Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

Detectie van de Enterohemorrhagic Escherichia Coli kolonisatie in lymfkliertest Host door niet-invasieve In Vivo bioluminescentie systeem

doi: 10.3791/56169 Published: April 9, 2018

Summary

Een gedetailleerd protocol voor een muismodel voor enterohemorrhagic E. coli (EHEC) kolonisatie met behulp van bacteriën bioluminescentie-label wordt gepresenteerd. Het opsporen van deze bioluminescente bacterie door een niet-invasieve in vivo imaging systeem in levende dieren kan verder ons huidige begrip van EHEC kolonisatie.

Abstract

Enterohemorrhagic E. coli (EHEC) O157:H7, die is een foodborne ziekteverwekker die causesdiarrhea, hemorragische colitis (HS), en hemolytische uremisch syndroom (HUS), koloniseren aan het darmkanaal van de mens. Om te studeren het gedetailleerde mechanisme van EHEC kolonisatie in vivo is het essentieel dat dierlijke modellen te controleren en te kwantificeren EHEC kolonisatie. Wij tonen hier een muis-EHEC kolonisatie model door de bioluminescente waarin plasmide naar EHEC kwantificeren EHEC kolonisatie in levende hosts te controleren om te zetten. Dieren geënt met bioluminescentie-geëtiketteerden EHEC Toon intens bioluminescente signalen in muizen door detectie met een niet-invasieve in vivo imaging systeem. Na 1 tot 2 dagen boeken van infectie, kunnen bioluminescente signalen nog worden gedetecteerd in besmette dieren, die suggereert dat de EHEC koloniseren in hosts gedurende ten minste 2 dagen. We laten ook zien dat deze bioluminescente EHEC vinden aan muis darm, specifiek in de blindedarm en dikke darm, van ex vivo afbeeldingen. Deze muis-EHEC kolonisatie model kan dienen als een instrument om de huidige kennis van de EHEC kolonisatie mechanisme vooruit te gaan.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

EHEC-O157:H7 is een ziekteverwekker die diarree1HS2, HUS3, en zelfs acuut nierfalen4 via besmet water of voedsel veroorzaakt. EHEC is een pathogene enterobacterium en koloniseert aan het maag-darmkanaal van de mens1. Wanneer EHEC eerst voldoen aan host intestinaal epitheel, injecteren ze de kolonisatie factoren gastheer cellen via het type III secretie systeem (T3SS), die fungeert als een moleculaire spuit inducerende een koppelen en uitwissen (A/E) laesie om vervolgens af te dwingen hechting (kolonisatie)5. Deze genen die betrokken zijn bij de vorming van de A/E laesie worden gecodeerd door de locus van enterocyte geweest (LEE) pathogeniteit eiland5.

Bioluminescentie is een licht-producerende chemische reactie, in welke luciferase katalyseert de luciferine substraat voor het genereren van zichtbaar licht6. Deze enzymatische proces vereist vaak de aanwezigheid van zuurstof of adenosinetrifosfaat (ATP)6. Bioluminescentie imaging (BLI) kan onderzoekers de visualisatie en de kwantisatie van gastheer-pathogeen interacties in levende dieren7. BLI kan het karakteriseren van de cyclus van de bacteriële infectie in levende dieren door de bioluminescente bacterie te volgen als ze naar migreren en het binnenvallen van de verschillende weefsels en7; Dit blijkt een dynamische progressie van de infectie. Bovendien, de bacteriële belasting bij dieren is gerelateerd aan de bioluminescente signaal8; Dus, het is een handige indicator om te schatten van de pathologische condities van proefdieren in een eenvoudige en directe manier.

Het plasmide gebruikt hier bevatte het luciferase operon, luxCDABE, die is van de bacterie Photorhabdus luminescens dat eigen luciferase substraat7,9 codeert. Door het omzetten van deze plasmide luciferase-uitdrukken in bacteriën, kunnen de kolonisatie en infectie processen worden gecontroleerd door het observeren van deze bioluminescente bacterie in levende dieren. Globaal, BLI en bioluminescentie-geëtiketteerden bacteriën kunnen onderzoekers om te controleren de bacteriële getallen en de locatie, de bacteriële levensvatbaarheid met antibiotica/therapie behandeling en bacteriële genexpressie in infectie/kolonisatie6, 7. talrijke pathogene bacteriën hebben gemeld dat het luxCDABE -operon te onderzoeken hun infectie cyclus en/of gen expressie in infectie express. Deze bacteriën, inclusief uropathogenic E. coli10, EHEC8,11,12,13, enteropathogenic E. coli (EPEC)8, Citrobacter rodentium14,15, Salmonella typhimurium16, Listeria monocytogenes17, Yersinia enterocolitica18,19, en Vibrio cholerae20, zijn gedocumenteerd.

Verschillende experimentele modellen zijn ontwikkeld ter vergemakkelijking van de studie van EHEC kolonisatie in vitro en in vivo21,22,23. Er is echter een gebrek aan geschikte dierlijke modellen om te studeren de EHEC kolonisatie in vivo, en dus een daaruit voortvloeiende gebrek aan details. Ter vergemakkelijking van de studie van de EHEC kolonisatie mechanisme in vivo, is het waardevol om te bouwen van diermodellen om te observeren en te kwantificeren EHEC kolonisatie in levende dieren in een niet-invasieve methode.

Dit manuscript beschrijft een muis-EHEC kolonisatie model dat een bioluminescente waarin systeem gebruikt om te controleren EHEC kolonisatie na verloop van tijd in levende hosts. Muizen zijn intragastrically geënt met EHEC bioluminescentie-label en de bioluminescente signaal is gevonden in muizen met een niet-invasieve in vivo imaging systeem13. Muizen geïnfecteerd met bioluminescentie-geëtiketteerden EHEC toonde significante bioluminescente signalen in hun darm na 2 dagen boeken van infectie, die suggereerde dat deze bacteriën in de darm host gekoloniseerd, na 2 dagen boeken van infectie. Ex vivo afbeeldingsgegevens toonde aan dat deze kolonisatie specifiek in de blindedarm en dikke darm van muizen. Met behulp van deze muis-EHEC-model, kan de bioluminescente EHEC-kolonisatie in de levende gastheer worden gedetecteerd door een in vivo imaging systeem, om te bestuderen van de precieze werking van de darmen bacteriën kolonisatie, die verder inzicht in kan bevorderen EHEC-geïnduceerde fysiologische en pathologische veranderingen.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Let op: EHEC-O157:H7 is een bioveiligheidsniveau 2 (BSL-2) pathogen volgens de Centers for Disease Control and Prevention (CDC) bioveiligheid instructie (https://www.cdc.gov/). Daarom moeten alle experimentele procedures waarbij EHEC worden uitgevoerd in een faciliteit BSL-2. Draag labjassen en handschoenen tijdens het uitvoeren van het experiment. Werken in een gecertificeerde bioveiligheid kabinet (BSC). Desinfecteer de experimentele Bank vóór en na de experimentele procedure met 70% ethanol. Alle instrumenten of apparatuur dat contact (of potentieel contact) EHEC moet worden ontsmet met 70% ethanol of bleekmiddel. Verontreinigde (of potentieel verontreinigde) afval moeten worden verzegeld en gesteriliseerde met autoclaaf zorgvuldig. Draag een masker, oogbescherming, dubbele handschoenen of een jumpsuit, indien nodig. De 6-week-oude C57BL/6 vrouwelijke muizen werden gekocht en onderhouden aan de Universiteit van het laboratorium dier Center van nationale Cheng Kung (NCKU). De dierproeven werden goedgekeurd door de institutionele Animal Care en gebruik Comité van NCKU (erkenningsnummer 104-039).

1. Bioluciferase-geëtiketteerden EHEC bacterie generatie

  1. Mix-50 ng deoxyribonucleic acid (DNA), 1 μL van 10 μM vooruit en achteruit primers, 2 μL 2.5 mM deoxynucleotides (dNTPs), 2 μL 10 x buffer, 0.2 μL DNA-polymerase, en steriele tweemaal gedestilleerd water (ddH2van O) tot een eindvolume van 20 μL te versterken de anti-kanamycine cassette, nptII gen24. De DNA-sjabloon is van pBSL18024, die is gekocht van de nationale BioResource Project (NBRP). De PCR voorwaarden zijn vermeld in tabel 1 en de primer-reeks is beschikbaar in tabel 2.
  2. De PCR producten op een commerciële klonen vector na de kit afbinden protocol (Zie Tabel van materialen).
  3. Het nptII gen fragment uit het klonen vector door NsiI en SmaI accijnzen en klonen in pBBR1MCS4, die wordt verteerd door de NsiI en ScaI van pAKlux2,9 tot het maken van de plasmide resistente kanamycine, pWF27813.
  4. Accijnzen het operon van de luxCDABE , van de uiting van de plasmide9, pAKlux2, door SpeI-HF en ScaI en kloon luciferase verteerd SpeI-HF en SmaI pWF278 voor het genereren van kanamycine resistente en luciferase plasmide, pWF27913te uiten.
    Opmerking: Voor de plasmide extracties en de zuivering van de verwijderde fragment, gebruikt de commerciële plasmide-extractie en de gel extractie kit, respectievelijk. Voor een enzym vertering, meng 100 ng DNA, 1 μL 10 x buffer, 1 μL van elke geselecteerde restrictie-enzym en steriele ddH2O tot een totaal volume van 10 μL, en Incubeer bij 37 ° C gedurende 2,5-3 uur.
  5. Het plasmide pWF279 omvormen door E. coli O157:H7 EDL933 bevoegde cellen door electroporation met 2.500 V voor 4 ms.
  6. Incubeer de cellen van de getransformeerde bacteriën in 1 mL Luria Bertani (LB) medium bij 37 ° C gedurende 1 uur.
  7. Plaat van de bacteriën op een LB agarplaat aangevuld met 50 µg/mL kanamycine bij 37 ° C gedurende 16-18 h.
  8. Controleer de bioluminescente signaal van de plaat door een in vivo imaging machine de volgende dag. Kies een één kolonie van de plaat en cultuur het in 3 mL LB aangevuld met 50 µg Mo/mL kanamycine bij 37 ° C gedurende 16-18 h.
  9. Bereiden van bacteriële voorraad medium door verdunning van 100% glycerol in steriele ddH2O om de 30% glycerol oplossing te maken.
  10. Bevriezen de kanamycine resistente E. coli O157:H7 EDL933 bacteriën herbergen de plasmide luciferase als een bacteriële voorraad in een schroefdop cryovial als een 1:1 verhouding van bacteriën cultuur en 30% glycerol oplossing bij-80 ° C. De uiteindelijke concentratie van glycerol is 15%.

2. bioluminescente EHEC bacterie voorbereiding, mondelinge inoculatie

Opmerking: Het stroomdiagram van de tijdlijn van de experimentele procedures voor EHEC voorbereiding en muis mondelinge maagsonde wordt gepresenteerd in Figuur 1 op steun in experimentele voorbereiding.

  1. Streak E. coli O157:H7 EDL933 bacteriën herbergen luciferase plasmide op een bord van de agar LB met 50 µg Mo/mL kanamycine uit voorraad-80 ° C. Groeien de bacteriën voor 16-18 h bij 37 ° C.
  2. Kies een één kolonie uit de overnachting plaat en cultuur in 3 mL LB medium met 50 µg Mo/mL kanamycine voor 16-18 h in een incubator 37 ° C op 220 toeren per minuut.
  3. Subcultuur de bacteriën (1:100 verdunning) in kanamycine (50 µg/mL) met de pond-Bouillon gedurende 2,5-3 uur in een incubator 37 ° C bij 200 omwentelingen per minuut. (Bijvoorbeeld, voeg toe 2 mL's nachts gekweekte bacteriën medium van de 200 mL LB met kanamycine (50 µg/mL) aangevuld).
  4. Incubeer de bacteriën voor 2,5-3 h en meet de optische dichtheid waarde op 600 nm (OD600) tot de waarde is tussen 0,9 tot 1. De bacteriële cel nummer is op een dichtheid van ongeveer 108 kolonie vormende eenheden (kve) / mL.
  5. Centrifugeer het opnieuw gekweekte bacteriën bij 8.000 x g gedurende 30 min, 4 ° C.
  6. Verwijder het supernatant zonder schudden van de pellet van bacteriën en wassen van de pellet met 100 mL 0,9% steriele normale zout door zachte agitatie.
  7. Herhaal stap 2.5 en 2.6 eens.
  8. Na het wassen, centrifugeren van de bacteriecultuur bij 8.000 x g gedurende 30 min, 4 ° C en verwijder het supernatant zachtjes.
  9. Condensaat de pellet op 100-fold met de steriele normale zoutoplossing 0,9%. Bijvoorbeeld, als 200 mL bacteriën worden gecentrifugeerd, voeg 2 mL normale zout op te schorten de pellet.
  10. Bevestig de bacteriën CFU (het moet ongeveer 109 kve/100 μl na condensatie in normale zout) door de geconcentreerde bacteriën via een 10-fold seriële verdunning25plating.

3. muis mondelinge maagsonde van EHEC

  1. 6 weken oude vrouwelijke C57BL/6 muizen met streptomycine water (5 g/L) voor 24 uur per dag behandelen.
  2. Na 24u, overschakelen naar reguliere drinkwater voor een andere 24 h vóór maagsonde. Na behandeling met gewoon water gedurende 24 uur, zijn de muizen klaar voor de mondelinge maagsonde van EHEC.
  3. Vul de injectiespuit met 100 μl EHEC-bacteriën door terug te trekken op de plunjer. Ervoor zorgen geen luchtbellen in de spuit. Verwijder de bubbels door breuk van de spuit met de vingers.
  4. Til het dier voorzichtig en plaats deze op de bovenkant van de kooi met zorg.
  5. Pak de muis door de staart zorgvuldig, en het dier zal grip van de bovenkant van de kooi en probeert te gaan weg.
  6. Zachtjes beperken de muis door grijpen de losse huid van de nek en de achterkant van het dier met duim en wijsvinger om te verhinderen dat het hoofd van de muis verplaatsen.
  7. Houd de muis in een verticale positie invoegen van de maagsonde naald en zorgen dat het hoofd van de muis is geïmmobiliseerdet en verticale.
  8. Plaats de naald van de maagsonde in de mond van de muis na het dak van de mond en omlaag in de slokdarm en de richting van de maag.
  9. Als de ingevoegde naald de helft of tweederde lengte in de muis is, injecteren de 100 μl EHEC-bacteriën, die ongeveer 109 CFU cellen bevatten.

4. visualisatie

  1. Na de mondelinge maagsonde, detecteert de bioluminescente signalen op 1 en 2 dagen.
  2. Alvorens de bioluminescente signalen van dieren, anesthetize hen door ze te plaatsen in een kamer van 2,5% Isofluraan met 1,5 L/min zuurstof.
  3. 2-5 min wachten totdat alle muizen onbewuste en stop verplaatsen geworden. Dieren zijn klaar voor in vivo detectie van bioluminescentie.
  4. Detecteren en beeld bioluminescente signalen van dieren door een in vivo imaging systeem. Raadpleeg hoofdstuk 5 "Data-acquisitie" voor de werking van de software. Tijdens de procedure staan alle dieren onder een voortdurende aanvoer van 2,5% Isofluraan met 1,5 L/min zuurstof.
    1. Klik op Bestand > live, en handmatig richten zich op de muis.
    2. Selecteer de blootstelling tijd en laser-intensiteit.
    3. Klik op verwerven > vastleggen.
  5. Voor ex vivo imaging, euthanaseren van de muizen door cervicale dislocatie en verwijder de hele darm van geïnfecteerde muizen. Breng de darmen in een 9-cm petrischaal en beeld door de in vivo imaging systeem. De instelling is hetzelfde als de in vivo imaging behalve het gezichtsveld is ingesteld als A/B. Zie hoofdstuk 5 "Data-acquisitie" voor details.
    Opmerking: Methode voor cervicale dislocatie: bedwingen van de muizen op de bovenkant van kooi door de staart met één hand te grijpen zodat de dieren greep de kooi. Plaats een viltstift of de duim en de eerste vinger van de andere hand tegen de achterkant van de nek op de onderkant van de schedel. Snel vooruit met de hand of object terwijl de beteugeling van het hoofd en trek achteruit met de hand met de staart.
    Selectievakje nauw te bevestigen respiratoire arrestatie en geen hartslag.

5. data-acquisitie

Opmerking: De software die wordt gebruikt voor data-acquisitie wordt vermeld in de Tabel van materialen.

  1. Voor Beeldacquisitie, opent u het Configuratiescherm van de overname van de software (Figuur 2).
  2. Selecteer "Verlichte", "fotograferen", en "Overlay".
  3. Stelt u blootstellingstijd als "Auto." Stel weggooien als "Medium."
  4. Ƒ/stop als 1 set voor verlichte en 8 voor foto. Ƒ/stop-controles in de hoeveelheid licht die door de CCD-detector wordt ontvangen.
  5. Instellen van het gezichtsveld die is gebaseerd op het veld van beelden die voor het verwerven van belang zijn. Optie "D" kan passen vijf 6-week-oude muizen en beeld ze allemaal op een moment. "C" beeld kunt drie 6-week-oude muizen in één veld.
  6. Zodra de muizen/monsters klaar voor imaging bent, klikt u op "Verwerven" voor Beeldacquisitie.
  7. Open de afbeeldingsgegevens die werd overgenomen.
  8. Open het deelvenster Tool palet (Figuur 3).
  9. Selecteer ROI extra. Het is raadzaam de cirkel (de meest linkse knop) aan het bereik van de bioluminescente gebied op beelden (Figuur 4).
  10. Klik op "Maatregel ROIs" (pictogram met potlood) voor het meten van de oppervlakte bioluminescente intensiteit (Figuur 3). Het deelvenster ROI metingen en de kwantificering waarden weergegeven (Figuur 5).
  11. Gebruik de meting configureren op de linker hoek van het deelvenster ROI metingen om te selecteren waarden/informatie die nodig is (Figuur 6), anders klik op "Export" om deze gegevenstabel exporteren en opslaan als CSV-bestand (Figuur 5).
  12. De waarden van de kolom "Totale Flux (p/s)" gebruiken als de kwantificering van de bioluminescente intensiteit in het CSV-bestand.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

We toegediend bioluminescentie-geëtiketteerden EHEC (~ 109 bacteriële cellen) met 6 - weken oude vrouwelijke C57BL/6 muizen mondelinge maagsonde. Na mondelinge inoculatie van EHEC aan muizen binnen 1 uur, werden de dieren onderzocht voor bioluminescente signaal door de in vivo imaging systeem zoals weergegeven in Figuur 7. De resultaten toonden een sterke bioluminescente signaal in maagsonde muizen met EHEC bioluminescentie-label. We hebben onderzocht de signalen op 2 dagen post infectie. Zoals blijkt uit figuur 8A, de muizen geënt met bioluminescentie-geëtiketteerden wild-type EHEC EDL933 intens bioluminescente signalen bleek zelfs na 2 dagen boeken van infectie, die suggereerde dat EHEC in hosts gekoloniseerd door 2 dagen. Wij besmet ook intragastrically bioluminescentie-label EDL933ΔrfaD (ΔrfaD) met muizen (figuur 8A). Deze mutant, overgelopen in lipopolysaccharide (LPS), heeft aangetoond dat kolonisatie in de ontvangst in onze eerdere studie verminderen. Zoals blijkt uit figuur 8A, er is geen bioluminescente signaal gedetecteerd in ΔrfaD-geïnfecteerde muizen, die suggereert dat er geen of minder bacteriën zijn cellen in de muizen gekoloniseerd. Kwantificering van het fluorescerende signaal wordt weergegeven in Figuur 8. Vervolgens werd de locatie van deze bacteriën bioluminescentie-geëtiketteerden vastgesteld. De besmette muizen werden opgeofferd humaan en hun hele darm verwijderd. De darmen van muizen 2 dagen post infectie werden geplaatst op 9 cm petrischalen en beeld ex vivo (figuur 9A). De intestinale weefsels van bioluminescentie-label EDL933 besmette muizen bleek een aanzienlijke toename van de bioluminescente signalen in de blindedarm en dikke darm, die suggereren dat deze bioluminescente EHEC gekoloniseerd in de blindedarm en dikke darm van geïnfecteerde muizen voor 2 dagen minste. Daarentegen daalde muizen geïnfecteerd met bioluminescentie-label ΔrfaD (figuur 9A), geopenbaard bioluminescente signaal in hun intestinale weefsel, dat met het beeld in-vivo (figuur 8A strookt ). Kwantificering van het fluorescerende signaal wordt weergegeven in figuur 9B.

Figure 1
Figuur 1 : Tijdlijn van het stroomschema van de experimentele opstelling.
Overzicht van de timing nodig om te bereiden bioluminescente EHEC-bacteriën en voorbehandeling van muizen met streptomycine. (A) EHEC voorbereiding. (B) muizen voorbereiding. Klik hier voor een grotere versie van dit cijfer.

Figure 2
Figuur 2 : In vivo imaging systeem overname Configuratiescherm.
Voordat het imaging monsters, IVIS acquisitie het Configuratiescherm te openen. Selecteer "Verlichte", "fotograferen", en "Overlay". Stelt u blootstellingstijd als "Auto." Stel weggooien als "Medium." Ƒ/stop als 1 set voor verlichte en 8 voor foto. Ƒ/stop-controles in de hoeveelheid licht die door de CCD-detector wordt ontvangen. Wanneer monsters klaar voor imaging zijn, klikt u op "Verwerven" om beelden te verwerven. Klik hier voor een grotere versie van dit cijfer.

Figure 3
Figuur 3 : Tool palet deelvenster.
Na image verwerven, door het gereedschap palet-deelvenster te gebruiken voor het kwantificeren van bioluminescente intensiteit. Open het deelvenster Tool palet en beeld van de gegevens. Kies een van de hulpmiddelen van de ROI aan het bereik van de bioluminescente signalen op beelden. Klik hier voor een grotere versie van dit cijfer.

Figure 4
Figuur 4 : Bioluminescente signaal uit monster voor kwantificering.
Bioluminescente signaal gebied op beelden daaromheen ROI Tools. Alle bioluminescente signalen die hier worden weergegeven zijn de rode cirkel. Klik hier voor een grotere versie van dit cijfer.

Figure 5
Figuur 5 : ROI metingen.
Na het cirkelen van bioluminescente signalen en "Maatregel ROIs" op het hulpmiddel palet paneel te klikken, worden waarden zoals gepresenteerd. De waarden van de kolom totale Flux (p/s) worden gebruikt voor de kwantificering van bioluminescente intensiteit. Klik hier voor een grotere versie van dit cijfer.

Figure 6
Figuur 6 : Toevoegen van verschillende kwantificering informatie.
Door te klikken op configureren meting op de linker hoek van het deelvenster ROI metingen, kunt u andere gewenste kwantificering waarden/informatie. Klik hier voor een grotere versie van dit cijfer.

Figure 7
Figuur 7 : Representatief beeld van muizen nadat geënt met bioluminescente EHEC.
Representatief beeld van muizen geënt met bioluminescente EHEC mondelinge maagsonde binnen 1 uur. De kleurenschaal vertegenwoordigt de straling (p/s/cm2/sr). Klik hier voor een grotere versie van dit cijfer.

Figure 8
Figuur 8 : Beelden van muizen geënt met bioluminescentie-geëtiketteerden EHEC na 2 dagen.
(A) vertegenwoordigen beeld van muizen geënt met bioluminescente wild-type EHEC EDL933 en EDL933:ΔrfaD mondelinge maagsonde, na 2 dagen boeken van infectie. (B) kwantificering van bioluminescentie intensiteit van muizen geïnfecteerd met EHEC. Foutbalken geven de standaarddeviaties. Representatieve beelden worden getoond. Alle experimenten werden uitgevoerd onafhankelijk driemaal met 2-3 dieren elke keer, en foutbalken geven de standaarddeviaties. P-waarden duiden de resultaten van de statistische analyse door t-test. De kleurenschaal vertegenwoordigt de straling (p/s/cm2/sr). Klik hier voor een grotere versie van dit cijfer.

Figure 9
Figuur 9 : Beelden van intestinale weefsels van geïnfecteerde muizen met bioluminescentie-geëtiketteerden EHEC.
(A) 2 dagen na inoculatie met bioluminescentie-EHEC geëtiketteerden, de muizen waren euthanized en hele intestinale weefsels werden verwijderd ex vivobeeld. Representatieve beelden worden getoond. (B) kwantificering van bioluminescentie intensiteit van intestinale weefsels van muizen geïnfecteerd met EHEC. Alle experimenten werden uitgevoerd onafhankelijk driemaal met 2-3 dieren elke keer, en foutbalken geven de standaarddeviaties. P-waarden duiden de resultaten van de statistische analyse door t-test. De kleurenschaal vertegenwoordigt de straling (p/s/cm2/sr). Schaal staaf vertegenwoordigt 1 cm. Klik hier voor een grotere versie van dit cijfer.

Stappen Temperatuur Tijd Aantal cycli
Eerste denaturatie 95 ° C 10 min 1
Denaturatie 95 ° C 30 sec 35
Gloeien 58,4 ° C 30 sec
Uitbreiding 72 ° C 1.5 min
Laatste uitbreiding 72 ° C 10 min 1
Houd 4 ° C 1

Tabel 1: Polymerase kettingreactie (PCR) voorwaarden

Inleidingen naam Volgorde
nptII F 5' CCTATGCATAATAATTCCGCTAGCTTCACG3'
nptII R 5' GCTCCACCGATAATATTCCTGAGTCATACT3'

Tabel 2: Primer sequenties gebruikt om te vergroten nptII

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Er werd gemeld dat EHEC getransformeerd met luciferase plasmide is gebruikt om te onderzoeken van de lokalisatie in de hosts of gen expressie in vivo8,11,12. De lymfkliertest model hier gedemonstreerd heeft ook gemeld om te ontdekken de EHEC gekoloniseerd timing en localisatie in lymfkliertest host8. Niettemin, wij bieden het detail protocol van hoe EHEC inoculatie met muizen intragastrically beheren en hoe zorgvuldig voor te bereiden op de bioluminescente bacterie mondelinge maagsonde. Met name voor de muis mondelinge maagsonde van EHEC (stap 3.7) is de positie van het hoofd van de muis van cruciaal belang wanneer de naald van de maagsonde wordt ingevoegd. Als de positie niet verticaal is, het zal moeilijk zijn om het doorgeven van de naald en het eventueel de muis kon verwonden. In stap 3.8, wanneer de maagsonde naald binnen de monding van de muis is, zal de tong leggen buiten de mond lichtjes. Resistentie wordt aangetroffen bij het overgaan van de maagsonde naald naar de slokdarm, stoppen met bewegen van de naald naar voren als onmiddellijk intrekken. Veranderen van de positie van de naald om ervoor te zorgen dat de naald is het invoeren van de slokdarm. De naald kan het invoeren van de luchtpijp bij resistentie optreedt, hetgeen leiden zou tot het injecteren van bacteriën in de longen in plaats van de maag.

Toepassing van groen fluorescent proteïne (GFP) als een biosensor is gebruikelijk in biologische experimenten. Echter, met behulp van GFP als verslaggever te observeren dat de pathogen infectie/kolonisatie in levende dieren door in vivo imaging wordt niet aanbevolen, omdat de absorptie van hemoglobine, eiwitten en water zijn tussen 200-650 nm26, dat overlapt met hoog GFP (excitatie 480 nm, emissie 510 nm)27. Dus, met behulp van GFP signaal als een verslaggever voor in vivo imaging kan worden onderbroken door hemoglobine, eiwitten en water in dieren26. De fluorescentie van nabij-infrarood (NIR) is ideaal voor in vivo imaging omdat zijn absorptie-venster rond is 650-900 nm28, die in de regio van laagste d'absorption acoustique van hemoglobine (< 650 nm) en water (> 900 nm)26 ,28 . Bovendien, wanneer weefsel licht absorbeert, er is een kans voor het opwekken van autofluorescence. Wanneer de golflengten van excitatie en emissie in het GFP-venster variëren, induceert het veel meer autofluorescence dan NIR29. Gebruik van NIR kan het signaal naar verhouding van de achtergrond vergeleken met die van GFP doordat de autofluorescence achtergrond29verbeteren. Bioluminescentie vereist geen energie excitatie voor het genereren van zichtbaar licht. Het hangt af van de reactie te katalyseren substraat luciferine door het enzym luciferase en licht te genereren. Aangezien bioluminescentie geen licht direct van een steekproef vereist, is het signaal van de achtergrond van een steekproef zeer laag. Daarom gebruik van bioluminescentie als een verslaggever meer algemeen en gemakkelijker voor in vivo imaging is. In tegenstelling, vereist fluorescentie lichte excitatie ertoe signaal licht. Wanneer weefsels licht absorberen, is er een kans dat de tl-licht zal worden uitgestoten en veroorzaken autofluorescence zodat hun signal-to-noise is hoger in vergelijking met die van bioluminescentie.

Gezien EHEC natuurlijk minder in muizen gekoloniseerd door mondelinge infectie2,22 is, een natuurlijke mucosal ziekteverwekker van muizen, genaamd Citrobacter rodentium, is gebruikt om te bestuderen van de kolonisatie-mechanisme naar lymfkliertest host als een surrogaat bacterie22,30. Beide EHEC en C. rodentium koloniseren de intestinale mucosa en de vorming van A/E laesies in host22,30te induceren. Ze bevatten ook het LEE pathogeniteit eiland, dat codeert voor een T3SS en verschillende effector eiwitten die laesie van de A/E22,30 veroorzaakte. Dus, het gebruik van luciferase plasmide uitdrukken als een verslaggever in C. rodentium op te sporen van de kolonisatie-pathologie en studie van het mechanisme van de kolonisatie via een in vivo imaging systeem is ook gemeld14, 15. toch, terwijl C. rodentium infectie van muizen een nuttig model om de functie van T3SS en het mechanisme van A/E laesie te onderzoeken is, C. rodentium bevat geen Shiga-toxine (Stx)30, die is een dominant Virulentiefactor die veroorzaakt nierfalen in EHEC, met name serotype O157:H73. Hoewel een Stx-uiten C. rodentium stam is opgebouwd onlangs31, dat meer realistisch EHEC-infectie is, het bevat geen andere potentiële EHEC Virulentiefactoren die cruciaal voor kolonisatie en/of besmetting zijn. Bovendien deelt de C. rodentium 67% van de genen met EHEC32, die suggereert dat EHEC een virulentie onderscheiden van C. rodentium tijdens de kolonisatie en/of besmetting gebruiken kan.

De luciferase uiten plasmide gebruikt hier, pWF27913, werd vanaf pAKlux29 waarvan ruggengraat pBBR1MCS433is gewijzigd. Hoewel pBBR1MCS4 zijn getest en gerepliceerd in verschillende bacteriën33, is het van cruciaal belang om ervoor te zorgen dat de oorsprong van de replicatie (ORI) van deze plasmide is geschikt voor de bacteriële host alvorens dit luciferase plasmide gebaseerde systeem te gebruiken voor het experiment en dus om te bevestigen dat deze luciferase plasmide uitdrukken in de bacteriële host kunt repliceren. We gebruiken antibiotica stress om handhaving van de stabiliteit van de plasmide in de bacteriën. Wanneer bacteriën voer de dieren in de afwezigheid van antibiotica, is de bioluminescente signaal van wild-type EHEC geconstateerd gedurende ten minste 2 dagen. Echter, wij niet na infectie langer dan 2 dagen omdat we al een significant verschil in verlichte intensiteit tussen EHEC WT en EHEC rfaD gezien hadden (die codeert een gen vereist voor EHEC synthese intact LPS) mutant op 2 dagen. Als u wilt behouden het plasmide stabiel in bacteriën onder de afwezigheid van antibiotica, kan een plasmide pCM1710,34 voor dit doel worden gebruikt. pCM17 codeert een twee-plasmide partitionering systeem en een post-segregational doden mechanisme voor de handhaving van de plasmide in bacteriën in de afwezigheid van antibiotica10,34. De plasmide pCM17 bevat het operon van de luxCDABE gedreven door de promotor van de OmpC kan worden gedetecteerd door bioluminescente signaal voor ten minste 7 dagen8. Een alternatieve methode voor het verkrijgen van een continu bioluminescente expressie bacteriën in de afwezigheid van antibiotica is luxABCDE gen in de bacteriële chromosoom35invoegen. Francis et al. gebruikt transposon ingevoegd de luxABCDE operon en antibiotica cassette willekeurig in het chromosoom van Streptococcus pneumoniae te verkrijgen van de Bioluminescentie stabiele spanning35ingevoegd.

In onze eerdere studie13gebruikt wij dit modelsysteem om te onderzoeken EHEC kolonisatie in een host en het verschil tussen kolonisatie vermogen tussen de EHEC wild type (WT) en mutant13te vergelijken. Wanneer de muizen werden bestuurd de bioluminescente EHEC rfaD mutant, de bioluminescente signalen drastisch verminderd vergeleken met dat van WT EHEC na 2 dagen infectie post. Het levert het bewijs dat dit lymfkliertest model het effect van de mutatie van EHEC kolonisatie in de host analyseren kunt. Bovendien, therapeutische behandelingen voor het verminderen van de kolonisatie van de EHEC is een weloverwogen, potentiële oplossing voor EHEC besmetting aangezien het gebruik van antibiotica is gecontra-indiceerd5,,36. Daarom testen waard of dit modelsysteem kan worden gebruikt voor het onderzoeken van de effectiviteit van anti-kolonisatie medicijnen/behandelingen tegen enterobacteria kolonisatie in de host. Wij zijn van mening dat met behulp van dit modelsysteem, het is mogelijk de timing en de locatie van niet alleen EHEC, maar ook andere enterobacteria kolonisatie in vivote onderzoeken. Met behulp van deze diermodel, het proces van de EHEC kolonisatie in muizen kan worden gecontroleerd en de lasten van de kolonisatie in de ontvangst kan worden gekwantificeerd om te bepalen van de ruimtelijke en temporele kolonisatie van EHEC in levende dieren. De visualisatie en de kwantificering van enterobacteria kolonisatie met behulp van dit model maakt het een geweldig hulpmiddel om te onderzoeken en analyseren van de fijne mechanismen van enterobacterial kolonisatie en dus compenseren de tekortkoming van kolonisatie onderzoek en verbetering van de huidige kennis.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

De auteurs hebben niets te onthullen.

Acknowledgments

Wij erkennen Chi-Chung Chen van het departement van medische Research, Chi Mei Medical Center (Tainan, Taiwan) voor de hulp in muis infectie, en de steun van het laboratorium dierlijke midden van nationale Cheng Kung Universiteit. Dit werk wordt ondersteund door de Minister van wetenschap en technologie (MOST) verleent (meest 104-2321-B-006-019, 105-2321-B-006--011, and106-2321-B-006-005) tot CC.

Materials

Name Company Catalog Number Comments
Shaker incubator YIH DER LM-570R bacteria incubation 
Orbital shaking incubator FIRSTEK S300 bacteria incubation 
pBSL180 source of nptII gene
pAKlux2 source of luxCDABE operon
T&A Cloning Kit Yeastern Biotech FYC001-20P use for TA cloning 
Nsi I NEB R0127S use for plasmid cloning 
Sca I NEB R0122S use for plasmid cloning 
Spe I-HF NEB R0133S use for plasmid cloning 
Sma NEB R0141S use for plasmid cloning 
T4 ligase NEB M0202S use for plasmid cloning 
Ex Taq TaKaRa RR001A use for PCR amplification
10X Ex Taq Buffer TaKaRa RR001A use for PCR amplification
dNTP Mixture  TaKaRa RR001A use for PCR amplification
PCR machine applied Biosystem  2720 thermal cycler   for PCR amplification
Glycerol SIGMA G5516-1L use for bacteria stocking solution
NaCl Sigma 31434-5KG-R chemical for making LB medium, 10 g/L
Tryptone CONDA pronadisa Cat 1612.00 chemical for making LB medium, 10 g/L
Yeast Extract powder Affymetrix 23547-1 KG chemical for making LB medium, 5 g/L
Agar CONDA pronadisa Cat 1802.00 chemical for making LB agar
kanamycin  Sigma K4000-5G antibiotics, use for seleciton
streptomycin  Sigma S6501-100G antibiotics, eliminate the microbiota in mice
EDL933 competent cell Homemade method is on supplemental document 
Electroporator MicroPulser for electroporation
Electroporation Cuvettes Gene Pulser/MicroPulser 1652086 for electroporation
High-speed centrifuge Beckman Coulter Avanti, J-26S XP use for centrifuging bacteria 
Fixed-Angle Rotor Beckman Coulter JA25.5 use for centrifuging bacteria 
Fixed-Angle Rotor Beckman Coulter JLA10.5 use for centrifuging bacteria 
centrifuge bottles Beckman Coulter REF357003 use for centrifuging bacteria 
centrifuge bottles Thermo Fisher scientific 3141-0500 use for centrifuging bacteria 
eppendorf biophotometer plus  eppendorf AG 22331 hamburg for measuring the OD600 value of bacteria
C57BL/6 mice  Laboratory Animal Center of NCKU
lab coat, gloves for personnel protection 
isoflurane  Panion & BF Biotech Inc. G-8669 for mice anesthesia, pharmaceutical grade
1ml syringe  use for oral gavage of mice
Reusable 22 G ball-tipped feeding needle φ0.9 mm X L 50 mm use for oral gavage of mice
surgical  scissors  use for mice experiment
Xenogen IVIS 200 imaging system Perkin Elmer IVIS spectrum use for bioluminescent image capture 
Living Image Software Perkin Elmer version 4.1 use for quantifying the image data

DOWNLOAD MATERIALS LIST

References

  1. Pennington, H. Escherichia coli O157. Lancet. 376, (9750), 1428-1435 (2010).
  2. Mayer, C. L., Leibowitz, C. S., Kurosawa, S., Stearns-Kurosawa, D. J. Shiga toxins and the pathophysiology of hemolytic uremic syndrome in humans and animals. Toxins (Basel). 4, (11), 1261-1287 (2012).
  3. Tarr, P. I., Gordon, C. A., Chandler, W. L. Shiga-toxin-producing Escherichia coli and haemolytic uraemic syndrome. Lancet. 365, (9464), 1073-1086 (2005).
  4. Obrig, T. G. Escherichia coli Shiga Toxin Mechanisms of Action in Renal Disease. Toxins (Basel). 2, (12), 2769-2794 (2010).
  5. Nguyen, Y., Sperandio, V. Enterohemorrhagic E. coli (EHEC) pathogenesis. Front Cell Infect Microbiol. 2, 90 (2012).
  6. Wiles, S., Robertson, B. D., Frankel, G., Kerton, A. Bioluminescent monitoring of in vivo colonization and clearance dynamics by light-emitting bacteria. Methods Mol Biol. 574, 137-153 (2009).
  7. Hutchens, M., Luker, G. D. Applications of bioluminescence imaging to the study of infectious diseases. Cell Microbiol. 9, (10), 2315-2322 (2007).
  8. Rhee, K. J., et al. Determination of spatial and temporal colonization of enteropathogenic E. coli and enterohemorrhagic E. coli in mice using bioluminescent in vivo imaging. Gut Microbes. 2, (1), 34-41 (2011).
  9. Karsi, A., Lawrence, M. L. Broad host range fluorescence and bioluminescence expression vectors for Gram-negative bacteria. Plasmid. 57, (3), 286-295 (2007).
  10. Lane, M. C., Alteri, C. J. S., Smith, S. N., Mobley, L. H. Expression of flagella is coincident with uropathogenic Escherichia coli ascension to the upper urinary tract. Proc Natl Acad Sci U S A. 104, (42), 16669-16674 (2007).
  11. Roxas, J. L., et al. Enterohemorrhagic E. coli alters murine intestinal epithelial tight junction protein expression and barrier function in a Shiga toxin independent manner. Lab Invest. 90, (8), 1152-1168 (2010).
  12. Siragusa, G. R., Nawotka, K., Spilman, S. D., Contag, P. R., Contag, C. H. Real-Time Monitoring of Escherichia coli O157:H7 Adherence to Beef Carcass Surface Tissues with a Bioluminescent Reporter. (1999).
  13. Kuo, C. J., et al. Mutation of the Enterohemorrhagic Escherichia coli Core LPS Biosynthesis Enzyme RfaD Confers Hypersusceptibility to Host Intestinal Innate Immunity In vivo. Front Cell Infect Microbiol. 6, 82 (2016).
  14. Wiles, S., et al. Organ specificity, colonization and clearance dynamics in vivo following oral challenges with the murine pathogen Citrobacter rodentium. Cell Microbiol. 6, (10), 963-972 (2004).
  15. Wiles, S., Pickard, K. M., Peng, K., MacDonald, T. T., Frankel, G. In vivo bioluminescence imaging of the murine pathogen Citrobacter rodentium. Infect Immun. 74, (9), 5391-5396 (2006).
  16. Contag, C. H., Contag, P. R., Mullins, J. I., Spillman, S. D., Stevenson, D. K., Benaron, D. A. Photonic detection of bacterial pathogens in living hosts. Mol Microbiol. 18, (4), 593-603 (1995).
  17. Hardy, J., Francis, K. P., DeBoer, M., Chu, P., Gibbs, K., Contag, C. H. Extracellular replication of Listeria monocytogenes in the murine gall bladder. Science. 303, (5659), 851-853 (2004).
  18. Kaniga, K., Sory, M. P., Delor, I., Saegerman, C., Limet, J. N., Cornelis, G. R. Monitoring of Yersinia enterocolitica in Murine and Bovine Feces on the Basis of the Chromosomally Integrated luxAB Marker Gene. Appl Environ Microbiol. 58, (3), 1024-1026 (1992).
  19. Trcek, J., Fuchs, T. M., Trulzsch, K. Analysis of Yersinia enterocolitica invasin expression in vitro and in vivo using a novel luxCDABE reporter system. Microbiology. 156, (Pt 9), 2734-2745 (2010).
  20. Morin, C. E., Kaper, J. B. Use of stabilized luciferase-expressing plasmids to examine in vivo-induced promoters in the Vibrio cholerae vaccine strain CVD 103-HgR. FEMS Immunol Med Microbiol. 57, (1), 69-79 (2009).
  21. Law, R. J., Gur-Arie, L., Rosenshine, I., Finlay, B. B. In vitro and in vivo model systems for studying enteropathogenic Escherichia coli infections. Cold Spring Harb Perspect Med. 3, (3), a009977 (2013).
  22. Ritchie, J. M. Animal Models of Enterohemorrhagic Escherichia coli Infection. Microbiol Spectr. 2, (4), EHEC-0022-2013 (2014).
  23. Chou, T. C., et al. Enterohaemorrhagic Escherichia coli O157:H7 Shiga-like toxin 1 is required for full pathogenicity and activation of the p38 mitogen-activated protein kinase pathway in Caenorhabditis elegans. Cell Microbiol. 15, (1), 82-97 (2013).
  24. Alexeyev, M. F., Shokolenko, I. N. Mini-Tnl 0 transposon derivatives for insertion mutagenesis and gene delivery into the chromosome of Gram-negative bacteria. Gene. 160, (1), 59-62 (1995).
  25. Wiegand, I., Hilpert, K., Hancock, R. E. Agar and broth dilution methods to determine the minimal inhibitory concentration (MIC) of antimicrobial substances. Nat Protoc. 3, (2), 163-175 (2008).
  26. Pansare, V., Hejazi, S., Faenza, W., Prud'homme, R. K. Review of Long-Wavelength Optical and NIR Imaging Materials: Contrast Agents, Fluorophores and Multifunctional Nano Carriers. Chem Mater. 24, (5), 812-827 (2012).
  27. Heim, R., Cubitt, A. B., Tsien, R. Y. Improved green fluorescence. Nature. 373, (6516), 663-664 (1995).
  28. Weissleder, R. A clearer vision for in vivo imaging. Nat Biotechnol. 19, (4), 316-317 (2001).
  29. Frangioni, J. In vivo near-infrared fluorescence imaging. Current Opinion in Chemical Biology. 7, (5), 626-634 (2003).
  30. Collins, J. W., et al. Citrobacter rodentium: infection, inflammation and the microbiota. Nat Rev Microbiol. 12, (9), 612-623 (2014).
  31. Mallick, E. M., et al. A novel murine infection model for Shiga toxin-producing Escherichia coli. J Clin Invest. 122, (11), 4012-4024 (2012).
  32. Petty, N. K., et al. The Citrobacter rodentium genome sequence reveals convergent evolution with human pathogenic Escherichia coli. J Bacteriol. 192, (2), 525-538 (2010).
  33. Kovach, M. E., Elzer, P. H., Hill, D. S., Robertson , G. T., Farris, M. A., Roop, R. M. II, Peterson, K. M. Four new derivatives of the broad-host-range cloning vector pBBR1MCS, carrying different antibiotic-resistance cassettes. Gene. 166, (1), 175-176 (1995).
  34. Galen, J. E., Nair, J., Wang , J. Y., Wasserman, S. S., Tanner, M. K., Sztein , M. B., Levine, M. M. Optimization of Plasmid Maintenance in the Attenuated Live Vector Vaccine Strain Salmonella typhiCVD 908-htrA. Infect Immun. 67, (12), 6424-6433 (1999).
  35. Francis, K. P., et al. Visualizing pneumococcal infections in the lungs of live mice using bioluminescent Streptococcus pneumoniae transformed with a novel gram-positive lux transposon. Infect Immun. 69, (5), 3350-3358 (2001).
  36. Goldwater, P. N., Bettelheim, K. A. Treatment of enterohemorrhagic Escherichia coli (EHEC) infection and hemolytic uremic syndrome (HUS). BMC Med. 10, (2012).
Detectie van de Enterohemorrhagic <em>Escherichia Coli</em> kolonisatie in lymfkliertest Host door niet-invasieve <em>In Vivo</em> bioluminescentie systeem
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Kuo, C. J., Wang, S. T., Chen, C. S. Detection of Enterohemorrhagic Escherichia Coli Colonization in Murine Host by Non-invasive In Vivo Bioluminescence System. J. Vis. Exp. (134), e56169, doi:10.3791/56169 (2018).More

Kuo, C. J., Wang, S. T., Chen, C. S. Detection of Enterohemorrhagic Escherichia Coli Colonization in Murine Host by Non-invasive In Vivo Bioluminescence System. J. Vis. Exp. (134), e56169, doi:10.3791/56169 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter