Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

A-seq2 ile kütüphane hazırlık sıralama 3' ucu

doi: 10.3791/56129 Published: October 10, 2017

Summary

Bu iletişim kuralı için siteleri işleme eşleme pre-mRNA 3' ucu bir yöntemi açıklar.

Abstract

Çalışmalar son on yılda bir karmaşık ve dinamik pre-mRNA bölünme ve çeşitli Poliadenilasyon tepkiler ortaya çıkardı. Oysa Proliferasyona hücreler tercihen Tutanaklar ile kısa 3' UTRs hızlı mRNA'ların uzun 3' Çevrilmemiş bölgeleri (UTRs) ile farklılaşmış hücreler oluşturulur. Biz şimdi onun ikinci yorum, hangi was gelişmiş Poliadenilasyon siteleri genom geniş eşleme ve pre-mRNA 3' son işlemesi Yönetmeliği çalışma vasıl A-seq iletişim kuralı tanımlamak. Ayrıca bu geçerli protokol (en memeli mRNA'ların zenginleştirmek için tam olarak işlenen mRNA'ların Biyogenez sırasında eklenen poly(A)) kuyrukları. polyadenylate yararlanır Deoxyuracil dördüncü konumunu, bir DNA adaptörü mRNA 3' son parçaları sıralama için hassas işleme izin verir. Hücre kültürü ve gece d dahil değil, protokol yaklaşık 8 s uygulamalı zaman gerektirir. Onunla birlikte bir kullanımı kolay yazılım paketi türetilmiş sıralama veri analizi için sağlanır. A-seq2 ve ilişkili analiz yazılımı sağlar bir verimli ve güvenilir çözüm pre-mRNA 3' eşlemesi biter koşulları, 10 geniş bir alanda6 veya daha az hücre.

Introduction

Yakalama ve mRNA 3' biter nın mRNA işlemesi, çalışma ve gen ekspresyonu miktar sağlar. Poli(a) kuyruklarını nedeniyle, ökaryotik mRNA'ların verimli toplam hücresini lysates boncuk immobilize oligo-deoxythymidine (Ayrıca cDNA sentez Başbakan oligo(dT)) moleküller,. ile gelen saf Ancak, bu yaklaşım iki dezavantajı vardır. İlk olarak, Tutanaklar için iç olan A'ın menziller cDNA sentezi, sahte Poli(a) Siteler'de kaynaklanan da Başbakan. İkinci, homojen Poli(a) uzanır için sıralama için transkript kimlik bilgilendirici olmamak bir yana, belirli sorunlar teşkil. Çeşitli yaklaşımlar ters transkripsiyon yoluyla Poli(a) gibi bu sınırlamaları aşmak için önerilen RNase H sindirim (3 P-seq 1), tarafından takip kuyrukları kullanın 20 dakika sonra biten bir özel sıralama astar Ts (2 P-seq 2), in disindan RNA parçaları ile ardından RNase H sindirim (3' okuma 3) ve bir saç tokası (A-seq 4) 3' bağdaştırıcıyı içeren bir oligo-dT astar kullanımı CU5T45 astar ile 50 nukleotid Poli(a) kuyruğu.

Son zamanlarda Gelişmiş A-seq2 yöntem 5 hedefler sıralama Poli(a) aracılığıyla ve bağdaştırıcıları, özellikle meydana gelen öz ligasyonu tarafından oluşturulan dimer oranını en aza indirmek için aynı zamanda atlamak için zaman bağdaştırıcıları molar konsantrasyonu INSERT konsantrasyonu daha ağır basar. Her iki bağdaştırıcı polinükleotit biter A-seq2, nerede 3' bağdaştırıcıları için 5' uç RNA parçaları ve bağdaştırıcılarına 5' 5' ucuna cDNAs sonra ters transkripsiyon bakmaksızın olduğu gibi aynı türüne bakmaksızın zaman bu sorun ortadan kaldırılabilir. Bizim daha önce önerilen A-seq - sıralama 5'-için-3'te yapıldı daha yöntemdir ' böylece tam olarak gerektiren yönü kontrol RNA parçalanma-Poli(a) sitesi kimliği yüksek bir doğruluk korurken,. Tipik örnekleri olarak sıralı okuma yaklaşık % 80 benzersiz olarak genom için harita ve 20.000'den fazla Poli(a) sitesi kümeleri, hangi ek açıklama eklenen 3' ile UTRs çakışan %70 daha fazla tanımlaması yol.

Kısacası, A-seq2 Protokolü mRNA parçalanma ve ters-tamamlayıcı 3' 5' ucuna RNA parçaları bağdaştırıcısına ligasyonu ile başlar. Poli (A)-içeren RNA'ların sonra ters bir çapa nükleotit 3' ucu, bir dU pozisyonda 4 ve 5' sonunda, bir biotin içeren bir 25 nükleotit (nt) uzun oligo(dT) astar ile transkripsiyonu için manyetik streptavidin boncuk cDNA bağlamaya izin vererek. Astar, biotin, dahil olmak üzere çoğu kaldırılır cDNA dU, bölünme tarafından urasil DNA glycosylase (UDG) ve DNA glycosylase-liyaz endonükleaz VIII içeren kullanıcı enzim karışımı tarafından. Poli(a) kuyruğu konumunu işaretlemek için bölünme kalır sonra bu reaksiyon olduğu gibi amaçları için bir 5' bağdaştırıcısı ve üç Ts sol ligasyonu bırakır. Tüp ligasyonu alıcı 5' biter tarafından 5' her ikisi ve 3' uyarlamak eklendiğinden, hiçbir bağdaştırıcısı dimer oluşturulur. Dört nükleotit rasgele-okur başlarında mers state-of--art sıralama aletleri üzerinde küme çözünürlük sağlar ve aynı zamanda benzersiz moleküler tanımlayıcı (UMI) olarak algılama ve PCR güçlendirme eserler kaldırılması için hizmet edebilir. UMI boyutunu daha da diğer çalışmalar 6' olarak artırılabilir. Protokol tamamlayıcı mRNA 3' biter, her 3 Ts. işleme onların PCR güçlendirme eserler tarafından düzeltilmesi ile 5' sonunda başlar, 3 tanı Ts var okur tarafından takip randomize bir tetramer başlayarak geriye doğru okuma oluşturur UMIs, 3' bağdaştırıcısı dizileri, kaldırılması istismar ve ters uluslara. Oligo(dT) astar iç A-zengin siteler üzerinden kökenli olduğu okuma da hesaplama açısından tanımlanır ve atılır. Sahte siteleri genellikle iyi karakterize 18 birini eksikliği ve olması gereken korunmuş Poli(a) sinyalleri ~ 21 nükleotit akıntıya karşı belirgin bölünme sitesi 7yer.

Protokol yaklaşık 8 s uygulamalı zaman, hücre kültürü ve gece d sayma değil gerektirir. İlişkili yazılım son derece hassas Poli(a) sitesi kimliği sağlar analiz okudum. Poli(a) sitesinden kümeleri 4 örnekleri bu el yazması (Denetim siRNA ve si HNRNPC tedavi edilen hücreleri iki biyolojik çoğaltır) % 84 örtüşme Açıklama eklenmiş bir gen ile ve bu, bir 3' UTR % 75 çakışma ve %86 ile ikisinden biri daha fazla vurgulu temel alınarak oluşturulan bir 3' UTR veya bir terminal exon. Çoğalt örnekleri... biter 3' ifadesinin Pearson korelasyon katsayısı 0.92 olduğunu ve üzerinde 0,9 değerleri genellikle yöntemi ile elde edilir. Böylece, A-seq2 çok tekrarlanabilir sonuçlar verir uygun bir yöntemdir.

Protocol

1. hücre büyümesi ve mRNA yalıtım

  1. 1 ~ %80 izdiham kuyuda başına 10 6 hücre x 6-şey tabak içinde deneysel tasarım göre hücreleri büyümek.
  2. Büyüme orta kaldırmak ve hücreleri bir kez tamponlanmış fosfat ile serum fizyolojik yıkayın. Doğrudan plaka üzerinde hücreleri mRNA yalıtım teçhizat--dan 1 mL lizis arabelleği ekleyerek parçalayıcı. Viskoz transfer 1 mL pipet ucu ile 15 mL plastik tüp içine lysate. Tamamen hücre malzemesi plaka yüzeyinden ayırmak için bir plastik spatula kullanın.
  3. Lysate içeren yapışkan DNA lysate artık yapışkan kadar 23 G Hipodermik İğne için birkaç pistonu yukarı ve aşağı hareketleri dinç bağlı 1 mL şırınga ile kesme. Şırınga iğne lysate tüp dışarı çıkarma önlemek için alt ortasına gelin.
  4. Lysate şırınga kullanarak bir 1,5 mL tüp içine aktarın. 20.000 x g de 5 min ve enkaz kaldırmak için 4 ° C spin. DNA düşük bağlama 1,5 mL tüpler boyunca protokol kullanın.
  5. Santrifüj çalışırken
  6. lizis arabelleği 500 µL ile manyetik bir raf üzerinde resuspended oligo (dT) 25 manyetik boncuklar 300 µL yıkayın. 2 - 3 kez üzerine askı boruları karıştırın. Çözüm açıktır sonra arabellek kaldırın. Açık süpernatant 1.4 adımından toplamak ve boncuk için ekleyin. Resuspend ve yer tüpler 10 dakika süreyle dönen bir tekerlek üstünde
  7. Tüpler manyetik bir rafa yerleştirin. Berrak sıvı 2 dk. sonra Ekle 0.8 mL arabellek A mRNA yalıtım Seti'nden kaldırın. Tüp 180 ° derece rafta, 2 - 3 kez kapatın. Bu yıkama işlemi tekrarlayın arabelleği A. ile bir kez daha
  8. 1.6 adımda anlatıldığı gibi boncuk arabelleği B 0.8 mL ile 2 kere yıka.
  9. Boncuklar, üzerinden bağlı mRNA elute
  10. 33 µL H 2 O ekleyin ve boncuk resuspend. Isıtmalı bir blok üzerinde 5 min için 75 ° c ısı. Hemen tüpler 1 s ve yer için spin manyetik raf onları. Süpernatant için yeni bir tüp aktarın. Örnekleri kadar daha fazla kullanılmasını-80 ° C'de saklanabilir.
  11. 33 66 eklemek µL alkalin hidroliz arabelleğe µL mRNA (Adım 1.8), mix ve tam olarak 5 dakika Isıtma blokta 95 ° c ısı. Hemen buz üzerine boruları, soğuk
  12. Bir RNA Temizleme kiti ile izole RNA.
    Not: ses onaylamak; 100 µL olması gerektiği.
    1. Seti ve 250 350 eklemek µL RLT arabelleğinden µL etanol. Sütun ve 30 tur üzerine yük 8000 x g oda sıcaklığında (RT), s. 500 µL RPE arabelleği kiti ile yıkayın. 500 µL % 80 etanol ile yıkayın. Sütun kurumaya 20.000 x g de 5 min için spin. 36 µL H 2 O sütununu ekleyin ve 20.000 x g., 1 dk sütun atmak ve eluate kaydetmek için spin.

2. 5 ' fosforilasyon ve Dnaz tedavi sonunda

  1. ekleyin 5 µL polinükleotit kinaz arabellek, 5 µL 10 mM ATP, 1 µL ribonükleaz inhibitör, 1 µL Dnaz ve 2 µL polinükleotit kinaz örnekler ve 1.1 birimleri karıştırılarak ana reaksiyon karışımları protokol boyunca 30 dk. isteğe bağlı olarak hazırlamak için 37 ° C'de kuluçkaya n x (n = örnekleri sayısı) her bileşenin.
  2. Değiştirmek arabellek ve ATP Poli(a) ek bir sonraki adımda önlemek için bir spin sütunu kaldır.
    1. Prespin spin-sütunlar vasıl 735 x g 1 dk. sütunları yeni 1,5 mL tüpler için Transfer ve kinaz reaksiyonlar sütunlar üzerine yük. 735 x g., 2 dk sütunları sütunları atın ve toplanan reaksiyonlar tüplerini Buza koyun veya saklamak-80 spin ° C.

3. 3 engelleme ' biter Cordycepin trifosfat ile

Not: 3 blok esastır ' onların concatemerization sonraki ligasyonu tepkiler. 3 önlemek için RNA parçaları ucu ' zaten engellenmez bir () tarafından biter hidroliz kabul edilir sonra buna ek olarak bir 3 tarafından döngüsel) fosfat ' dATP (cordycepin trifosfat) zinciri Sonlandırıcı nükleotit Poli(a) polimeraz yardımı ile. Burada, ifade ve 8 ' de açıklandığı gibi saf Maya Poli(a) polimeraz (yPAP), 0,5 mg/mL konsantrasyonu kullanıldı. Maya veya E. coli PAP her iki var hemen hemen aynı etkinlik 3 eklenmesi için ' dATP ve ticari olarak satın alınabilir (malzemeleri tablo görmek).

  1. Ekleyin 13,5 µL 5 x konsantre Poli(a) polimeraz tepki tampon, 10 mm 3 2 µL ' dATP, 1 µL RNase inhibitörü ve 1 µL Poli(a) polimeraz gelen tepki için adım 2.2.1. Mix ve spin için 30 dk. eklemek 32.5 µL H 2 O her tepki için 37 ° C'de 1 s. Incubate. RNA olduğu gibi adım 1.10.1 arındırmak. RNA 14 µL H 2 O. elute

4. Ligasyonu ters 3 ' 5 bağdaştırıcılarına ' RNA parçaları son

  1. 6 µL. 3 eklemek µL 10 x T4 RNA ligasyonu arabellek, 3 µL 10 mM ATP için sesi azaltmak için vakum yoğunlaştırıcı 10 min için tepkiler gerçekleşti , 15 µL PEG­-8000, 1 µL RNase inhibitörü, 0,1 mM ters Kompleman 3 1 µL ' bağdaştırıcı " revRA3 " (malzemeleri tablo görmek) ve 1 µL yüksek konsantrasyon RNA ligaz 1, mix.
  2. Reaksiyonlar ısıtmalı bir mikser üzerinde 16 h için 24 ° C'de aralıklı 1000 devir / dakikada karıştırma ile kuluçkaya. 70 µL H 2 O her tepki ekleyip karıştırın. RNA olduğu gibi adım 1.10.1 arındırmak. O. örnekleri saklanabilir-80 ° C'de bu noktada 14 µL H 2 RNA elute.

5. Transkripsiyon (RT) ters

  1. yer eluates için 11 µL. Transfer reaksiyonları 200 µL PCR için sesi azaltmak için vakum yoğunlaştırıcı 3 dk içinde tüpler. 1 µL 0.05 mM RT astar eklemek " Bio-dU-dT25 ". PCR cycler 70 ° C'de 5 min için ısı ve RT 5 dk. için terk
  2. 1 µL 10 mM dNTPs, 4 µL 5 x transkriptaz arabellek, 1 µL 0.1 M DTT, 1 µL RNase inhibitörü ve 1 µL transkriptaz ekleyin. Mix ve PCR cycler 80 ° C'de 10 dk 55 ° c ve 10 min için tepkiler ısı. Buz üzerinde veya-80 ° c daha uzun depolama için devam.

6. Sindirim urasil DNA Glycosylase enzim karışımı ile

  1. damlalıklı 100 µL Streptavidin-boncuk 1,5 mL şişe içine 800 µL biotin bağlayıcı arabelleğe resuspend ve yer manyetik bir raf. Tüpler 2 - 3 kez tersine çevirin. Ne zaman açık arabellek kaldırın. Çamaşır adımı yineleyin. Boncuk 200 µL biotin bağlayıcı arabelleğe resuspend.
  2. Boncuk çözüm ters transkripsiyon tepki ekleyin ve dönen bir tekerlek üzerinde 4 ° C'de 20 dk kuluçkaya. Yıkama 2 x biotin bağlama ile tampon gibi boncuk adım 6.1 ve 2 x on tampon ile manyetik bir raf. Boncuk 50 µL on arabellekte resuspend, 2 µL urasil DNA glycosylase enzim karışımı ekleyin ve aralıklı karıştırma ile bir mikser 37 ° C'de 1 h kuluçkaya.
  3. Ekle 50 µL H 2 O, RNase h 11 µL tampon ve tepkileri için 1 µL RNase H. Manyetik bir raf üzerine 20 dk. yer boruları için 37 ° C'de kuluçkaya ve yeni bir tüp cleaved cDNA içeren sıvı transfer
  4. cleaved cDNA arındırmak.
    1. Ekleyin 550 µL arabelleği PB PCR arıtma Takımı'ndan bölünme reaksiyonlar. 3 M sodyum asetat, pH pH düşürmek için 5,2 10 µL ekleyin. Tepkiler yük en az elüsyon spin sütunlar ve spin 17.000 x g 1 dk.
    2. Akış yoluyla
    3. eklemek 750 µL arabelleğe PE sütunlar ve 17.000 x g 1 dk. spin atmak. 17.000 x g Kuru için 1 dakika için sütunları spin. Sütunları bir 1,5 mL flakon aktarmak, 16 µL H 2 O ve 17.000 x g 1 dk. spin gerçekleşti tepkiler için 7 µL bir birime konsantre için 8 dakika vakum yoğunlaştırıcı eklemek.

7. Ligasyonu 5 ' 5 bağdaştırıcılarına ' cDNA ucunun

  1. izole cDNA için 3 µL 10 x T4 RNA ligaz 1 arabellek, 3 µL 10 mM ATP, 15 µL eklemek PEG­-8000, 1 µL 50 µM " revDA5 " oligo ve 1 µL yüksek konsantrasyon T4 RNA ligaz 1. 20 h. eklemek 70 µL için 24 ° c H 2 O her tepki için kuluçkaya. Örnekleri-20 ° C'de bu noktada saklı.

8. PCR, amplifikasyon kütüphaneler ve Boyut seçimi pilot

  1. bir pilot reaksiyon, Kütüphane amplifikasyon veya üssel faz içinde ulaşmak için döngüleri PCR en uygun sayısı belirlemek.
    1. Damlalıklı 25 µL DNA polimeraz mix, 20 µL ligasyonu tepki, 2 µL H 2 O, 1,5 µL 10 µM ileri PCR astar (RP1) ve 1.5 µL 10 µM ters PCR dizini astar 200 µL PCR tüp içine.
    2. Aşağıdaki programla cycler çalıştırın: 3 dk. 20 20 döngüsü tarafından takip 95 ° C s 98 ° C, 20 s 67 ° C ve 30 s 72 ° C. 7 toplamak µL aliquots 6, 8, 10, 12, 14, 16 ve 18 döngüleri cycler doğrudan dan sonra. Arabellek (% 50 gliserol, % 0.05 Ksilen cyanol) yükleme x 1 µL 10 ekleyin. Not: Lütfen eğer barkod birleştirirken çoğullama kullanarak tedarikçinin önerileri izleyin.
    3. Ayrı ürünler üzerinde % 2 özel küçük yuva, 1:10, floresan yeşil boya 00 seyreltme içeren 1 x TBE arabellekte jel.
      1. Yük aliquots üzerinde % 2 özel jel ve jel 100 volt 15 dk. Visualize geçiş PCR ürünlerinin bir jel dokümantasyon sistemde çalışacak.
  2. İki kez pilot reaksiyon ( Şekil 2) için kullanılan birimleri ile büyük ölçekli bir PCR reaksiyonu için pilot reaksiyon üstel amplifikasyon başında döngü sayısı kullanın.
    1. İçin büyük ölçekli PCR reaksiyonları, konsantre ve tepkiler ilk PCR arıtma kiti ile desalt ve 1 x TBE tampon % 2 özel jeller üzerinde geniş yuva ürünlerde ayrı.
  3. 200-350 nt DNA içeren jel dilimlerini dışarı kesmek ürünleri. Jel, RT chaotropic arabellek için 30 dakikaya kadar kavrulur. DNA jel dilimleri bir jel ekstraksiyon kiti ile ayıklamak. A-zengin DNA 9 bağlama içinde önyargı önlemek için 50 ° c ısı değil.
  4. Gönder sıralama için.
    Not: Genellikle 50 döngüleri tek-okunur (SR50) yeterlidir (bkz, örneğin için https://www.illumina.com/technology/next-generation-sequencing.html).

9. Veri işleme

Not: elde edilen sıralama veri (fastq formatında) gitlab depo (https://git.scicore.unibas.ch/zavolan_public/A-seq2-processing) yazılımlarının işlenir. Analiz dört ana adımları içerir: (1), yükleme (2) bir sanal ortam, git havuzu analizi ile başlatılması (3) belirli parametreleri ayarlama yapılandırma dosyası ve (4) indirme ‘ snakemake ’ 10. tek bir komut için adım 4'te yapılan tüm analiz gerekir. Analiz ayrıntılı adım adım açıklamasını gitlab depo README dosyasında bulunabilir ve kısa bir açıklama aşağıda mevcuttur. Tüm bireysel işlem adımları halk için elde edilebilir araçlar, dış kaynaklardan gelen ya da yürütme tamamlandı veya şirket içinde hazırlanmış. Hesaplamalı boru hattı bir anakonda tabanlı 11 python 3 sanal ortam snakemake paket kullanılabilir 10 ile bağlıdır. Üstünde makine Unix benzeri işletim sistemi ile çalışır ve CentOS 6.5 işletim sistemi yüklü olan bir Linux ortamı ve 40 GB kullanılabilir RAM test edildi. Yazılım bağımlılıklarının otomatik olarak sanal ortamı içinde kontrol edilir. Aşağıdaki genel kullanıma sunulan yazılım araçları gerekli ve böylece ortamı ile birlikte yüklenen: snakemake (v3.9.1) 10, fastx araç seti (v0.0.14) 12, STAR (v2.5.2a) 13 , cutadapt (v1.12) 14, samtools (v1.3.1) 14 , 15, bedtools (v2.26.0) 16 , 17.

  1. Veri ön işleme'den okuyan cDNAs
    Not: sıralama derinlik çalışmaları arasında değişiklik gösterebilir ve enstrüman bağlı olarak bir örnek verileri birden fazla sıra dosya bölünebilir. Bu durumda ise, bir örnek için aşağıdaki adımlarda kullanılır tek bir giriş dosyasında karşılık gelen dosyaları birleştirin.
    1. Dosya fastq fasta biçimine.
    2. Özü okur doğru yapısı (3 thymidines okuma pozisyonlarda 5, 6 ve 7).
      Not: doğru şekilde yukarıda açıklanan deneysel protokolüne göre hazırlanan bir okuma bir yapıya sahip olmalıdır (5 ' sonu): 4-nükleotit barkod - 3 thymidines - transkript 3 Kompleman ters ' son.
    3. Sırası Açıklama satırı başlangıç tetramer hakkında bilgi depolamak.
      Not: Tetramer amplifikasyon eserler daha sonra analizde düzeltilmesi kolaylaştırır benzersiz bir moleküler tanımlayıcı (UMI) olarak hizmet vermektedir.
    4. İlk yedi nükleotit okuma kaldırmak ' s 5 ' son.
    5. Sırası ve UMI amplifikasyon eserler okuma aynı ile yalnızca bir kopyasını tutarak eklemek için düzeltin.
    6. 3 parçası kaldırmak ' bağdaştırıcı dizisi ve sonra geriye doğru tamamlayıcı sırası maçlar sonunda. Sadece uzunluk alt sınırı olan okuma ile devam (varsayılan: 15 nt).
      Not: uzunluğuna bağlı olarak özgün mRNA parçası ve sıralama döngüleri, 3 sayısı ' okunur sonu 3 parçası içeriyor olabilir ' adaptörü, bu adımda kaldırılır.
  2. Aşağıdaki kriterleri yerine getirmek tüm okuma ayıklamak: en fazla 2 bilinmeyen nükleotit (' N '), en fazla %80 olarak ve son nükleotit okuma değil A. Bu okuma analizde kullanılacak yeterli kalite olarak kabul edilir.
  3. Okuma genom spliced okuma işleme ve BAM biçiminde bir çıkış dosyası oluşturan bir araç ile eşleştirmek.
    1. Eğer STAR kullanılır, okuma eşlenmiş gereken Genom dizini ile bir dosya oluşturur. İnsan Genomu 35 GB bellek (RAM) bu adımı gerektirir.
    2. Harita okuma için genom.
      Not: (STAR özel notlar) yumuşak kırpma 3 eşleme zorlamak için devre dışı ' sonunda her okumak bu gibi nükleotit hemen ters yönde bölünme sitesinin.
  4. BAM bir yatak-dosya dönüştürme. Bir okuma birden çok konuma varsa, yalnızca en düşük ile mesafe düzenleme devam.
    Not: Belirli bir konumda eşlenmiş okunur kopya sayısını skor kullanılır. Birden çok konuma harita okuma kesirli yerlerin hangi için bir okuma haritalar 1/numarasına eşit ağırlığı her konuma sayılır.
  5. Bir büyük olasılıkla sıralama hatası değişir
  6. çöküşü defa okundu. İki ayrı okuma aynı konuma yeniden eşleştirirseniz (başlangıç ve bitiş konumları eşlemeleri aynıdır) ve onlar aynı UMI paylaşmak, onları PCR çoğaltmalar olarak ve yalnızca bir devam.
  7. Sonucuna tüm bireysel pre-mRNA 3 ' işleme siteleri son.
    Not: Bireysel bir okuma için bir 3 kanıt sağlar ' son ne zaman onun son dört nükleotit hatasız genom eşlenir. Hangi pozisyon 3 ' okuma haritalar sonu bölünme site olarak saklanır.
  8. Algıla 3 ' sonunda iç astar kökenli olduğu siteleri. Ne zaman 10 nt aşağı genom bölünme sitesinin tatmin site iç astar yapısı olarak tanımlamak aşağıdaki ölçütlerden biri: fazla altı olarak içerir, altı ardışık olarak veya bir aşağıdaki tetramers ile başlar: AAAA, AGAA, AAGA, AAAG .
  9. Bireysel 3 bir tablo oluşturmak ' yatak biçiminde işleme siteleri son.
  10. Tespit bağımsız olarak Poli(a) sitesi kümeleri düzenlenir.
    Not: Burada açıklanan adımları bir önceki yayın 5 ' te kullanılmaya başlanan yordamı izleyin.
    1. Başlatmak bireysel 3 toplayarak ' çalışmanın tüm örneklerinde elde edilmiştir işleme siteleri son.
    2. Bilinen Poli(a) sinyalleri 7 -60 için + 10 bölgede açıklama nükleotit bireysel her 3 çevresinde ' son işleme sitesi.
    3. Tespit Poli(a) siteleri aşağıdaki gibi arka planda her örnek yukarıda dile getirdi.
      1. Onların ham ifade geçerli örnek içinde belgili tanımlık yer sıralandı. Sitelerin listesini yukarıdan genom önceden tanımlanmış bir mesafe içinde yer olmaları durumunda alt sırada yer bir daha yüksek dereceli siteyle ilişkilendirme yukarıdan aşağıya doğru çapraz geçiş (varsayılan: 25 nt up - veya karşıdan akış) üst düzey siteden.
        Not: tüm düşük rütbeli siteler yüksek rütbeli bir site ile ilikili tüm bu sitelerin belgeleyen okuma sayısı, Ifade olduğu küme tanımlamak.
      2. Bu kümeler sıralama ifadesi tarafından ve kümeleri listesini yüksekten en düşük ifade, bir ek açıklama eklenen Poli(a) kümeleriyle yüzdesi sinyal açılan bir önceden tanımlanmış eşik (aşağıda ifade eşik c belirlenmesi için çapraz geçiş yapma Varsayılan: % 90'ı).
      3. Atmak herhangi bir küme kesme aşağıdaki sitelerden.
    4. Küme yakından aralıklı 3 ' sona örnekler üzerindeki elde edilen sitelerinin.
      Not: Sıralama 3 ' siteleri ilk örnekleri destekleyen sayısını ve normalleştirilmiş toplamı göre işleme sonunda okumak sayısı (başına okur milyon (RPM)) örnekleri arasında. Listenin yukarıdan aşağıya doğru onların mesafe yüksek rütbe siteye önceden tanımlanmış bir sınırdan daha büyük olduğunda alt sıralarda yer alan siteler daha yüksek sırada sitelerle ilişkilendirme üstten geçme (varsayılan: 12 nt). Ne zaman herhangi oluşturan 3 ' son site bir ek açıklama eklenen Poli(a) sinyal ile çakışıyor veya doğrudan, karşılık gelen küme iç astar algılamak daha fazla kontrol için işaretlenmiş Poli(a) uyarısı vardır.
    5. Birleştirme Poli(a) site kümeleri.
      Not: bir küme olarak sözde iç astar aday olarak işaretlenmesi, bu iki kümeyi Poli(a) sinyallerini paylaşıyorsanız bir aşağı akım kümede birleştirilmiş veya kümenin en aşağı akım sitedeki en azından bulunan bir Poli(a) sinyale sahipse muhafaza akıntıya karşı mesafe (varsayılan: 15 nt). Son olarak, yakından aralıklı kümeleri Eğer birleştirilir: (i) aynı Poli(a) signal(s) paylaştıkları veya (ii) elde edilen küme aralığını en fazla olamaz (varsayılan: 25 nt).
    6. Saklamak tüm 3 okuma sayısı kümeleri ile normalleştirilmiş Toplam yatak-dosya biçiminde ' sona siteler puan olarak her kümedeki.

Representative Results

Poli (A)-RNA içeren izole kültürlü hücrelerden alkalin hidroliz tarafından parçalanmış ve cDNAs ile ters transkripsiyon oligo(dT) astar ile yapılmıştır. Elde edilen cDNA streptavidin boncuk üzerinde immobilize, dU urasil belirli eksizyon tepki olarak i ciddi, bağdaştırıcıları 5' tane ve biter 3' cleaved parça ve ekler sıralı. Şekil 1 deneme grafik bir özetini gösterir.

HeLa ve HEK293 hücreler için 106 hücre protein kodlayıcı genlerin yordamın sonundaki büyük çoğunluğu için Poli(a) siteleri tanımlamak yeterliydi. Ancak, diğer hücre türleri veya doku deneyde kullanılan hücre sayısı olarak tanımlanan Poli(a) sitelerin sayısı doygunluk test etmek gerekli olabilir için artırır. Pilot PCR temsilcisi sonuçlarını adım ve DNA parçası sıralama önce örnek analizi Şekil 2' de gösterilmiştir.

Şekil 3 Sequencer'ı elde edilen ve genom için eşlenmesi hazırız kalite kontrol, bağdaştırıcı kesilmiş okuma ile biten fastq dosyasından başlayarak, sayısal analiz, ön işlem adımları gösterir. Şekil 4 belirli bir örneğinde tanımlanan siteler işleme mRNA 3' ucu katalog karşılık gelen genom ve son okuma eşleştirmeyle ile başlayın çözümleme adımları gösterir. Ne zaman birden fazla örnekleri analiz edilir, ek adımlar 3' ucu bireysel örnekleri bulunan siteleri işleme maç ve onların bereket örnekler üzerindeki rapor için devam etmektedir. Aşağıdaki adımları şekil 5' te gösterilmektedir.

Böylece, örnekleri sıralı bir kez okumak eğe (fastq biçiminde) kullanılabilir işleme boru hattı elde edilen sıralama analizi basittir. Örnekleri hakkında bilgi yapılandırma dosyasına ekledikten sonra boru hattı yürütülmesini çıktı dosyaları iki ana tür neden olur: 1) yatak-dosyaları ile tüm 3' işleme siteleri tespit bireysel örnekleri (örneğin "sona sample1.3pSites.noIP.Bed.gz") ve 2) çalışmanın tüm örnekleri arasında tüm Poli(a) sitesi kümeleri (clusters.merged.bed) dosyasıyla yatak. Çıkış tüm okur (örneğin "sample1. tek tek her örnek için genom koordinatları da içerir STAR_out/Aligned.sortedByCoord.Out.bam"), daha sonra görülebilir bir genom tarayıcı IGV16gibi. Okuma profillerini görsel muayene genellikle Poli(a) siteleri genom ve çalışma odasında yapılmıştır belirli tedirginlikler üzerine oluşan değişiklikleri dağıtım ilk bir bakış sağlar. Örneğin, şekil 6 ' da belirli bir gen yanıt knock-down HNRNPC protein olarak gösterilir.

Bu genom çapında dağıtımları özetleri (Tablo 1) mevcuttur. Özellikle, kesirler sitelerin belirli ek açıklama eklenen özellikleri ile üst üste "sayar/annotation_overlap" dizinindeki çıktı dosyaları içeren (gtf dosyasından giriş olarak sağlanan; açıklamalı vardır: 3' UTR, terminal exon, exon, intron, intergenic). Son olarak, her örnek için bireysel işlem adımları sonuçları da (örneğin "sample1.summary.tsv") kaydedilir. Bu numaralarını içerir: yüksek kaliteli ham okuma her örnek, 5' uç beklenen yapıya sahip okuma, tam PCR yinelenenleri daraltma sonra kalan okur okur 9.2, bir adımda tanımlanmış ölçütlere göre eşlenen genom benzersiz olarak okur (bkz. bu sıralama hatayla sonuçlanan daraltma sonra adım 9.5), birden çok eşleme okur (bkz. bu sıralama hatayla sonuçlanan daraltma sonra adım 9.5), siteler siteleri işleme her örnek, ham 3' sonunda işleme (değil kümelenmiş) 3' zor kısım iç astar aday benzersiz 3' tüm örnekleri iç astar adaylar ve Poli(a) sitesi kümelerinin son set olmadan sitelerden işlem sonunda.

Figure 1
Şekil 1: A-seq2 Protokolü'nün ana adımları. Tek tek adımları rakam sol tarafında gösterilir. INSERT RNA parçaları ters transkripsiyon sonra açmak için cDNA kırmızı yeşil çizgiler olarak tasvir edilir; bağdaştırıcıları açık mavi veya turuncu renkte görünür. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 2
Şekil 2: Pilot PCR ve nihai ürün profili. (bir) Aliquots PCR reaksiyon gelen farklı döngüsü sırasında toplanan ve % 2 özel jeller üzerinde ayrılmış. Sayılar sola nükleotit DNA merdiven ilgili gruplarından boyutunda gösterir. Bu deneyde 12 devir (*) büyük ölçekli PCR reaksiyon için seçilmiştir. (b) bir örnek boyutu sonra örneği seçimi yaklaşık 280 nükleotit bir ortalama büyüklüğü ortaya bir parça boyutu Çözümleyicisi üzerinde çalıştırın. Sayılar sola [FU] göreli sinyal yoğunluğu gösterir. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 3
Şekil 3: okuma sıralama ön işleme taslağını. Fastq dosyaları sıralama araç ilişkili yazılımı tarafından oluşturulan okuma ile ilgili genom eşleştirilir yüksek kaliteli okuma tanımlamak için işlenir. Şekilde tek tek adımları giriş/çıkış tayini "Veri işleme" bölümünde açıklanan protokol tek tek adımları bağlantıları olan boru hattı gösterilmiştir. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 4
Şekil 4: anahat sırası işleme, işleme siteleri eşleme adım genom bireysel 3' son nesil için okumak. Boru hattı i bağlantıları olan tek tek adımları giriş/çıkış tayini şekil gösterir"Veri işleme" bölümünde açıklanan protokol adımlardan kaynaklandığıdır. Kullanıcıya teslim ana çıkış dosyası kalın olarak işaretlenir. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 5
Şekil 5: anahat siteleri sıralama co düzenlenmiş 3' ucu kümeleri oluşturmak için geçen adımları. Şekilde tek tek adımları giriş/çıkış tayini "Veri işleme" bölümünde açıklanan protokol tek tek adımları bağlantıları olan boru hattı gösterilmiştir. Ana çıkış dosyası kalın olarak işaretlenir. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 6
Şekil 6: örnek sonuçları 3' profilinin son işleme okuma boyunca IGV 16 genom tarayıcıda gösterilen NUP214 gene, terminal exon. A-seq2 okuma denetimi siRNA ile veya bir HNRNPC siRNA ile tedavi HEK 293 hücrelerinin iki örneklerinden hazırlanmıştır. Tarafından analiz boru hattı açıklamalı Poli(a) siteleri belgelenen okuma IGV genom tarayıcı giriş olarak kullanılan BAM biçiminde kaydedildi. 3' biter okuma doruklarına mRNA için 3' Ensembl içinde açıklamalı biter eşleyin. Profilleri uzun 3' UTR izoformu HNRNPC knock-down üzerine artan kullanımı gösterir. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

si-denetim çoğaltmak 1 si-denetim çoğaltmak 2
ID: 29765 ID: 32682
ham okuma sayısı 44210258 68570640
kırpma ve süzme sonra geçerli okuma sayısı 14024538 21211793
benzersiz olarak eşleme okuma sayısı 6953674 13946436
için birden fazla loci eşleme okuma sayısı 2040646 2925839
siteleri işleme bireysel 3' ucu sayısı 1107493 1710353

Tablo 1: örnek çıktı analiz boru hattı. Tek tek adımları elde edildi okuma özetleri.

Discussion

Çekirdek ve pre-mRNA 3' son işlemesi söz konusu yardımcı faktörler çok sayıda buna bağlı olarak karmaşık Poliadenilasyon manzara modunda yansıtılır. Ayrıca, Poliadenilasyon Ayrıca transkripsiyon ve yapıştırma gibi diğer süreçler değişikliklere cevap veriyor. 3' sonu bölünme siteleri pre-mRNA genellikle 5' bölünme ürünleri için eklenen karakteristik Poli(a) kuyruğu göre tanımlanır. Pek çok yöntem oligo(dT) astar, Poli (A) belirli dönüştürme izin değişken uzunlukta kullanın-mRNA'ların cDNAs ters transkripsiyon tepki için içeren. Bu yaklaşımın ortak bir sorun A-zengin sıralarını manipülasyonun bölünme Siteler'de sonuçlanan iç astar olduğunu. Amaç bu artifakı numune hazırlama aşamasında aşmak için iki yöntem önerilmiştir. 3 P-seq yöntem 1' deki, bağdaştırıcıları Poli(a) kuyruğu uçlarına ardından kısmi RNase T1 sindirim ve tepki olarak tek deoxynucleotide TTP ile ters transkripsiyon bir tahta oligo yardımıyla özellikle bakmaksızın. Elde edilen poly(A)-poly(dT) heteroduplexes sonra RNase H ile sindirmek ve kalan RNA parçaları izole, bağdaştırıcıya da bakmaksızın ve sıralı. Daha basit ve zarif bir yöntemi, 2P-seq, sıralama tepki olarak kalan oligo(dT) streç tarafından aynı yazarlar 2bildirildi atlama bir özel sıralama astar kullanır. İlgili bir yöntemde, 3' 3, 5 çok uzun bir astar bize 45 okur ve Ts, aynı zamanda bir biotin içeren parçalanmış RNA, RNA molekülleri ile 50 nukleotid Poli(a) kuyruğu seçmek için sıkı yıkar ardından komplementer. Her ne kadar 3' okuma büyük ölçüde iç astar sıklığını azaltır, bu tamamen o 3ortadan kaldırmaz. İletişim kuralları doğrudan RNA sıralama için de teklif, ama kısa ve hata yüksek bir oranı elde edilen okur ve bu yaklaşım daha da gelişmiş 18,19,20olmamıştır. PolyA Seq ve ticari Quant Seq protokolleri dayalı oligo(dT) astar cDNA ikinci strand sentez 20için bir rasgele astar adım ile birleştirir. Şablon anahtarı ters transkripsiyon tepki Moloney fare lösemi virüs (MMLV) transkriptaz ile kullanımı cDNAs üretimi ile halkalı tek bir adımda yol açar ve böylece hiçbir bağdaştırıcısı dimer PAS-Seq ve SAPAS yöntemleri görünebilir 21 , 22.

A-seq2 yöntemi bir biotinylated oligo(dT) astar içinde yarilabilir bir nükleotit (dU) onun kullanımı standları dışarı burada sundu. Bu değişiklik melezleşmiştir oligo(dT), kitaplıkları hazırlanır önce izole parçaları oligo (dT)25 serisinden çoğunu kaldırılması poliadenile hedeflerle ve üç Ts, korunması zenginleştirici yardımcı programını birleştirir hangi Poli(a) kuyruğu önceki varlığını gösterir. Buna ek olarak, RNase H Poli(a) RNA molekülleri rastgele kaldırmak için kullanmak yöntemleri çeşitli olarak bırakın. A-seq2, 3' sondan Anti-anlamda iplikçiklerinin sıralama beri bölünme siteleri sonra NNNNTTT motifi ham sıra okuma başında bulunduğu olduğu tahmin edilmektedir. Randomize tetramers sadece ama aynı zamanda PCR güçlendirme eserler kaldırılması arama temel izin için hizmet vermektedir. Uzun UMIs da yerleştirilebilir. İç astar olasılığı A-seq2 içinde kalır ve hesaplama açısından ele, ilk 3' atarak genomically kodlanmış, A-zengin bir aşağı akım sıra ile ve daha sonra iç astar tarafından açıklanabilir 3' uç kümeler atarak tarafından biter A-zengin Poli(a) sinyal kendisi. Poli(a) siteleri benzersiz çok sayıda iletişim kuralları tarafından değişkenden son bir analizini A-seq2 için benzersiz olan siteler beklenen nükleotit dağıtım ve genler, diğer 3' için benzer içinde sıralama iletişim kuralları son konuma sahip gösterir.

A-seq2 kritik bir adımda poliadenile RNA yelpazesi ve ribozomal RNA'ların ve çeşitli küçük RNA'ların var. Bu en kolay bir mRNA-izolasyon Kiti (dT) oligo25 manyetik boncuklar ile yapılır. Prensip olarak, toplam RNA çözümleri de içeren fenol ile izole yüksek kalitede daha fazla seçim için mRNA-izolasyon kiti veya oligo (dT) özel tarafından tabi olmak RNA verir. A-seq2 içinde değiştirilebilir bir adım kısaltılmış veya RNA parçaları farklı boyutlarda elde etmek için genişletilmiş alkalin hidroliz ile tedavisidir. 3' dATP uçlarına 3' Poli(a) polimeraz tarafından RNA parçalarının yanı sıra verimli de önemlidir. Burada açıklanan iletişim kuralında, concatemerization tüp ligasyonu reaksiyonu sırasında önlemek için tüm RNA parçaları, bu tedavi uygulanır. Son olarak, burada bir bağdaştırıcıya 5' uç cDNA moleküllerin ligate için yaptığımız gibi RNA ligaz 1 normalde bir RNA ligaz kullanılmasına rağmen aynı zamanda etkin bir şekilde tek iplikçikli DNA, ligates unutmayın.

Böylece, A-seq2 bir verimli ve protokol siteleri işleme pre-mRNA 3' ucu tanımlanması için uygulanması kolay olmasıdır. Gelecekteki gelişmeler daha fazla iletişim kuralı ve gerekli malzeme miktarını azaltarak içerebilir. Sayısal veri çözümleme araçları daha fazla ilişkili Grup çok çeşitli protokolleri ile elde edilen okuma sıralama 3' ucu homojen işlenmesini etkinleştirmek.

Disclosures

Yazarlar ifşa gerek yok.

Acknowledgments

Yazarlar Bayan Béatrice Dimitriades hücre kültürü ile yardım için teşekkür. Bu eser İsviçre Ulusal Bilim Vakfı Hibe #31003A_170216 ve 51NF40_141735 tarafından desteklenmiştir (NCCR RNA & hastalığı).

Materials

Name Company Catalog Number Comments
Materials
Agarose, ultra pure Invitrogen 16500-500
2100 Bioanalyzer Agilent G2940CA
Cordycepin triphosphate (3’ dATP) SIGMA C9137
DNA low bind vials, 1.5 ml Eppendorf 22431021
Dulbecco’s Phosphate Buffered Saline SIGMA D8637
Dynabeads mRNA-DIRECT Kit Ambion AM61012
GR-Green dye Excellgen EG-1071 use 1:10,000 dillution
HiSeq 2500 or NextSeq 500 next generation sequencers Illumina inquire with supplier
KAPA HiFi Hotstart DNA polymerase mix KAPA/Roche KK2602
Nuclease free water Ambion AM9937
Poly(A) polymerase, yeast Thermo Fisher Scientific 74225Z25KU
Poly(A) polymerase, E.coli New England Biolabs M0276L
Polynucleotide kinase Thermo Fisher Scientific EK0032
QIAEX II Gel Extraction Kit Qiagen 20021
QIAquick PCR Purification Kit Qiagen 28104
QIAquick Gel Extraction Kit Qiagen 28704
RNA ligase 1, high concentration New England Biolabs M0437M includes PEG-8000
RNeasy MinElute RNA Cleanup kit Qiagen 74204
RNase H New England Biolabs M0279
RNasin Plus, ribonuclease inhibitor Promega N2618
Superscript IV reverse transcriptase Thermo Fisher Scientiific 18090050
Turbo DNase Ambion AM2238
USER enzyme mix New England Biolabs M5505
Dyna-Mag-2 magnetic rack Thermo Fisher Scientific 12321D
Thermomixer C Eppendorf 5382000015 Heated mixer with heated lid
MicroSpin columns GE-Healthcare 27-5325-01
Name Company Catalog Number Comments
Buffers
Alkaline hydrolysis buffer, 1.5 x Mix 1 part 0.1 M Na2CO3 and 9 parts 0.1 M NaHCO3. Add EDTA to 1 mM. Adjust pH to 9.2. Store aliquots at -20 °C.
5x poly(A) polymerase buffer Thermo Fisher Scientiific 100 mM Tris-HCl, pH 7.0, 3 mM MnCl2, 0.1 mM EDTA, 1 mM DTT, 0.5 mg/ml acetylated BSA, 50% glycerol
Biotin binding buffer 20 mM Tris­Cl pH 7.5, 2 M NaCl, 0.1% NP­40
TEN buffer 10 mM Tris­Cl, pH 7.5, 1 mM EDTA, 0.02% NP­40
Name Company Catalog Number Sequence
Oligonucleotides according to Illumina TruSeq Small RNA Sample Prep Kits, for GA-IIx and Hiseq2000/2500 sequencers Microsynth
revRA3 (RNA) Microsynth 5’ amino­ CCUUGGCACCCGAGAAUUCCA­ 3’
revDA5 Microsynth 5’ amino­ GTTCAGAGTTCTACAGTCCGAC GATCNNNN-3’
Bio-dU-dT25, RT primer Microsynth 5' Biotin-TTTTTTTTTTTTTTTTTTTTTTTTTT-dU-TTTVN 3' (V = G, A or C)
PCR primer forward, RP1 Microsynth 5' AATGATACGGCGACCACCGAGA TCTACACGTTCAGAGTTCTACAG
TCCGA 3'
PCR primer reverse, RPI1, barcode in bold Microsynth 5' CAAGCAGAAGACGGCATACGAG
ATCGTGATGTGACTGGAGTTCCT
TGGCACCCGAGAATTCCA 3'
Name Company Catalog Number Comments
Oligonucleotides according to Illumina TruSeq HT-Small RNA Sample Prep Kits, for HiSeq2000/2500 and NextSeq500 sequencers
HT-rev3A (DNA/RNA) Microsynth 5'-amino-GTGACTGGAGTTCAGACGTGTG
CTCTTCCrGrAUrC-3'
HT-rev5A Microsynth 5' amino-ACACTCTTTCCCTACACGACGCT
CTTCCGATCTNNNN 3'
Bio-dU-dT25, RT primer Microsynth 5' Biotin-TTTTTTTTTTTTTTTTTTTTTTTTTT-dU-TTTVN 3'
PCR primers forward (D501-506) Microsynth or Illumina 5'-AATGATACGGCGACCACCGAGAT
CTACAC[i5]ACACTCTTTCCCTACA
CGACGCTCTTCCGATCT -3'
PCR primers reverse (D701-D712) Microsynth or Illumina 5'-CAAGCAGAAGACGGCATACGAG A[i7]GTGACTGGAGTTCAGACGTG TGCTCTTCCGATC-3'
Documentation for Illumina multiplexing: Illumina https://support.illumina.com/content/dam/illumina-support/documents/documentation/chemistry_documentation/experiment-design/illumina-adapter-sequences_1000000002694-01.pdf

DOWNLOAD MATERIALS LIST

References

  1. Jan, C. H., Friedman, R. C., Ruby, J. G., Bartel, D. P. Formation, regulation and evolution of Caenorhabditis elegans 3'UTRs. Nature. 469, (7328), 97-101 (2011).
  2. Spies, N., Burge, C. B., Bartel, D. P. 3' UTR-isoform choice has limited influence on the stability and translational efficiency of most mRNAs in mouse fibroblasts. Genome Res. 23, (12), 2078-2090 (2013).
  3. Hoque, M., Ji, Z., et al. Analysis of alternative cleavage and polyadenylation by 3' region extraction and deep sequencing. Nat. methods. 10, (2), 133-139 (2013).
  4. Martin, G., Gruber, A. R., Keller, W., Zavolan, M. Genome-wide analysis of pre-mRNA 3’ end processing reveals a decisive role of human cleavage factor I in the regulation of 3' UTR length. Cell Rep. 1, (6), 753-763 (2012).
  5. Gruber, A. R., Martin, G., et al. Global 3' UTR shortening has a limited effect on protein abundance in proliferating T cells. Nat. Commun. 5, 5465 (2014).
  6. Kivioja, T., Vähärautio, A., et al. Counting absolute numbers of molecules using unique molecular identifiers. Nat. methods. 9, (1), 72-74 (2011).
  7. Gruber, A. J., Schmidt, R., et al. A comprehensive analysis of 3' end sequencing data sets reveals novel polyadenylation signals and the repressive role of heterogeneous ribonucleoprotein C on cleavage and polyadenylation. Genome Res. 26, (8), 1145-1159 (2016).
  8. Lingner, J., Keller, W. 3'-end labeling of RNA with recombinant yeast poly(A) polymerase. Nucleic Acids Res. 21, (12), 2917-2920 (1993).
  9. Quail, M. A., Kozarewa, I., et al. A large genome center's improvements to the Illumina sequencing system. Nat. methods. 5, (12), 1005-1010 (2008).
  10. Rahmann, S. Snakemake--a scalable bioinformatics workflow engine. Bioinformatics. 28, (19), 2520-2522 (2012).
  11. Analytics, C. Anaconda Software Distribution. Available from: https://continuum.io (2016).
  12. Lab, H. FASTX-Toolkit - Hannon Lab. Available from: http://hannonlab.cshl.edu/fastx_toolkit/index.html (2017).
  13. Dobin, A., Davis, C. A., et al. STAR: ultrafast universal RNA-seq aligner. Bioinformatics. 29, (1), 15-21 (2013).
  14. Martin, M. Cutadapt removes adapter sequences from high-throughput sequencing reads. EMBnet.journal. 17, (1), 10-12 (2011).
  15. Li, H., Handsaker, B., et al. The Sequence Alignment/Map format and SAMtools. Bioinformatics. 25, (16), 2078-2079 (2009).
  16. Robinson, J. T., Thorvaldsdóttir, H., et al. Integrative genomics viewer. Nat. Biotechnol. 29, (1), 24-26 (2011).
  17. Quinlan, A. R., Hall, I. M. BEDTools: a flexible suite of utilities for comparing genomic features. Bioinformatics. 26, (6), 841-842 (2010).
  18. Ozsolak, F., Platt, A. R., et al. Direct RNA sequencing. Nature. 461, (7265), 814-818 (2009).
  19. Yao, C., Biesinger, J., et al. Transcriptome-wide analyses of CstF64-RNA interactions in global regulation of mRNA alternative polyadenylation. Proc. Natl. Acad. Sci. U. S. A. 109, (46), 18773-18778 (2012).
  20. Lin, Y., Li, Z., et al. An in-depth map of polyadenylation sites in cancer. Nucleic Acids Res. 40, (17), 8460-8471 (2012).
  21. Shepard, P. J., Choi, E. -A., Lu, J., Flanagan, L. A., Hertel, K. J., Shi, Y. Complex and dynamic landscape of RNA polyadenylation revealed by PAS-Seq. RNA. 17, (4), 761-772 (2011).
  22. Fu, Y., Sun, Y., et al. Differential genome-wide profiling of tandem 3' UTRs among human breast cancer and normal cells by high-throughput sequencing. Genome Res. 21, (5), 741-747 (2011).
A-seq2 ile kütüphane hazırlık sıralama 3' ucu
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Martin, G., Schmidt, R., Gruber, A. J., Ghosh, S., Keller, W., Zavolan, M. 3' End Sequencing Library Preparation with A-seq2. J. Vis. Exp. (128), e56129, doi:10.3791/56129 (2017).More

Martin, G., Schmidt, R., Gruber, A. J., Ghosh, S., Keller, W., Zavolan, M. 3' End Sequencing Library Preparation with A-seq2. J. Vis. Exp. (128), e56129, doi:10.3791/56129 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter