SE. Resultatene ble publisert av Xu et al. 31. Klikk her for å se en større versjon av dette tallet.

Livshistorieparametre HaDV2 + HaDV2- t-verdien df P-verdien
Larve periode (dager) mann 16.51 (± 0,72) 16,93 (± 1,21) 4,147 379 <0,001
Hunn 16.51 (± 0,79) 16,80 (± 1,05) 2,732 312 0,0067
Puppe periode (dager) mann 13,02 (± 0,68) 13,31 (± 0,69) 4,057 379 <0,001
Hunn 11,62 (± 0,67) 12,00 (± 0,63) 5.1 312 <0,001
Longevity av voksen (dager) mann 10,69 (± 1,98) 10,93 (± 2,46) 0,915 367 0,36
Hunn 9,07 (± 1,98) 8,51 (± 1,58) 2,992 367 0,003
Antall egg produsert per kvinne 482 (± 174) 403 (± 180) 2,172 93 0,032
Antall hatchings per hunn 207 (± 108) 143 (± 99) 3,026 93 0,0032

Tabell 1. livshistorie Parametere for HaDV2 + og HaDV2 bomull bollworms. T-test brukes til å bestemme nivået av betydning. Betyr ± SE vises. Data presentert i denne tabellen ble publisert av Xu et al. 31.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

I de siste tiårene har de fleste studier på insekt-virus interaksjoner fokusert på honningbie helse 34, 35, 36, vektorer av menneskelig sykdom 37, virus plante 38, og noen insekt patogene virus som har stort potensial som biologiske bekjempelsesmidler 39. Lite oppmerksomhet har blitt betalt til hemmelige virus i insekter, spesielt i sommerfugl-skadedyr. Her presenterer vi en protokoll for studiet av samspillet mellom et skjult virus og verts insekt. En sammenligning av livet tabellparameterne for virusinfiserte og virusfrie verts individer bør ideelt utelukke noen effekt av forskjeller i verts genetisk bakgrunn. For å studere viral fenotype, har mange tidligere studier sammenlignet livet tabellparameterne av enten naturlig smittet eller ikke-infiserte individer i samme koloni eller enkeltpersoner inokulertved mikroinjeksjon, men dette arbeidet er tidkrevende 23, 40. Den oral inokulering av bomull bollworms med HaDV2, som beskrevet her, tjener som en enkel og effektiv måte for å analysere virale fenotyper. Denne fremgangsmåten sikrer også den samme genetiske bakgrunnen for HaDV2-infiserte og uinfiserte HaDV2-kolonier.

Virusinokulumet kan tilberedes på mange måter. Rensing av viruspartikler ved hjelp av høyhastighets-sentrifugering hindrer virus smittsomhet, noe som resulterer i lav smitteevne; Derfor ble virusinneholdende filtrerte væsken anvendt for å infisere bomulls bollworm larver 31. Det faktum at 0,22 pm membran kan filtrere ut mest sopp-og bakteriepartikler fra HaDV2 holdige filtrerte væske, og at den HaDV2 frie filtrerte væske ble anvendt som kontroll kan utelukke virkningen av andre virus på våre resultater. Men vi kan ikke utelukke at bioanalyseresultatene kunne enLSO være forspent ved uoppdagede virus. Derfor HaDV2 partikler med høy smittsomhet bør ideelt sett skal renses i fremtiden for å oppnå robuste resultater.

Viruskonsentrasjonen positivt korrelert med virus infektivitet; følgelig, var vi er interessert i å bestemme den HaDV2 konsentrasjon som vil gi 100% infeksjon. Våre resultater viste at de 10 8 kopiantall / pl kunne brukes for viruset inokulering for å oppnå denne infeksjonsraten. Utvilsomt, bør sammenhengen mellom virus titer og infeksjon rate bli utredet for andre virus-vert interaksjoner studert i fremtiden. I tillegg bør det virustiter hver enkelt i feltet også bli undersøkt. Derfor kunne vi deretter simulere effekten av virus på enkeltpersoner i feltet.

Den milde håndtering av delikat larver i løpet av de første dagene etter at de klekkes er svært viktig, fordi de er lett skjebnesvangert skadet. Videre er HaDV2-uinfisert colony bør holdes separat i drivhus for å forhindre forurensning HaDV2-infeksjon hastigheten HaDV2 har vist seg å være meget høy, både i felten og i laboratoriet 31.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne hevder at de ikke har noen konkurrerende økonomiske interesser.

Acknowledgments

Dette arbeidet ble støttet av National Key Basic Research Program of China (nr 2013CB127602) og Science Fund for kreativ forskning Grupper av Science Foundation National of China (nr 31321004).

Materials

Name Company Catalog Number Comments
24-well plate Corning 07-200-740 Multiple suppliers available.
DNA extraction kit TIANGEN DP304-03 Multiple suppliers available.
thermal cycler Veriti; Applied Biosystems 4375786
PBS Corning 21-040-CV
0.22 µm membrane filter Millipore SLGS025NB
pEASY-T Cloning Vector TransGen, Beijing, China CT301-02
Tweezers IDEAL-TEK 2.SA
Premix Ex Taq (Probe qPCR) Takara RR390A
Probes Invitrogen Custom order
Primers Invitrogen Custom order
microspectrophotometry NanoDrop 2000c  Thermo scientific  not available
7500 Real-Time PCR system Applied Biosystems not available
stereomicroscope SZX-16 Olympus not available
sucrose Multiple suppliers available.
vitamin complex Multiple suppliers available.

DOWNLOAD MATERIALS LIST

References

  1. Tang, P., Chiu, C. Metagenomics for the discovery of novel human viruses. Future Microbiol. 5, 177-189 (2010).
  2. Rosario, K., Breitbart, M. Exploring the viral world through metagenomics. Curr. Opin. Virol. 1, 289-297 (2011).
  3. Hugenholtz, P., Tyson, G. W. Microbiology - metagenomics. Nature. 455, 481-483 (2008).
  4. Kristensen, D. M., Mushegian, A. R., Dolja, V. V., Koonin, E. V. New dimensions of the virus world discovered through metagenomics. Trends Microbiol. 18, 11-19 (2010).
  5. Kleiner, M., Hooper, L. V., Duerkop, B. A. Evaluation of methods to purify virus-like particles for metagenomic sequencing of intestinal viromes. BMC Genomics. 16, 7 (2015).
  6. Ho, T., Tzanetakis, I. E. Development of a virus detection and discovery pipeline using next generation sequencing. Virology. 471, 54-60 (2014).
  7. Marx, C. J. Can you sequence ecology? Metagenomics of adaptive diversification. PLoS Biol. 11, e1001487 (2013).
  8. Radford, A. D., et al. Application of next-generation sequencing technologies in virology. J. Gen. Virol. 93, 1853-1868 (2012).
  9. Liu, S. J., Chen, Y. T., Bonning, B. C. RNA virus discovery in insects. Curr. Opin. Insect Sci. 8, 54-61 (2015).
  10. Mokili, J. L., Rohwer, F., Dutilh, B. E. Metagenomics and future perspectives in virus discovery. Curr. Opin. Virol. 2, 63-77 (2012).
  11. Liu, S. J., Vijayendran, D., Bonning, B. C. Next generation sequencing technologies for insect virus discovery. Viruses-Basel. 3, 1849-1869 (2011).
  12. Cook, S., et al. Novel virus discovery and genome reconstruction from field RNA samples reveals highly divergent viruses in Dipteran hosts. PLoS ONE. 8, e80720 (2013).
  13. Webster, C. L., et al. The discovery, distribution, and evolution of viruses associated with Drosophila melanogaster. PLoS Biol. 13, e1002210 (2015).
  14. Granberg, F., et al. Metagenomic detection of viral pathogens in spanish honeybees: co-infection by aphid lethal paralysis, israel acute paralysis and lake sinai viruses. PLoS ONE. 8, e57459 (2013).
  15. Runckel, C., et al. Temporal analysis of the honey bee microbiome reveals four novel viruses and seasonal prevalence of known viruses, Nosema, and Crithidia. PLoS ONE. 6, 20656 (2011).
  16. Cox-Foster, D. L., et al. A metagenomic survey of microbes in honey bee colony collapse disorder. Science. 318, 283-287 (2007).
  17. Chandler, J. A., Liu, R. M., Bennett, S. N. RNA shotgun metagenomic sequencing of northern California (USA) mosquitoes uncovers viruses, bacteria, and fungi. Front. Microbiol. 6, 185 (2015).
  18. Shi, C. Y., et al. A metagenomic survey of viral abundance and diversity in mosquitoes from Hubei province. PLoS ONE. 10, e0129845 (2015).
  19. Nouri, S., Salem, N., Nigg, J. C., Falk, B. W. Diverse array of new viral sequences identified in worldwide populations of the Asian citrus psyllid (Diaphorina citri) using viral metagenomics. J. Virol. 90, 2434-2445 (2016).
  20. Dayaram, A., et al. Identification of diverse circular single-stranded DNA viruses in adult dragonflies and damselflies (Insecta Odonata) of Arizona and Oklahoma, USA. Infect. Genet. Evol. 30, 278-287 (2015).
  21. Jakubowska, A. K., et al. Simultaneous occurrence of covert infections with small RNA viruses in the lepidopteran Spodoptera exigua. J.Invert. Pathol. 121, 56-63 (2014).
  22. Roossinck, M. J. Move over, Bacteria! Viruses make their mark as mutualistic microbial symbionts. J. Virol. 89, 6532-6535 (2015).
  23. Ryabov, E. V., Keane, G., Naish, N., Evered, C., Winstanley, D. Densovirus induces winged morphs in asexual clones of the rosy apple aphid, Dysaphis plantaginea. Proc. Natl. Acad. Sci. USA. 106, 8465-8470 (2009).
  24. Roossinck, M. J. The good viruses: viral mutualistic symbioses. Nat. Rev. Microbiol. 9, 99-108 (2011).
  25. Venkataraman, S., et al. Structure of seneca valley virus-001: an oncolytic picornavirus representing a new genus. Structure. 16, 1555-1561 (2008).
  26. Deterding, K., et al. Hepatitis a virus infection suppresses hepatitis c virus replication and may lead to clearance of hcv. J. Hepatol. 45, 770-778 (2007).
  27. Barton, E. S., et al. Herpesvirus latency confers symbiotic protection from bacterial infection. Nature. 447, 326-329 (2007).
  28. Ponferrada, V. G., Mauck, B. S., Wooley, D. P. The envelope glycoprotein of human endogenous retrovirus herv-w induces cellular resistance to spleen necrosis virus. Arch. Virol. 148, 659-675 (2003).
  29. Márquez, L. M., Redman, R. S., Rodriguez, R. J., Roossinck, M. J. A virus in a fungus in a plant: three-way symbiosis required for thermal tolerance. Science. 315, 513-515 (2007).
  30. Xu, P. J., et al. Complete genome sequence of a monosense densovirus infecting the cotton bollworm, Helicoverpa armigera. J. Virol. 86, 10909-10909 (2012).
  31. Xu, P. J., Liu, Y. Q., Graham, R. I., Wilson, K., Wu, K. M. Densovirus is a mutualistic symbiont of a global crop pest (Helicoverpa armigera) and protects against a baculovirus and Bt biopesticide. PLoS Pathog. 10, e1004490 (2014).
  32. Liang, G. M., Tan, W. J., Guo, Y. Y. An improvement in the technique of artificial rearing cotton bollworm. Plant Protec. 25, 15-17 (1999).
  33. Zhou, W. G., Rousset, F., O'Neill, S. Phylogeny and PCR-based classification of Wolbachia strains using wsp gene sequences. P. Roy. Soc. B-Biol. Sci. 265, 509-515 (1998).
  34. Mondet, F., de Miranda, J. R., Kretzschmar, A., Le Conte, Y., Mercer, A. R. On the front line: quantitative virus dynamics in honeybee (Apis mellifera L.) colonies along a new expansion front of the parasite Varroa destructor. PLoS Pathog. 10, e1004323 (2014).
  35. Chen, Y. P., et al. Israeli acute paralysis virus: epidemiology, pathogenesis and implications for honey bee health. PLoS Pathog. 10, e1004261 (2014).
  36. Hunter, W., et al. Large-scale field application of RNAi technology reducing israeli acute paralysis virus disease in honey bees (Apis mellifera, Hymenoptera: Apidae). PLoS Pathog. 6, e1001160 (2010).
  37. Halstead, S. B. Dengue virus - mosquito interactions. Annu. Rev. Entomol. 53, 273-291 (2008).
  38. Whitfield, A. E., Falk, B. W., Rotenberg, D. Insect vector-mediated transmission of plant viruses. Virology. 479-480, 278-289 (2015).
  39. Moscardi, F. Assessment of the application of baculoviruses for control of Lepidoptera. Annu. Rev. Entomol. 44, 257-289 (1999).
  40. Szelei, J., et al. Susceptibility of North-American and European crickets to Acheta domesticus densovirus (AdDNV) and associated epizootics. J. Invert. Pathol. 106, 394-399 (2011).
Protokoller for Gransker Host-vev distribusjon, overføring-modus, og innvirkning på vertsmaskinen Fitness av en Densovirus i Cotton Bollworm
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Yang, X., Xu, P., Graham, R. I., Yuan, H., Wu, K. Protocols for Investigating the Host-tissue Distribution, Transmission-mode, and Effect on the Host Fitness of a Densovirus in the Cotton Bollworm. J. Vis. Exp. (122), e55534, doi:10.3791/55534 (2017).More

Yang, X., Xu, P., Graham, R. I., Yuan, H., Wu, K. Protocols for Investigating the Host-tissue Distribution, Transmission-mode, and Effect on the Host Fitness of a Densovirus in the Cotton Bollworm. J. Vis. Exp. (122), e55534, doi:10.3791/55534 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter