Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

الكشف عن استعمار الإشريكيّة القولونية Enterohemorrhagic موريني واستضافة بنظام الإضاءة الحيوية غير الغازية في فيفو

doi: 10.3791/56169 Published: April 9, 2018

Summary

ويقدم بروتوكول مفصلاً نموذج الماوس ل enterohemorrhagic الاستعمار كولاي (الإشريكيّة) باستخدام البكتيريا المسماة الإضاءة الحيوية. يمكن المضي قدما الكشف عن هذه البكتيريا طرحه غير الغازية في فيفو التصوير النظام في الحيوانات الحية فهمنا الحالي لاستعمار القولونية.

Abstract

انتيروهيمورهاجيك كولاي (الإشريكيّة) O157:H7، الذي هو مسببات الأمراض المنقولة عن طريق الأغذية التي كاوسيسديارهيا، التهاب القولون النزفي (النظام المنسق)، ومتلازمة يوريمي الانحلالي (HUS)، استعمار للامعاء للبشر. إلى دراسة مفصلة إليه القولونية الاستعمار المجراة، من الضروري أن لديها نماذج حيوانية لرصد وقياس الاستعمار القولونية. نظهر هنا نموذج استعمار القولونية ماوس عن طريق تحويل بلازميد تعرب عن طرحه القولونية لرصد وقياس الاستعمار القولونية في معيشة المضيفين. إظهار الحيوانات تلقيح مع القولونية المسمى الإضاءة الحيوية إشارات طرحه مكثفة في الفئران بالكشف مع غير الغازية في فيفو نظام التصوير. بعد أيام 1 و 2 مرحلة ما بعد الإصابة، إشارات طرحه يمكن لا يزال يتم الكشف عن في الحيوانات المصابة، مما يوحي بأن استعمار القولونية في المضيفين لمدة يومين على الأقل. نحن أيضا إثبات أن موقع هذه الإشريكيّة طرحه للامعاء الماوس، على وجه التحديد في الأعور والقولون، من صور السابقين فيفو . قد يعمل هذا النموذج الاستعمار القولونية الماوس كأداة للنهوض بالمعرفة الحالية لآلية الاستعمار القولونية.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

O157:H7 القولونية هو ممرض الذي يسبب الإسهال1، HS2،3من الحص، و الفشل الكلوي الحاد حتى4 عن طريق الأغذية أو المياه الملوثة. الإشريكيّة انتيروباكتيريوم المسببة للأمراض، وكولونيزيس إلى الجهاز الهضمي من البشر1. عندما القولونية أولاً الانضمام إلى المضيف ظهارة الأمعاء، أنها حقن عوامل الاستعمار في الخلايا المضيفة من خلال نظام إفراز الثالث نوع (T3SS) يعمل بمثابة حقنه جزيئي الذي يحفز إرفاق ويمحوا الآفة (A/E) فيما بعد لفرض الالتصاق (الاستعمار)5. يتم ترميز هذه الجينات المشاركة في تشكيل الآفة A/E بمحور enterocyte إغاراته (لي) الإمراضية الجزيرة5.

الإضاءة الحيوية رد فعل المواد كيميائية المنتجة للضوء، في لوسيفراس الذي يحفز به لوسيفرين الركيزة لتوليد الضوء المرئي6. وتتطلب هذه العملية الانزيمية غالباً وجود الأوكسجين أو الادينوسين ثلاثي الفوسفات (ATP)6. الإضاءة الحيوية التصوير (BLI) يسمح الباحثين للتصور وتكميم التفاعلات المضيف الممرض في الحيوانات الحية7. ويمكنك تمييز BLI دورة العدوى البكتيرية في الحيوانات الحية باتباع هذه البكتيريا طرحه كما أنها تهاجر إلى غزو أنسجة مختلفة7؛ وهذا يكشف عن تطور ديناميكية للعدوى. وعلاوة على ذلك، يرتبط الحمولة البكتيرية في الحيوانات إلى إشارة طرحه8؛ وبالتالي، مؤشر مناسب لتقدير الظروف المرضية للحيوانات التجريبية بطريقة بسيطة ومباشرة.

بلازميد المستخدمة هنا يتضمن مشغل لوسيفراس، لوكسكدابي، ومن بكتيريا لومينيسسينس فوتورهابدوس أن ترميز الخاصة به الركيزة لوسيفراس7،9. بتحويل هذا بلازميد معربا عن لوسيفراس إلى البكتيريا، يمكن رصد عمليات الاستعمار والعدوى عن طريق مراقبة هذه البكتيريا طرحه في الحيوانات الحية. إجمالاً، BLI والبكتيريا المسماة الإضاءة الحيوية السماح للباحثين رصد أرقام البكتيرية والموقع وبقاء البكتيريا مع العلاج/العلاج بالمضادات الحيوية، والتعبير الجيني البكتيرية في استعمار العدوى/6، 7-قد تم الإبلاغ عن العديد من البكتيريا المسببة للأمراض أن نعرب عن مشغل لوكسكدابي لفحص تعبيرها دورة و/أو الجينات الإصابة بالعدوى. هذه البكتيريا، بما في ذلك أوروباثوجينيك كولاي10، الإشريكيّة8،11،،من1213، انتيروباثوجينيك كولاي (أبيك)8، المضادات رودينتيوم،من1415، typhimurium السالمونيلا16، الليستريه المستوحدة17، واليرسينيا انتيروكوليتيكا18،19، و20من الكوليرا، وقد وثقت.

وضعت عدة نماذج تجريبية لتسهيل دراسة القولونية الاستعمار في المختبر و في فيفو21،،من2223. ومع ذلك، هناك نقص في نماذج حيوانية مناسبة لدراسة الإشريكيّة الاستعمار في فيفو، وبالتالي قلة الناتجة من التفاصيل. لتسهيل دراسة الإشريكيّة الاستعمار إليه في فيفو، أنها ذات قيمة لبناء نماذج حيوانية لمراقبة وقياس الاستعمار القولونية في الحيوانات الحية في طريقة غير الغازية.

ويصف هذه المخطوطة نموذج استعمار القولونية ماوس يستخدم نظام تعرب عن طرحه لمراقبة الإشريكيّة الاستعمار على مر الزمن في معيشة المضيفين. إينتراجاستريكالي يتم تلقيح الفئران مع القولونية المسمى الإضاءة الحيوية وتم الكشف عن إشارة طرحه في الفئران مع غير الغازية في فيفو التصوير النظام13. الفئران المصابة مع القولونية المسمى الإضاءة الحيوية أظهرت إشارات طرحه كبيرة في الأمعاء بهم بعد يومين بعد الإصابة، مما يوحي بأن المستعمر هذه البكتيريا في الأمعاء المضيف بعد يومين بعد الإصابة. السابقين فيفو بيانات الصورة أظهرت أن هذا الاستعمار على وجه التحديد في الأعور والقولون من الفئران. باستخدام هذا النموذج القولونية الماوس، يمكن اكتشاف استعمار القولونية طرحه في المضيف المعيشة في فيفو نظام، لدراسة آليات تفصيلية لاستعمار البكتيريا المعوية، التي قد تشجع على زيادة فهم في التصوير التغيرات الفسيولوجية والمرضية التي يسببها القولونية.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

تنبيه: O157:H7 القولونية مستوى السلامة الأحيائية 2 (BSL-2) الممرض طبقاً لمراكز "مراقبة الأمراض" والوقاية منها تعليمات السلامة الأحيائية (https://www.cdc.gov/). لذلك، يجب إجراء كافة الإجراءات التجريبية التي تشمل القولونية في منشأة BSL-2. ارتداء قفازات ومعاطف المعمل أثناء إجراء التجربة. العمل في مجلس الوزراء السلامة معتمدة (BSC). تطهير على مقاعد البدلاء التجريبية قبل وبعد الإجراء التجريبي مع الإيثانول 70%. جميع الصكوك أو معدات أنه ينبغي تطهيرها القولونية الاتصال (أو يحتمل أن تكون جهات الاتصال) مع الإيثانول 70% أو التبييض. ينبغي أن تكون النفايات الملوثة (أو يحتمل أن تكون ملوثة) مختومة ويعقم بعناية. ارتداء قناع أو حماية العين، وضعف قفازات أو بذله، إذا لزم الأمر. الفئران الإناث عمرها 6 الأسبوع C57BL/6 تم شراؤها وصيانة في الجامعة مختبر الحيوان مركز من الوطني تشنغ الكونغ (NCKU). قد أقر في التجارب على الحيوانات برعاية الحيوان المؤسسية واستخدام اللجنة NCKU (الموافقة رقم 104-039).

1-المسمى بيولوسيفيراسي القولونية بكتيريا جيل

  1. ميكس 50 نانوغرام الحمض الخلوي الصبغي (DNA)، ميكروليتر 1 كل من 10 ميكرومترات إلى الأمام وعكس الإشعال، 2 ميكروليتر 2.5 مم deoxynucleotides (دنتبس)، 2 ميكروليتر 10 × المخزن المؤقت، 0.2 بوليميراز الدنا ميكروليتر، والماء المقطر المزدوجة العقيمة (ddH2س) لوحدة تخزين نهائي من 20 ميكروليتر تضخيم كاناميسين المضادة الكاسيت، نبتيي الجينات24. قالب الحمض النووي من pBSL18024، والتي يتم شراؤها من المشروع بيوريسورسي الوطنية (نبرب). بكر الشروط المدرجة في الجدول 1 وتسلسل التمهيدي متاح في الجدول 2.
  2. اضطر منتجات PCR لناقل استنساخ تجاري بعد عدة البروتوكول (انظر الجدول للمواد).
  3. المكوس في نبتيي الجينات جزء من ناقل الاستنساخ نسيي و سماي واستنساخ في pBBR1MCS4، الذي يهضم نسيي و سكاي من pAKlux29 لإنشاء بلازميد مقاومة كاناميسين، pWF27813.
  4. المكوس مشغل لوكسكدابي ، من لوسيفراس الإعراب عن بلازميد9، pAKlux2، سبيي-التردد وسي واستنساخ سبيي-التردد و سماي هضمها pWF278 لتوليد كاناميسين مقاومة والإعراب عن بلازميد، pWF27913لوسيفراس.
    ملاحظة: للاستخراج بلازميد وتنقية يفتت قصت، استخدام استخراج بلازميد التجارية وأدوات استخراج هلام، على التوالي. لأنزيم الهضم، مزيج 100 نانوغرام الحمض الخلوي الصبغي، العازلة 10 x ميكروليتر 1، 1 ميكروليتر كل إنزيم التقييد المحدد، والعقيمة ddH2س إلى إجمالي حجم 10 ميكروليتر، واحتضان في 37 درجة مئوية ح 2.5-3.
  5. تحويل بلازميد pWF279 كولاي O157:H7 EDL933 الخلايا المختصة انهانسر مع 2,500 الخامس لمرض التصلب العصبي المتعدد 4.
  6. احتضان خلايا البكتيريا المحولة في 1 مل بيرتاني لوريا (رطل) المتوسطة في 37 درجة مئوية ح 1.
  7. لوحة البكتيريا على صفيحة أجار رطل وتستكمل مع 50 ميكروغرام/مل من كاناميسين في 37 درجة مئوية ح 16-18.
  8. التحقق من إشارة طرحه بليت في فيفو التصوير الجهاز في اليوم التالي. اختيار مستعمرة واحدة من اللوحة والثقافة أنه في 3 مل رطل وتستكمل مع 50 ميكروغرام/مل كاناميسين في 37 درجة مئوية ح 16-18.
  9. إعداد البكتيريا المتوسطة الأسهم بتمييع والغليسيرول 100% في ddH العقيمة2س لجعل الحل والغليسيرول 30%.
  10. تجميد كاناميسين مقاومة البكتيريا O157:H7 EDL933 كولاي إيواء بلازميد لوسيفراس كمخزون بكتيرية في كريوفيال ملولبة كنسبة 1:1 من البكتيريا الحل والغليسيرول الثقافة و 30% في-80 درجة مئوية. تركيز والغليسيرول النهائي هو 15%.

2. إعداد البكتيريا القولونية طرحه للتطعيم عن طريق الفم

ملاحظة: المخطط الانسيابي الخط الزمني للإجراءات التجريبية لإعداد القولونية والماوس عن طريق الفم تزقيمية مدتها يرد في الشكل 1 للمساعدة في إعداد تجريبية.

  1. الانتصارات البكتيريا O157:H7 EDL933 كولاي إيواء بلازميد لوسيفراس على صفيحة أجار رطل مع 50 ميكروغرام/مل كاناميسين من المخزون-80 درجة مئوية. تنمو هذه البكتيريا ح 16-18 في 37 درجة مئوية.
  2. اختيار مستعمرة واحدة من لوحة بين عشية وضحاها والثقافة في المتوسط 3 مل رطل مع 50 ميكروغرام/مل كاناميسين ح 16-18 في حاضنة 37 درجة مئوية 220 لفة في الدقيقة.
  3. ثقافة فرعية البكتيريا (تخفيف 1: 100) إلى كاناميسين (50 ميكروغرام/مل) تحتوي على مرق رطل ح 2.5-3 في حاضنة 37 درجة مئوية 200 لفة في الدقيقة. (على سبيل المثال، إضافة 2 مل مثقف بين عشية وضحاها البكتيريا إلى متوسط 200 مل رطل مع كاناميسين (50 ميكروغرام/مل) تكمل).
  4. احتضان البكتيريا عن 2.5-3 ح وقياس قيمة الكثافة الضوئية في 600 نانومتر (OD600) حتى القيمة ما بين 0.9 إلى 1. عدد الخلايا البكتيرية في كثافة مستعمرة8 حوالي 10 وحدات تشكيل (زيمبابوي)/مل.
  5. الطرد المركزي إعادة استزراع البكتيريا في س 8,000 ز لمدة 30 دقيقة، 4 درجة مئوية.
  6. تجاهل المادة طافية دون التحريض بيليه البكتيريا وغسل بيليه مع 100 مل 0.9% عقيمة المالحة العادية بالانفعالات لطيف.
  7. كرر الخطوات من 2.5 و 2.6 مرة واحدة.
  8. بعد الغسيل، الطرد المركزي ثقافة البكتيرية في 8,000 ز خ ل 30 دقيقة، 4 درجة مئوية، وتجاهل المادة طافية بلطف.
  9. المكثفات بيليه في 100-fold مع المحلول الملحي العادي العقيمة 0.9 في المائة. على سبيل المثال، إذا كان يتم فصل البكتيريا 200 مل، إضافة 2 مل المحلول الملحي العادي تعليق بيليه.
  10. تأكيد البكتيريا زيمبابوي (وينبغي أن يكون حوالي 109 زيمبابوي/100 ميكروليتر بعد التكثيف في المحلول الملحي العادي) بطلاء البكتيريا مركزة من خلال تمييع مسلسل إذ25.

3-الماوس تزقيمية الشفوي من القولونية

  1. علاج الفئران C57BL/6 أنثى عمرها 6 الأسبوع مع الماء ستربتوميسين (5 غرام/لتر) من أجل ح 24.
  2. بعد 24 ساعة، قم بالتبديل إلى مياه الشرب العادية لآخر 24 ساعة قبل تزقيمية مدتها. بعد التعامل مع المياه العادية ح 24، الفئران جاهزة تزقيمية الشفوي من القولونية.
  3. ملء المحاقن مع 100 ميكروليتر القولونية البكتيريا عن طريق سحب مرة أخرى على المكبس. ضمان لا فقاعات الهواء في المحاقن. إزالة الفقاعات عن طريق العض المحاقن مع الأصابع.
  4. رفع الحيوان برفق ووضعه على قمة القفص مع الرعاية.
  5. أمسك الماوس بالذيل بعناية، وسوف قبضة الجزء العلوي من القفص الحيوان ومحاولة التحرك بعيداً.
  6. كبح الماوس برفق باستيعاب الجلد فضفاض من الرقبة ومؤخرة الحيوان بالإبهام والسبابة للحيلولة دون نقل رأس الماوس.
  7. أمسك الماوس في وضع عمودي لإدراج إبرة تزقيمية مدتها وضمان رأس الماوس المعطل تداولها والعمودي.
  8. أدخل إبرة تزقيمية مدتها في الفم الماوس بعد سقف الفم وتحريك لأسفل إلى المريء والمعدة.
  9. عند الإبرة المدرج نصف أو ثلثي طول في الماوس، حقن البكتيريا القولونية 100 ميكروليتر، التي تحتوي على حوالي 109 خلايا زيمبابوي.

4-التصور

  1. بعد تزقيمية الشفوي، الكشف عن الإشارات طرحه في أيام 1 و 2.
  2. قبل دراسة الإشارات طرحه من الحيوانات، تخدير عليها قبل وضعها في دائرة isoflurane 2.5% مع الأكسجين 1.5 لتر في الدقيقة.
  3. انتظر لمدة 2-5 دقائق حتى تصبح جميع الفئران فاقداً للوعي وتوقف نقل. الحيوانات على استعداد للكشف في فيفو للإضاءة الحيوية.
  4. الكشف عن والصورة إشارات طرحه من الحيوانات التي في فيفو نظام التصوير. الرجاء مراجعة القسم 5 "الحصول على البيانات" لتشغيل البرنامج. وتخضع جميع الحيوانات أثناء عملية التصوير، إمداد المستمر isoflurane 2.5% مع الأكسجين 1.5 لتر في الدقيقة.
    1. انقر فوق ملف > التركيز يدوياً ويعيش على الماوس.
    2. تحديد كثافة التعرض الوقت والليزر.
    3. انقر فوق الحصول على > التقاط.
  5. لتصوير السابقين فيفو ، euthanize الفئران بخلع عنق الرحم وإزالة الأمعاء أسرة من الفئران المصابة. ضع الأمعاء في طبق بتري 9-سم والصورة في فيفو نظام التصوير. الإعداد هو نفسه في فيفو التصوير إلا إذا تم تعيين حقل الرؤية ألف/باء الرجاء مراجعة القسم 5 "الحصول على البيانات" للحصول على التفاصيل.
    ملاحظة: الأسلوب للتفكك عنق الرحم: كبح جماح الفئران أعلى القفص باستيعاب الذيل مع يدا واحدة حتى أن الحيوانات قبضة القفص. ضع قلم علامة أو الإبهام والإصبع الأول من ناحية أخرى ضد الجزء الخلفي الرقبة في قاعدة الجمجمة. بسرعة قدما باليد أو كائن أثناء تقييد الرأس وسحب إلى الخلف باليد عقد الذيل.
    التحقق عن كثب لتأكيد اعتقال الجهاز التنفسي، ولا نبض القلب.

5. الحصول على البيانات

ملاحظة: يتم سرد البرامج المستخدمة للحصول على البيانات في الجدول للمواد.

  1. للحصول على الصور، افتح "لوحة التحكم اقتناء" البرمجيات (الشكل 2).
  2. حدد "الإنارة"، "صورة"، و "تراكب".
  3. تعيين وقت التعرض "تلقائي". تعيين Binning أنها "متوسطة".
  4. تعيين ƒ/إيقاف ك 1 للإنارة و 8 للصورة. ضوابط ƒ/إيقاف تلقي كمية الضوء الكاشف اتفاقية مكافحة التصحر.
  5. تعيين مجال الرؤية استناداً إلى حقل الصور التي تهم حيازة. الخيار "د" يمكن أن تناسب خمس عمرها 6 الأسبوع الفئران وصورة لهم جميعا في وقت واحد. يمكن الصورة "ج" فئران عمرها 6 الأسبوع ثلاثة في حقل واحد.
  6. مرة واحدة الفئران/النماذج جاهزة للتصوير، انقر فوق "الحصول على" للحصول على الصور.
  7. فتح بيانات الصورة التي تم الحصول عليها.
  8. فتح "لوح ألوان أداة" لوحة (الشكل 3).
  9. حدد أدوات العائد على الاستثمار. ونحن نوصي الدائرة (من أقصى اليسار) نطاق منطقة طرحه على الصور (الشكل 4).
  10. انقر فوق "في تدبير رويس" (رمز القلم الرصاص) لقياس كثافة طرحه السطحية (الشكل 3). تظهر لوحة "قياس العائد على الاستثمار" وقيم القياس الكمي (الشكل 5).
  11. استخدام "تكوين القياس" على الجانب الأيمن من لوحة "قياس العائد على الاستثمار" لتحديد القيم/المعلومات المطلوبة (الشكل 6)، وإلا انقر فوق "تصدير" تصدير هذا الجدول البيانات وحفظها كملف.csv (الشكل 5).
  12. استخدام القيم الموجودة في العمود "مجموع الجريان (p/s)" كتقدير كثافة طرحه في ملف.csv.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

نحن تدار الإضاءة الحيوية المسمى القولونية (~ 109 الخلايا البكتيرية) للفئران C57BL/6 الإناث 6-الأسبوع القديمة قبل تزقيمية الشفوي. بعد التطعيم عن طريق الفم القولونية للفئران داخل ح 1، بحثت الحيوانات لإشارة طرحه في فيفو نظام التصوير كما هو مبين في الشكل 7. وأظهرت النتائج إشارة قوية بطرحه في الفئران تزقيمية مع القولونية المسمى الإضاءة الحيوية. قمنا بفحص الإشارات في 2 يوما بعد الإصابة. كما هو موضح في الشكل 8 أ، تلقيح الفئران مع EDL933 القولونية البرية من نوع الإضاءة الحيوية المسمى أظهرت إشارات طرحه مكثفة حتى بعد 2 يوما بعد العدوى، الذي اقترح القولونية المستعمر في المضيفين قبل يومين. ونحن أيضا إينتراجاستريكالي مصابة EDL933 الإضاءة الحيوية المسمىΔrfaD (ΔrfaD) للفئران (الشكل 8 أ). هذا المسخ، انشق في lipopolysaccharide (LPS)، لقد ثبت للحد من الاستعمار في البلد المضيف في دراستنا السابقة. كما هو موضح في الشكل 8 أ، هناك لا توجد إشارة طرحه اكتشفت في ΔrfaD-الفئران المصابة، مما يوحي بأن هناك لا أو أقل من البكتيريا استعمرت الخلايا في الفئران. التحديد الكمي لإشارة الفلورسنت يرد في الشكل 8B. بعد ذلك، تم تحديد مكان هذه البكتيريا المسماة الإضاءة الحيوية. كانت التضحية الفئران المصابة بمعاملة إنسانية وإزالة الأمعاء أكملها. أمعاء الفئران 2 يوما بعد الإصابة كانت متوضعة على أطباق بيتري 9 سم وتصويرها السابقين فيفو (الشكل 9 ألف). الأنسجة المعوية المسمى الإضاءة الحيوية EDL933 إصابة الفئران كشفت عن زيادة كبيرة في إشارات طرحه في الأعور والقولون، التي توحي بأن هذه الإشريكيّة طرحه المستعمر في الأعور والقولون من الفئران المصابة لمدة يومين في أقل. وفي المقابل، انخفضت الفئران المصابة بالإضاءة الحيوية المسمى ΔrfaD (الشكل 9 ألف)، وكشف إشارة طرحه في الأنسجة المعوية بهم، وما يتسق مع الصورة في فيفو (الشكل 8 أ ). التحديد الكمي لإشارة الفلورسنت يرد في الشكل 9B.

Figure 1
الشكل 1 : الخط الزمني مخطط تدفق إعداد تجريبية.
نظرة عامة حول توقيت اللازمة لإعداد البكتيريا القولونية طرحه والفئران مع ستربتوميسين بريتريات. (أ) الإشريكيّة إعداد. (ب) إعداد الفئران. الرجاء انقر هنا لمشاهدة نسخة أكبر من هذا الرقم-

Figure 2
الشكل 2 : في فيفو لوحة التحكم اقتناء نظام التصوير-
قبل التصوير عينات، افتح "لوحة التحكم اقتناء إيفيس". حدد "الإنارة"، "صورة"، و "تراكب". تعيين وقت التعرض "تلقائي". تعيين Binning أنها "متوسطة". تعيين ƒ/إيقاف ك 1 للإنارة و 8 للصورة. ضوابط ƒ/إيقاف تلقي كمية الضوء الكاشف اتفاقية مكافحة التصحر. وبمجرد عينات جاهزة للتصوير، انقر فوق "الحصول على" الحصول على الصور. الرجاء انقر هنا لمشاهدة نسخة أكبر من هذا الرقم-

Figure 3
الشكل 3 : "لوح ألوان أداة" لوحة.
وبعد الحصول على الصورة، استخدم لوحة "لوح ألوان أداة" لقياس كثافة طرحه. فتح "لوح ألوان أداة" لوحة وصورة البيانات. اختر واحدة من "أدوات العائد على الاستثمار" مجموعة إشارات طرحه على الصور. الرجاء انقر هنا لمشاهدة نسخة أكبر من هذا الرقم-

Figure 4
الشكل 4 : إشارة طرحه من العينة للقياس الكمي-
منطقة إشارة طرحه على الصور "أدوات العائد على الاستثمار". جميع إشارات طرحه المعروضة هنا في دائرة حمراء. الرجاء انقر هنا لمشاهدة نسخة أكبر من هذا الرقم-

Figure 5
الشكل 5 : قياس العائد على الاستثمار-
بعد الدوران حول إشارات طرحه والنقر فوق "تدبير رويس" على لوحة "لوحة أداة"، يتم عرض القيم كما هو موضح. قيم العمود "التدفق الكلي" (p/s) تستخدم لتحديد كثافة طرحه. الرجاء انقر هنا لمشاهدة نسخة أكبر من هذا الرقم-

Figure 6
الرقم 6 : إضافة معلومات مختلفة القياس الكمي-
بالنقر فوق "تكوين القياس" على الجانب الأيمن من لوحة "قياس العائد على الاستثمار"، يمكنك تحديد قيم أو معلومات القياس الكمي المطلوب. الرجاء انقر هنا لمشاهدة نسخة أكبر من هذا الرقم-

Figure 7
الشكل 7 : صورة تمثيلية للفئران بعد تلقيح مع طرحه القولونية.
صورة تمثيلية للفئران تلقيح مع القولونية طرحه قبل تزقيمية الشفوي ضمن ح 1. مقياس اللون يمثل التألق (خ ع/s/سم2). الرجاء انقر هنا لمشاهدة نسخة أكبر من هذا الرقم-

Figure 8
الشكل 8 : صور للفئران تلقيح مع القولونية المسمى الإضاءة الحيوية بعد أيام 2-
(أ) تمثل صورة من الفئران تلقيح مع طرحه البرية من نوع EDL933 القولونية و EDL933:ΔrfaD طريق تزقيمية الشفوي بعد يومين بعد الإصابة. (ب) التحديد الكمي لكثافة الإضاءة الحيوية من الفئران المصابة مع القولونية. أشرطة الخطأ تشير إلى الانحرافات المعيارية. تظهر الصور التمثيلية. جميع التجارب التي أجريت بشكل مستقل ثلاث مرات مع الحيوانات 2-3 في كل مرة، وأشرطة الخطأ تشير إلى الانحرافات المعيارية. قيم P-تدل نتائج التحليل الإحصائي باختبار t. مقياس اللون يمثل التألق (خ ع/s/سم2). الرجاء انقر هنا لمشاهدة نسخة أكبر من هذا الرقم-

Figure 9
الرقم 9 : صور للأنسجة المعوية في الفئران المصابة بالإضاءة الحيوية المسمى الإشريكيّة.
(أ) بعد التطعيم مع الإضاءة الحيوية المسمى القولونية وقد euthanized الفئران والأنسجة المعوية كاملة أزيلت وتصويرها السابقين فيفو2 أيام. تظهر الصور التمثيلية. (ب) التحديد الكمي لكثافة الإضاءة الحيوية في الأنسجة المعوية من الفئران المصابة مع القولونية. جميع التجارب التي أجريت بشكل مستقل ثلاث مرات مع الحيوانات 2-3 في كل مرة، وأشرطة الخطأ تشير إلى الانحرافات المعيارية. قيم P-تدل نتائج التحليل الإحصائي باختبار t. مقياس اللون يمثل التألق (خ ع/s/سم2). يمثل الشريط مقياس 1 سم. الرجاء انقر هنا لمشاهدة نسخة أكبر من هذا الرقم-

الخطوات درجة الحرارة الوقت عدد الدورات
تمسخ الأولى 95 درجة مئوية 10 دقيقة 1
تمسخ 95 درجة مئوية 30 ثانية 35
الصلب 58.4 درجة مئوية 30 ثانية
ملحق 72 درجة مئوية 1.5 دقيقة
التمديد النهائي 72 درجة مئوية 10 دقيقة 1
عقد 4 درجة مئوية 1

الجدول 1: بوليميريز سلسلة من ردود الفعل (الاسترداد) الشروط

اسم الإشعال التسلسل
نبتيي و 5 'CCTATGCATAATAATTCCGCTAGCTTCACG3'
نبتيي R 5 'GCTCCACCGATAATATTCCTGAGTCATACT3'

الجدول 2: تسلسل التمهيدي تستخدم لتضخيم نبتيي

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

وأفيد أن تتحول مع بلازميد لوسيفراس القولونية قد استخدمت لدراسة عن التعريب في المضيفين أو مورثة تعبير في فيفو8،،من1112. كما أبلغ نموذج مورين تظاهروا اليوم للكشف عن توقيت القولونية المستعمر والتعريب في المضيف مورين8. ومع ذلك، نحن نقدم البروتوكول من التفصيل كيفية إدارة التلقيح القولونية للفئران إينتراجاستريكالي وكيفية إعداد البكتيريا طرحه بعناية تزقيمية الشفوي. لمنصب رئيس الماوس وخاصة للماوس تزقيمية الشفوي من القولونية (الخطوة 3، 7)، أمر حاسم عندما يتم إدخال إبرة تزقيمية مدتها. إذا لم تكن الموضع عمودي، سيكون من الصعب تمرير الإبرة، وأنه ربما يمكن أن تصيب الماوس. في الخطوة 3، 8، عندما يكون إبرة تزقيمية داخل فم الماوس، اللسان سيرسي خارج الفم قليلاً. إذا هو واجه مقاومة عند تمرير الإبرة تزقيمية مدتها إلى المريء، وقف الأمام الإبرة وسحبها فورا. تغيير موقف إبرة للتأكد من أن يدخل الإبرة المريء. يمكن أن يدخل الإبرة القصبة الهوائية عند حدوث المقاومة، مما يؤدي إلى حقن البكتيريا في الرئتين بدلاً من المعدة.

تطبيق البروتينات الفلورية الخضراء (التجارة والنقل) باعتباره بيوسينسور الشائع في التجارب البيولوجية. ومع ذلك، باستخدام بروتينات فلورية خضراء كمراسل لمراقبة العدوى/استعمار الممرض في الحيوانات الحية بالتصوير في فيفو غير مستحسن، لأن امتصاص الهيموغلوبين والبروتينات والماء مرتفعة بين 200-650 نانومتر26، التي تتداخل مع التجارة والنقل (الإثارة 480 نانومتر، الانبعاثات 510 نيوتن متر)27. ولذلك، استخدام التجارة والنقل يمكن أن توقف الإشارات كمراسل للتصوير في فيفو خضاب الدم والبروتينات والماء في الحيوانات26. الأسفار (الجرد) القريبة من الأشعة تحت الحمراء هو مثالي للتصوير في فيفو لإطاره امتصاص حول 650-900 نانومتر28، الذي في منطقة أدنى معامل امتصاص الهيموغلوبين (< 650 nm) والمياه (> 900 نانومتر)26 ،28 . وعلاوة على ذلك، عندما الأنسجة تمتص الضوء، هناك فرصة للحث على أوتوفلوريسسينسي. عندما تتراوح أطوال موجية الإثارة والانبعاثات في إطار التجارة والنقل، فإنه يدفع أوتوفلوريسسينسي أكثر بكثير من نير29. يمكن تحسين استخدام قوائم الجرد الوطنية إشارة إلى نسبة الخلفية مقارنة بالتجارة والنقل من خلال القضاء على خلفية أوتوفلوريسسينسي29. لا تتطلب الإضاءة الحيوية الإثارة الطاقة لتوليد الضوء المرئي. يتوقف على رد فعل على تحفيز لوسيفرين الركيزة التي لها لوسيفراس الإنزيم وتوليد الضوء. حيث لا تتطلب الإضاءة الحيوية الضوء مباشرة في عينة، إشارة خلفية من عينة منخفض جداً. ولذلك، استخدام الإضاءة الحيوية كمراسل أكثر عمومية وأكثر سهولة للتصوير في فيفو . وفي المقابل، يتطلب fluorescence الإثارة الخفيفة للحث على ضوء الإشارات. عندما الأنسجة تمتص الضوء، هناك فرصة أن ضوء فلورسنت سوف تنبعث والحث على أوتوفلوريسسينسي حيث أن الإشارة إلى الضوضاء أعلى بالمقارنة بالإضاءة الحيوية.

النظر القولونية هي بطبيعة الحال أقل المستعمر في الفئران بالعدوى عن طريق الفم2،22، ممرض مخاطية طبيعية للفئران، تسمى المضادات رودينتيوم، وقد استخدمت لدراسة إليه الاستعمار إلى المضيف موريني بديلة بكتيريا22،30. كلا من الإشريكيّة و رودينتيوم جيم- استعمار مخاطية الأمعاء، والحث على تشكيل الآفات A/E في المضيف22،30. كما أنها تحتوي على الجزيرة الإمراضية لي، الذي يقوم بترميز T3SS وبروتينات المستجيب عدة الناجم عن الآفة A/E22،30. ولذلك، استخدام لوسيفراس الإعراب عن بلازميد كمراسل في رودينتيوم جيم للكشف عن أمراض الاستعمار ودراسة إليه الاستعمار عن طريق في فيفو نظام تصوير كان أيضا أفادت14، 15-ومع ذلك، حين الإصابة رودينتيوم C. الفئران نموذجا مفيداً للتحقيق في وظيفة T3SS وآلية الآفة A/E، رودينتيوم جيم- لا تحتوي على شيغا السمية (Stx)30، ومهيمن فوعة العامل الذي يسبب فشل كلوي في الإشريكيّة، لا سيما النمط المصلي المسيطر O157:H73. على الرغم من أن سلالة الإعراب عن Stx رودينتيوم C. وقد شيدت مؤخرا31، وأكثر واقعية لعدوى الإشريكيّة، أنها لا تتضمن الأخرى المحتملة من عوامل الفوعة القولونية التي تعتبر حاسمة بالنسبة للاستعمار و/أو الإصابة. وعلاوة على ذلك، أسهم رودينتيوم جيم- 67% الجينات، مع القولونية32، مما يوحي بأن الإشريكيّة قد تستخدم ضراوة متميزة من رودينتيوم جيم أثناء الاستعمار و/أو الإصابة.

تم تعديل لوسيفراس الإعراب عن بلازميد المستخدمة هنا، pWF27913، من pAKlux29 هو العمود الفقري الذي pBBR1MCS433. على الرغم من أن pBBR1MCS4 تم اختبارها وتطبيقها في مختلف البكتيريا33، من الأهمية بمكان لضمان مصدر النسخ المتماثل (أوري) من بلازميد هذا مناسبة للمضيف البكتيرية قبل استخدام هذا النظام القائم على بلازميد لوسيفراس للتجربة و مما يؤكد أن لوسيفراس هذا التعبير عن بلازميد يمكنك نسخ متماثل في المضيف البكتيرية. نحن نستخدم الإجهاد المضادات الحيوية للحفاظ على استقرار بلازميد في البكتيريا. عندما تدخل البكتيريا الحيوانات في غياب المضادات الحيوية، تم الكشف عن إشارة طرحه من البرية من نوع الإشريكيّة لمدة يومين على الأقل. ومع ذلك، لم نكن بعد الإصابة لمدة تزيد على يومين لأنه قد شهدنا بالفعل فرقا كبيرا في شدة الإنارة بين WT الإشريكيّة القولونية رفاد (الذي يقوم بترميز جينات المطلوبة لتوليف لبس سليمة القولونية) المسخ في 2 يوما. للحفاظ على بلازميد ستابلي في البكتيريا تحت غياب المضادات الحيوية، يمكن استخدامها10،pCM17 بلازميد34 لهذا الغرض. pCM17 ترميز نظام تقسيم بلازميد اثنين ومقتل بوستسيجريجاشونال إليه لضمان الحفاظ على بلازميد في البكتيريا في غياب المضادات الحيوية10،34. بلازميد pCM17 التي تحتوي على مشغل لوكسكدابي مدفوعا بالمروج أومبك يمكن الكشف عنها بواسطة إشارة طرحه على الأقل 7 أيام8. أسلوب بديل للحصول على بكتيريا تعبير طرحه مستمر في غياب المضادات الحيوية لإدراج لوكسابكدي الجينات في الكروموسومات البكتيرية35. ينقول et al. تستخدم فرانسيس إدراج كاسيت لوكسابكدي مشغل والمضادات الحيوية عشوائياً إدراجها في الكروموسوم من ستربتوكوكس نيمونيا للحصول على سلالة مستقر الإضاءة الحيوية35.

لدينا الدراسة السابقة13، نحن استخدمت هذا النظام النموذجي لدراسة الاستعمار القولونية في مضيف وقارن الفرق بين قدرة الاستعمار بين نوع البرية القولونية (WT) و المسخ13. عندما كانت تدار من الفئران المسخ رفاد القولونية طرحه، إشارات طرحه تضاءلت إلى حد كبير مقارنة بمن الإشريكيّة WT بعد يومين بعد الإصابة. ويوفر دليل على أن هذا النموذج موريني ويمكن تحليل أثر الطفرة القولونية الاستعمار في البلد المضيف. وعلاوة على ذلك، العلاجات العلاجية للحد من استعمار القولونية حل النظر في ذلك المحتملة لعدوى الإشريكيّة نظراً لاستخدام المضادات الحيوية هو بطلان5،36. ولذلك، أنها تستحق اختبار ما إذا كان يمكن استخدام هذا النظام النموذجي لدراسة فعالية العقاقير المضادة الاستعمار/علاجات ضد enterobacteria الاستعمار في البلد المضيف. ونحن نعتقد أن من الممكن باستخدام هذا النظام النموذجي، بالنظر في توقيت وموقع القولونية ليس فقط، ولكن أيضا أخرى الاستعمار enterobacteria فيفو. باستخدام هذا النموذج الحيواني، يمكن رصد عملية استعمار القولونية في الفئران ويمكن قياسها كمياً عبء الاستعمار في البلد المضيف لتحديد استعمار القولونية المكانية والزمانية في الحيوانات الحية. التصور والتقدير الكمي لاستعمار enterobacteria باستخدام هذا النموذج يجعلها أداة عظيمة للتحقيق وتحليل آليات الاستعمار انتيروباكتيريال الجميلة، وهكذا تعويض نقص البحوث الاستعمار و تحسين المعرفة الحالية.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

الكتاب ليس لها علاقة بالكشف عن.

Acknowledgments

ونعترف تشن تشونغ تشي من إدارة "البحوث الطبية"، المركز الطبي لمي تشي (تاينان، تايوان) للمساعدة في الماوس العدوى، والدعم المقدم من مركز جامعة تشينغ كونغ الوطنية الحيوانات المختبرية. هذا العمل معتمد من قبل "وزير العلوم" والتكنولوجيا (معظم) يمنح (الأكثر 104-2321-ب-006-019، 105-2321-ب-006-011،-005 and106-2321-ب-006) CC.

Materials

Name Company Catalog Number Comments
Shaker incubator YIH DER LM-570R bacteria incubation 
Orbital shaking incubator FIRSTEK S300 bacteria incubation 
pBSL180 source of nptII gene
pAKlux2 source of luxCDABE operon
T&A Cloning Kit Yeastern Biotech FYC001-20P use for TA cloning 
Nsi I NEB R0127S use for plasmid cloning 
Sca I NEB R0122S use for plasmid cloning 
Spe I-HF NEB R0133S use for plasmid cloning 
Sma NEB R0141S use for plasmid cloning 
T4 ligase NEB M0202S use for plasmid cloning 
Ex Taq TaKaRa RR001A use for PCR amplification
10X Ex Taq Buffer TaKaRa RR001A use for PCR amplification
dNTP Mixture  TaKaRa RR001A use for PCR amplification
PCR machine applied Biosystem  2720 thermal cycler   for PCR amplification
Glycerol SIGMA G5516-1L use for bacteria stocking solution
NaCl Sigma 31434-5KG-R chemical for making LB medium, 10 g/L
Tryptone CONDA pronadisa Cat 1612.00 chemical for making LB medium, 10 g/L
Yeast Extract powder Affymetrix 23547-1 KG chemical for making LB medium, 5 g/L
Agar CONDA pronadisa Cat 1802.00 chemical for making LB agar
kanamycin  Sigma K4000-5G antibiotics, use for seleciton
streptomycin  Sigma S6501-100G antibiotics, eliminate the microbiota in mice
EDL933 competent cell Homemade method is on supplemental document 
Electroporator MicroPulser for electroporation
Electroporation Cuvettes Gene Pulser/MicroPulser 1652086 for electroporation
High-speed centrifuge Beckman Coulter Avanti, J-26S XP use for centrifuging bacteria 
Fixed-Angle Rotor Beckman Coulter JA25.5 use for centrifuging bacteria 
Fixed-Angle Rotor Beckman Coulter JLA10.5 use for centrifuging bacteria 
centrifuge bottles Beckman Coulter REF357003 use for centrifuging bacteria 
centrifuge bottles Thermo Fisher scientific 3141-0500 use for centrifuging bacteria 
eppendorf biophotometer plus  eppendorf AG 22331 hamburg for measuring the OD600 value of bacteria
C57BL/6 mice  Laboratory Animal Center of NCKU
lab coat, gloves for personnel protection 
isoflurane  Panion & BF Biotech Inc. G-8669 for mice anesthesia, pharmaceutical grade
1ml syringe  use for oral gavage of mice
Reusable 22 G ball-tipped feeding needle φ0.9 mm X L 50 mm use for oral gavage of mice
surgical  scissors  use for mice experiment
Xenogen IVIS 200 imaging system Perkin Elmer IVIS spectrum use for bioluminescent image capture 
Living Image Software Perkin Elmer version 4.1 use for quantifying the image data

DOWNLOAD MATERIALS LIST

References

  1. Pennington, H. Escherichia coli O157. Lancet. 376, (9750), 1428-1435 (2010).
  2. Mayer, C. L., Leibowitz, C. S., Kurosawa, S., Stearns-Kurosawa, D. J. Shiga toxins and the pathophysiology of hemolytic uremic syndrome in humans and animals. Toxins (Basel). 4, (11), 1261-1287 (2012).
  3. Tarr, P. I., Gordon, C. A., Chandler, W. L. Shiga-toxin-producing Escherichia coli and haemolytic uraemic syndrome. Lancet. 365, (9464), 1073-1086 (2005).
  4. Obrig, T. G. Escherichia coli Shiga Toxin Mechanisms of Action in Renal Disease. Toxins (Basel). 2, (12), 2769-2794 (2010).
  5. Nguyen, Y., Sperandio, V. Enterohemorrhagic E. coli (EHEC) pathogenesis. Front Cell Infect Microbiol. 2, 90 (2012).
  6. Wiles, S., Robertson, B. D., Frankel, G., Kerton, A. Bioluminescent monitoring of in vivo colonization and clearance dynamics by light-emitting bacteria. Methods Mol Biol. 574, 137-153 (2009).
  7. Hutchens, M., Luker, G. D. Applications of bioluminescence imaging to the study of infectious diseases. Cell Microbiol. 9, (10), 2315-2322 (2007).
  8. Rhee, K. J., et al. Determination of spatial and temporal colonization of enteropathogenic E. coli and enterohemorrhagic E. coli in mice using bioluminescent in vivo imaging. Gut Microbes. 2, (1), 34-41 (2011).
  9. Karsi, A., Lawrence, M. L. Broad host range fluorescence and bioluminescence expression vectors for Gram-negative bacteria. Plasmid. 57, (3), 286-295 (2007).
  10. Lane, M. C., Alteri, C. J. S., Smith, S. N., Mobley, L. H. Expression of flagella is coincident with uropathogenic Escherichia coli ascension to the upper urinary tract. Proc Natl Acad Sci U S A. 104, (42), 16669-16674 (2007).
  11. Roxas, J. L., et al. Enterohemorrhagic E. coli alters murine intestinal epithelial tight junction protein expression and barrier function in a Shiga toxin independent manner. Lab Invest. 90, (8), 1152-1168 (2010).
  12. Siragusa, G. R., Nawotka, K., Spilman, S. D., Contag, P. R., Contag, C. H. Real-Time Monitoring of Escherichia coli O157:H7 Adherence to Beef Carcass Surface Tissues with a Bioluminescent Reporter. (1999).
  13. Kuo, C. J., et al. Mutation of the Enterohemorrhagic Escherichia coli Core LPS Biosynthesis Enzyme RfaD Confers Hypersusceptibility to Host Intestinal Innate Immunity In vivo. Front Cell Infect Microbiol. 6, 82 (2016).
  14. Wiles, S., et al. Organ specificity, colonization and clearance dynamics in vivo following oral challenges with the murine pathogen Citrobacter rodentium. Cell Microbiol. 6, (10), 963-972 (2004).
  15. Wiles, S., Pickard, K. M., Peng, K., MacDonald, T. T., Frankel, G. In vivo bioluminescence imaging of the murine pathogen Citrobacter rodentium. Infect Immun. 74, (9), 5391-5396 (2006).
  16. Contag, C. H., Contag, P. R., Mullins, J. I., Spillman, S. D., Stevenson, D. K., Benaron, D. A. Photonic detection of bacterial pathogens in living hosts. Mol Microbiol. 18, (4), 593-603 (1995).
  17. Hardy, J., Francis, K. P., DeBoer, M., Chu, P., Gibbs, K., Contag, C. H. Extracellular replication of Listeria monocytogenes in the murine gall bladder. Science. 303, (5659), 851-853 (2004).
  18. Kaniga, K., Sory, M. P., Delor, I., Saegerman, C., Limet, J. N., Cornelis, G. R. Monitoring of Yersinia enterocolitica in Murine and Bovine Feces on the Basis of the Chromosomally Integrated luxAB Marker Gene. Appl Environ Microbiol. 58, (3), 1024-1026 (1992).
  19. Trcek, J., Fuchs, T. M., Trulzsch, K. Analysis of Yersinia enterocolitica invasin expression in vitro and in vivo using a novel luxCDABE reporter system. Microbiology. 156, (Pt 9), 2734-2745 (2010).
  20. Morin, C. E., Kaper, J. B. Use of stabilized luciferase-expressing plasmids to examine in vivo-induced promoters in the Vibrio cholerae vaccine strain CVD 103-HgR. FEMS Immunol Med Microbiol. 57, (1), 69-79 (2009).
  21. Law, R. J., Gur-Arie, L., Rosenshine, I., Finlay, B. B. In vitro and in vivo model systems for studying enteropathogenic Escherichia coli infections. Cold Spring Harb Perspect Med. 3, (3), a009977 (2013).
  22. Ritchie, J. M. Animal Models of Enterohemorrhagic Escherichia coli Infection. Microbiol Spectr. 2, (4), EHEC-0022-2013 (2014).
  23. Chou, T. C., et al. Enterohaemorrhagic Escherichia coli O157:H7 Shiga-like toxin 1 is required for full pathogenicity and activation of the p38 mitogen-activated protein kinase pathway in Caenorhabditis elegans. Cell Microbiol. 15, (1), 82-97 (2013).
  24. Alexeyev, M. F., Shokolenko, I. N. Mini-Tnl 0 transposon derivatives for insertion mutagenesis and gene delivery into the chromosome of Gram-negative bacteria. Gene. 160, (1), 59-62 (1995).
  25. Wiegand, I., Hilpert, K., Hancock, R. E. Agar and broth dilution methods to determine the minimal inhibitory concentration (MIC) of antimicrobial substances. Nat Protoc. 3, (2), 163-175 (2008).
  26. Pansare, V., Hejazi, S., Faenza, W., Prud'homme, R. K. Review of Long-Wavelength Optical and NIR Imaging Materials: Contrast Agents, Fluorophores and Multifunctional Nano Carriers. Chem Mater. 24, (5), 812-827 (2012).
  27. Heim, R., Cubitt, A. B., Tsien, R. Y. Improved green fluorescence. Nature. 373, (6516), 663-664 (1995).
  28. Weissleder, R. A clearer vision for in vivo imaging. Nat Biotechnol. 19, (4), 316-317 (2001).
  29. Frangioni, J. In vivo near-infrared fluorescence imaging. Current Opinion in Chemical Biology. 7, (5), 626-634 (2003).
  30. Collins, J. W., et al. Citrobacter rodentium: infection, inflammation and the microbiota. Nat Rev Microbiol. 12, (9), 612-623 (2014).
  31. Mallick, E. M., et al. A novel murine infection model for Shiga toxin-producing Escherichia coli. J Clin Invest. 122, (11), 4012-4024 (2012).
  32. Petty, N. K., et al. The Citrobacter rodentium genome sequence reveals convergent evolution with human pathogenic Escherichia coli. J Bacteriol. 192, (2), 525-538 (2010).
  33. Kovach, M. E., Elzer, P. H., Hill, D. S., Robertson , G. T., Farris, M. A., Roop, R. M. II, Peterson, K. M. Four new derivatives of the broad-host-range cloning vector pBBR1MCS, carrying different antibiotic-resistance cassettes. Gene. 166, (1), 175-176 (1995).
  34. Galen, J. E., Nair, J., Wang , J. Y., Wasserman, S. S., Tanner, M. K., Sztein , M. B., Levine, M. M. Optimization of Plasmid Maintenance in the Attenuated Live Vector Vaccine Strain Salmonella typhiCVD 908-htrA. Infect Immun. 67, (12), 6424-6433 (1999).
  35. Francis, K. P., et al. Visualizing pneumococcal infections in the lungs of live mice using bioluminescent Streptococcus pneumoniae transformed with a novel gram-positive lux transposon. Infect Immun. 69, (5), 3350-3358 (2001).
  36. Goldwater, P. N., Bettelheim, K. A. Treatment of enterohemorrhagic Escherichia coli (EHEC) infection and hemolytic uremic syndrome (HUS). BMC Med. 10, (2012).
الكشف عن استعمار <em>الإشريكيّة القولونية</em> Enterohemorrhagic موريني واستضافة بنظام الإضاءة الحيوية غير الغازية <em>في فيفو</em>
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Kuo, C. J., Wang, S. T., Chen, C. S. Detection of Enterohemorrhagic Escherichia Coli Colonization in Murine Host by Non-invasive In Vivo Bioluminescence System. J. Vis. Exp. (134), e56169, doi:10.3791/56169 (2018).More

Kuo, C. J., Wang, S. T., Chen, C. S. Detection of Enterohemorrhagic Escherichia Coli Colonization in Murine Host by Non-invasive In Vivo Bioluminescence System. J. Vis. Exp. (134), e56169, doi:10.3791/56169 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter