Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

Detección de la colonización de Escherichia Coli enterohemorrágica en anfitrión murino no invasiva In Vivo el sistema de bioluminiscencia

doi: 10.3791/56169 Published: April 9, 2018

Summary

Se presenta un protocolo detallado de un modelo de ratón para enterohemorrágica e. coli (EHEC) colonización utilizando bacterias etiquetado bioluminiscencia. La detección de estas bacterias bioluminiscentes por un no-invasivo en vivo sistema de animales vivos de imagen puede avanzar nuestra comprensión actual de la colonización de EHEC.

Abstract

Enterohemorrágica e. coli (EHEC) O157: H7, que es un patógeno de transmisión alimentaria que causesdiarrhea, colitis hemorrágica (HS), y síndrome urémico hemolítico (SUH), colonizar en el tracto intestinal de los seres humanos. Para estudiar el mecanismo detallado de la colonización de EHEC en vivo, es imprescindible disponer de modelos animales para controlar y cuantificar la colonización de EHEC. Se demuestra aquí un modelo de colonización de ratón-EHEC transformando el plásmido expresando bioluminiscente a EHEC para monitorear y cuantificar la colonización de EHEC en anfitriones de vida. Animales inoculados con ECEH etiquetado bioluminiscencia muestran intensas señales bioluminiscentes en ratones por la detección con un no-invasivo en vivo sistema de imagen. Después de 1 y 2 días post infección, señales bioluminiscentes todavía se podían detectar en los animales infectados, lo cual sugiere que EHEC colonizan en anfitriones de al menos 2 días. También demostramos que estos EHEC bioluminiscente localizar al intestino de ratón, específicamente en el ciego y el colon, de imágenes de ex vivo . Este modelo de colonización de ratón-EHEC puede servir como una herramienta para avanzar en el conocimiento actual del mecanismo de colonización de EHEC.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

ECEH O157: H7 es un patógeno que causa diarrea1, HS2, HUS3y falta renal aguda incluso4 a través de agua o alimentos contaminados. EHEC es un patógeno Enterobacter y coloniza en el tracto gastrointestinal de los seres humanos1. Cuando EHEC primero se adhieren al epitelio intestinal del anfitrión, inyectan los factores de colonización en las células del huésped a través del sistema de la secreción del III tipo (T3SS) que funciona como una jeringa molecular induciendo una fijación y borrar (A/E) lesión posteriormente para hacer cumplir adherencia (colonización)5. Estos genes involucrados en la formación de la lesión A/E son codificados por el locus de la isla de patogenicidad del enterocyte effacement (LEE)5.

Bioluminescence es una reacción química produzca luz, en la cual luciferase cataliza su luciferin del substrato para generar luz visible6. Este proceso enzimático requiere con frecuencia la presencia de oxígeno o trifosfato de adenosina (ATP)6. Bioluminiscencia (BLI) la proyección de imagen permite a los investigadores la visualización y cuantificación de las interacciones huésped-patógeno en animales vivos7. BLI puede caracterizar el ciclo de infección bacteriana en animales vivos siguiendo las bacterias bioluminiscentes que migran e invaden diferentes tejidos7; Esto revela una evolución dinámica de la infección. Por otra parte, la carga bacteriana en los animales se relaciona con la señal bioluminiscente8; por lo tanto, es un indicador conveniente para estimar las condiciones patológicas de los animales experimentales en una forma simple y directa.

El plásmido utilizado aquí contenida el operón de la luciferasa, luxCDABE, que es de la bacteria Photorhabdus luminescens que codifica su propia luciferase sustrato7,9. Al transformar este plásmido de expresión de luciferasa en las bacterias, los procesos de colonización y la infección pueden controlarse mediante la observación de estas bacterias bioluminiscentes en animales vivos. En general, BLI y bacterias etiquetado bioluminiscencia permiten a los investigadores a monitorear los números bacterianos y ubicación, viabilidad bacteriana con tratamiento de antibióticos y la expresión génica bacteriana en infección/colonización6, 7. se han reportado numerosas bacterias patógenas que expresar el operón luxCDABE para examinar su expresión de ciclo o gen de infección en infección. Estas bacterias, incluyendo uropatógenos Escherichia coli10, EHEC8,11,12,13, enteropatógeno e. coli (EPEC)8, Citrobacter Rodentium14,15, Salmonella typhimurium16, Listeria monocytogenes17, Yersinia enterocolitica18,19, y Vibrio cholerae20, han sido documentados.

Varios modelos experimentales se han desarrollado para facilitar el estudio de ECEH colonización in vitro e in vivo21,22,23. Sin embargo, hay una falta de modelos animales adecuados para el estudio de la colonización la EHEC en vivoy, por tanto, la escasez resultante de los datos. Para facilitar el estudio de la EHEC colonización mecanismo en vivo, es valioso para construir modelos animales para observar y cuantificar la colonización de ECEH en los animales vivos en un método no invasivo.

Este manuscrito describe un modelo de colonización de EHEC de mouse que utiliza un sistema de expresión bioluminiscente para controlar la colonización de la ECEH en el tiempo de vida acoge. Ratones se inoculan intragástrica con EHEC etiquetado bioluminiscencia y se detecta la señal bioluminiscente en ratones con un no-invasivo en vivo imágenes del sistema13. Ratones infectan con ECEH etiquetado bioluminiscencia mostró significativas señales bioluminiscentes en su intestino después de 2 días post infección, lo que sugiere que las bacterias colonizan en el intestino del anfitrión después de 2 días post infección. Ex vivo imagen datos demostraron que esta colonización es específicamente en el ciego y el colon de los ratones. Mediante este modelo de ratón-EHEC, la colonización bioluminiscente de EHEC puede detectarse en la vida de acogida un en vivo sistema, para estudiar los mecanismos detallados de la colonización de bacterias entéricas, que puede promover la comprensión más en la proyección de imagen Inducida por la EHEC cambios fisiológicos y patológicos.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

PRECAUCIÓN: ECEH O157: H7 es un nivel de bioseguridad 2 (BSL-2) patógeno según los centros para el Control de enfermedades y prevención de enfermedades (CDC) Instrucciones de seguridad de la biotecnología (https://www.cdc.gov/). Por lo tanto, deben realizarse todos los procedimientos experimentales que EHEC en una facilidad BSL-2. Use guantes y batas de laboratorio al realizar el experimento. Trabajo en una gabinete de la bioseguridad certificada (BSC). Desinfectar el Banco experimental antes y después del procedimiento experimental con etanol al 70%. Todos los instrumentos o equipos que EHEC contacto (o potencialmente contacto) debe ser desinfectado con etanol al 70% o blanqueador. Desechos contaminados (o potencialmente contaminados) deben ser cuidadosamente sellado y esterilizado. Use una máscara, protección ocular, guantes doble o un mono, si es necesario. Los ratones hembra de 6 semanas de edad C57BL/6 fueron comprados y mantenidos en el laboratorio Animal centro de National Cheng Kung University (NCKU). Los experimentos con animales fueron aprobados por el cuidado de Animal institucional y Comité de uso de NCKU (número 104-039).

1. generación de las bacterias EHEC Bioluciferase-etiquetado

  1. Mezcle 50 ng del ácido desoxirribonucléico (ADN), 1 μL de 10 μM adelante y atrás cartillas, Deoxynucleótidos 2 por μL de 2,5 mM (dNTPs), 2 μL de 10 x tampón, 0,2 μL ADN polimerasa y agua doble destilada estéril (ddH2O) hasta un volumen final de 20 μL para amplificar la casete de la kanamicina nptII gen24. La plantilla de DNA es de pBSL18024, que se adquiere desde el proyecto nacional de BioResource (NBRP). Las condiciones PCR se enumeran en la tabla 1 y la secuencia de la cartilla está disponible en la tabla 2.
  2. Ligan los productos PCR a un vector de clonación comercial siguiendo el kit protocolo (véase Tabla de materiales).
  3. Suprimir el fragmento de gen nptII del vector de clonación NsiI y SmaI y clonar en pBBR1MCS4, que es digerida por el NsiI y ScaI de pAKlux29 para crear el plásmido resistentes a kanamicina, pWF27813.
  4. Suprimir el operón luxCDABE , de la luciferase expresando plásmido9, pAKlux2, por SpeI-HF y ScaI y clon SpeI-HF y SmaI digerido pWF278 para generar kanamicina resistente y luciferasa expresando su plásmido, pWF27913.
    Nota: Para la extracción de plásmidos y las purificaciones fragmento suprimido, utilice la extracción comercial del plásmido y el kit de extracción de gel, respectivamente. Para la digestión de la enzima, mezcle 100 ng de ADN, 1 μL 10 x tampón, 1 μL de cada enzima de restricción seleccionada y ddH estéril2O hasta un volumen total de 10 μL e incubar a 37 ° C por 2.5-3 h.
  5. Transformar el plásmido pWF279 en células competentes de e. coli EDL933 O157: H7 por electroporación con 2.500 V durante ms de 4.
  6. Incube las células de las bacterias transformadas en medio Luria-Bertani (LB) de 1 mL a 37 ° C durante 1 hora.
  7. Las bacterias en una placa de agar LB suplementado con 50 μg/mL de kanamicina a 37 ° C durante 16-18 h. de la placa.
  8. Comprobar la señal bioluminiscente de la placa por un en vivo la proyección de imagen la máquina el día siguiente. Escoger una sola Colonia de la placa y de la cultura en 3 mL LB con kanamicina 50 de μg/mL a 37 ° C durante 16-18 h..
  9. Preparar el medio de acción bacteriano diluyendo 100% glicerol estéril ddH2O para la solución de glicerol 30%.
  10. Congelar la kanamicina resistente bacteria de e. coli EDL933 O157: H7 que el plásmido de la luciferasa como una acción bacteriana en un cryovial de tapón de rosca como una proporción de 1:1 de solución de bacterias cultura y 30% de glicerol a-80 ° C. La concentración final de glicerol es 15%.

2. preparación de bacterias EHEC bioluminiscente para inoculación Oral

Nota: El diagrama de flujo de línea de tiempo de los procedimientos experimentales para la preparación de EHEC y sonda oral ratón se presenta en la figura 1 para ayudar en la preparación experimental.

  1. Bacteria de raya e. coli EDL933 O157: H7 que plásmidos de luciferasa en un agar-LB con kanamicina 50 de μg/mL del stock de-80 ° C. Crecer las bacterias durante 16-18 horas a 37 ° C.
  2. Escoge una sola Colonia de la placa durante la noche y la cultura en medio de 3 mL LB con kanamicina 50 de μg/mL durante 16-18 h. en una incubadora de 37 ° C a 220 rpm.
  3. Subcultura las bacterias (dilución 1: 100) en kanamicina (50 μg/mL) que contiene caldo LB por 2.5-3 h en una incubadora de 37 ° C a 200 rpm. (Por ejemplo, agregar 2 mL cultivados durante la noche las bacterias 200 mL LB suplementado con kanamicina (50 μg/mL)).
  4. Incubar las bacterias por 2.5-3 h y medir el valor de densidad óptica a 600 nm (OD600) hasta el valor es entre 0.9 a 1. El número de la célula bacteriana es a una densidad de cerca de 108 unidades formadoras de colonias (UFC) / mL.
  5. Centrifugue las bacterias cultivadas a 8.000 x g por 30 min, 4 ° C.
  6. Descartar el sobrenadante sin agitar el sedimento de bacterias y lave el precipitado con 100 mL 0,9% solución salina estéril normal por agitación suave.
  7. Repita los pasos del 2.5 y 2.6 una vez.
  8. Después del lavado, centrifugar el cultivo bacteriano a 8.000 x g por 30 min, 4 ° C y descarte el sobrenadante con cuidado.
  9. Condensado el pellet en 100-fold con 0,9% solución salina estéril normal. Por ejemplo, si las bacterias 200 mL se centrifugaron, Agregar solución salina normal 2 mL para suspender el sedimento.
  10. Las bacterias concentradas a través de una dilución seriada 10 veces25de la galjanoplastia para confirmar las bacterias UFC (debe ser aproximadamente 109 UFC/100 μL después de la condensación en solución salina normal).

3. ratón Oral por sonda nasogástrica de EHEC

  1. Tratamiento de 6 semanas de edad hembra C57BL/6 ratones con agua de estreptomicina (5 g/L) durante 24 h.
  2. Después de 24 h, interruptor para regular el agua potable por otro 24 h antes por sonda nasogástrica. Después de tratar con agua corriente durante 24 horas, los ratones están listos para oral por sonda nasogástrica de EHEC.
  3. Llene la jeringa con las bacterias EHEC de 100 μL tirando hacia atrás del émbolo. No sean burbujas de aire en la jeringa. Quite las burbujas por ajustar la jeringa con los dedos.
  4. Levantar al animal suavemente y colóquelo en la parte superior de la jaula con cuidado.
  5. Tome el ratón por la cola con cuidado, y el animal se agarre la parte superior de la jaula y tratar de alejar.
  6. Frenar suavemente el ratón agarrando la piel floja del cuello y la parte posterior del animal con dedos pulgar e índice para evitar que se mueva la cabeza del ratón.
  7. Mantenga el ratón en una posición vertical para insertar la aguja de la sonda nasogástrica y asegurar que la cabeza del ratón es inmovilizado y vertical.
  8. Inserte la aguja de la sonda en la boca del ratón tras el techo de la boca y mover hacia abajo en el esófago y hacia el estómago.
  9. Cuando la aguja insertada es la mitad o dos tercios longitud en el ratón, inyectar la bacteria EHEC 100 μL, que contiene aproximadamente 109 UFC las células.

4. visualización

  1. Después la sonda oral, detectar las señales bioluminiscentes en los días 1 y 2.
  2. Antes de examinar las señales bioluminiscentes de los animales, anestesiar, poniendo en una cámara de 2,5% isoflurano con oxígeno de 1.5 L/min.
  3. Espere 2-5 minutos hasta que todos los ratones se convierten en inconsciente y tope móvil. Los animales están listos para en vivo detección de bioluminiscencia.
  4. Detectar y señales bioluminiscentes de los animales de la imagen de un en vivo sistema de imagen. Consulte Sección 5 "Adquisición de datos" para la operación del software. Durante el proceso de proyección de imagen, todos los animales están bajo un continuo suministro de 2,5% isoflurano con oxígeno de 1.5 L/min.
    1. Haga clic en archivo > vivo y manualmente se centran en el ratón.
    2. Seleccione la intensidad de la exposición tiempo y láser.
    3. Haga clic en adquirir > capturar.
  5. Imagen ex vivo , eutanasia a los ratones por dislocación cervical y retire el intestino entero de ratones infectados. Coloque los intestinos en un plato de Petri de 9 cm e imagen del en vivo sistema de imagen. El ajuste es el mismo que el en vivo la proyección de imagen excepto el campo de visión se define como A/B. Para detalles, véase sección 5 "Adquisición de datos".
    Nota: Método de la dislocación cervical: frenar los ratones en la parte superior de la jaula agarrando la cola con una mano para que los animales agarrar la jaula. Coloque un rotulador o el pulgar y primer dedo de la otra mano contra la parte posterior del cuello en la base del cráneo. Empuje hacia adelante con la mano o algún objeto mientras la cabeza y tirar hacia atrás con la mano que sujeta la cola rápidamente.
    Cheque a confirmar detención respiratoria y no hay latidos del corazón.

5. adquisición de datos

Nota: El software utilizado para la adquisición de datos se muestra en la Tabla de materiales.

  1. Para la adquisición de la imagen, abra el Panel de Control de la adquisición del software (figura 2).
  2. Seleccione "Luminiscente", "fotografía" y "Superposición".
  3. Tiempo de exposición determinado como "Auto." Establecer Binning como "Medio."
  4. Establecer ƒ/parada 1 luminiscente y 8 para la fotografía. Ƒ/stop controles la cantidad de luz recibida por el detector del CCD.
  5. Establecer el campo de visión basado en el campo de las imágenes que son de interés para adquirir. Opción "D" puede caber cinco ratones de 6 semanas de edad e imagen un momento. "C" puede imagen tres ratones de 6 semanas de edad en un campo.
  6. Una vez que las muestras de ratones están preparadas para la proyección de imagen, haga clic en "Adquirir" para la adquisición de la imagen.
  7. Abrir los datos de imagen que fue adquiridos.
  8. Abra el panel de la paleta de herramientas (figura 3).
  9. Seleccione Herramientas ROI. Recomendamos el círculo (uno izquierdo) para variar la zona bioluminiscente en imágenes (figura 4).
  10. Haga clic en "Medida de ROIs" (icono de lápiz) para medir la intensidad bioluminiscente superficial (figura 3). El panel de medición de retorno de la inversión y los valores de cuantificación aparecen (figura 5).
  11. Use la medida de configurar en la esquina izquierda del panel de mediciones de ROI para seleccionar la valores e información necesaria (figura 6), de lo contrario, haga clic en "Exportar" para exportar esta tabla de datos y guardar como archivo .csv (figura 5).
  12. Utilice los valores de la columna "Total flujo (p/s)" como la cuantificación de la intensidad bioluminiscente en el archivo CSV.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Administramos la bioluminiscencia etiquetado EHEC (~ 109 células bacterianas) a 6 - semanas de edad hembra C57BL/6 ratones por sonda oral. Después de la inoculación oral de EHEC para ratones dentro de 1 h, los animales fueron examinados para bioluminiscente de la señal por el sistema generador de imágenes en vivo como se muestra en la figura 7. Los resultados mostraron una fuerte señal bioluminiscente en ratones por sonda nasogástrica con EHEC etiquetado bioluminiscencia. Examinamos las señales en 2 días post infección. Como se muestra en la figura 8A, los ratones inoculan con etiquetado bioluminiscencia tipo EHEC EDL933 mostró señales bioluminiscentes intenso incluso después de 2 días post infección, que sugirió que EHEC colonizados en los anfitriones por 2 días. Nosotros también intragástricamente infectados etiquetado bioluminiscencia EDL933ΔrfaD (ΔrfaD) a los ratones (figura 8A). Este mutante, desertó en lipopolisacárido (LPS), se ha demostrado para reducir la colonización en el host en nuestro estudio anterior. Como se muestra en la figura 8A, no hay ninguna señal bioluminiscente en ΔrfaD-ratones infectados, lo que sugiere que hay bacterias no o menos células colonizaron en los ratones. Cuantificación de la señal fluorescente se muestra en la figura 8B. A continuación, se determinó la ubicación de estas bacterias etiquetado bioluminiscencia. Los ratones infectados fueron sacrificados humanitariamente y quitado su intestino entero. Los intestinos de ratones 2 días post infección se colocaron en platos de Petri de 9 cm y reflejada ex vivo (Figura 9A). Los tejidos intestinales de ratones infectados EDL933 etiquetado bioluminiscencia revelaron un aumento significativo de señales bioluminiscentes en el ciego y el colon, que sugieren que estos EHEC bioluminiscente colonizados en el ciego y el colon de ratones infectados por 2 días en menos. En contraste, ratones infectados con etiquetado bioluminiscencia ΔrfaD (Figura 9A), reveló disminución de señal bioluminiscente en su tejido intestinal, lo cual es consistente con la imagen en vivo (figura 8A ). Cuantificación de la señal fluorescente se muestra en la figura 9B.

Figure 1
Figura 1 : Línea de tiempo del diagrama de flujo preparación experimental.
Resumen de la sincronización necesaria para preparar bacterias bioluminiscentes de EHEC y trate de ratones con estreptomicina. (A) ECEH preparación. (B) preparación de ratones. Haga clic aquí para ver una versión más grande de esta figura.

Figure 2
Figura 2 : En vivo panel de control sistema adquisición de imágenes.
Antes las muestras de la proyección de imagen, abra el Panel de Control de adquisición de IVIS. Seleccione "Luminiscente", "fotografía" y "Superposición". Tiempo de exposición determinado como "Auto." Establecer Binning como "Medio." Establecer ƒ/parada 1 luminiscente y 8 para la fotografía. Ƒ/stop controles la cantidad de luz recibida por el detector del CCD. Una vez que las muestras están listas para la proyección de imagen, haga clic en "Adquirir" para adquirir imágenes. Haga clic aquí para ver una versión más grande de esta figura.

Figure 3
Figura 3 : Panel de paleta de herramientas.
Después de la adquisición de la imagen, utilice el panel de la paleta de herramientas para cuantificar la intensidad bioluminiscente. Abra el panel de la paleta de herramientas y los datos de la imagen. ¡Elegir una de las herramientas de ROI para las señales bioluminiscentes en imágenes de la gama. Haga clic aquí para ver una versión más grande de esta figura.

Figure 4
Figura 4 : Señal bioluminiscente de muestra para la cuantificación.
Zona bioluminiscente señal en las imágenes rodeado por herramientas de ROI. Todas las señales bioluminiscentes que se muestra aquí son en el círculo rojo. Haga clic aquí para ver una versión más grande de esta figura.

Figure 5
Figura 5 : Las mediciones de ROI.
Después de circundar las señales bioluminiscentes y haciendo clic en "ROIs de medida" en el panel de la paleta de herramientas, se presentan los valores como se muestra. Los valores de la columna de flujo Total (p/s) se utilizan para la cuantificación de la intensidad bioluminiscente. Haga clic aquí para ver una versión más grande de esta figura.

Figure 6
Figura 6 : Añadir información de cuantificación diferentes.
Haciendo clic en la medida de configurar en la esquina izquierda del panel de mediciones de ROI, puede seleccionar otros valores de cuantificación deseada e información. Haga clic aquí para ver una versión más grande de esta figura.

Figure 7
Figura 7 : Imagen representativa de los ratones después de inoculados con ECEH bioluminiscente.
Imagen representativa de los ratones inoculados con ECEH bioluminiscente por sonda oral dentro de 1 h. La escala de color representa la radiancia (/sr p/s/cm2). Haga clic aquí para ver una versión más grande de esta figura.

Figure 8
Figura 8 : Imágenes de ratones inocularon con ECEH etiquetado bioluminiscencia después de 2 días.
(A) representan imagen de ratones inoculados con salvaje-tipo bioluminiscente EDL933 EHEC y EDL933:ΔrfaD por sonda oral después de 2 días post infección. (B) cuantificación de la intensidad de la bioluminiscencia de ratones infectados con ECEH. Barras de error indican la desviación estándar. Se muestran imágenes representativas. Todos los experimentos se llevaron a cabo independientemente tres veces con 2-3 animales cada vez, y barras de error indican la desviación estándar. Los valores de P indican los resultados del análisis estadístico por t-test. La escala de color representa la radiancia (/sr p/s/cm2). Haga clic aquí para ver una versión más grande de esta figura.

Figure 9
Figura 9 : Imágenes de los tejidos intestinales de ratones infectados con ECEH etiquetado bioluminiscencia.
(A) 2 días después de la inoculación con bioluminiscencia-etiquetado EHEC, los ratones fueron sacrificados y tejidos todo intestinales fueron quitados y reflejada ex vivo. Se muestran imágenes representativas. (B) cuantificación de la intensidad de la bioluminiscencia de los tejidos intestinales de ratones infectados con ECEH. Todos los experimentos se llevaron a cabo independientemente tres veces con 2-3 animales cada vez, y barras de error indican la desviación estándar. Los valores de P indican los resultados del análisis estadístico por t-test. La escala de color representa la radiancia (/sr p/s/cm2). Barra de escala representa 1 cm. haga clic aquí para ver una versión más grande de esta figura.

Pasos Temperatura Tiempo Número de ciclos de
Desnaturalización inicial 95 ° C 10 min 1
Desnaturalización 95 ° C 30 seg. 35
De recocido 58,4 ° C 30 seg.
Extensión 72 ° C 1,5 min
Extensión final 72 ° C 10 min 1
Mantenga 4 ° C 1

Tabla 1: Condiciones de reacción en cadena (PCR) de polimerasa

Nombre de cartillas Secuencia de
nptII F 5' CCTATGCATAATAATTCCGCTAGCTTCACG3'
nptII R 5' GCTCCACCGATAATATTCCTGAGTCATACT3'

Tabla 2: secuencias de la cartilla utilizadas para amplificar nptII

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Se ha divulgado que EHEC transformada con el plásmido de la luciferasa se ha utilizado para examinar su localización en hosts o expresión de gen en vivo8,11,12. El modelo murino demostrado aquí también se ha divulgado para detectar el momento de EHEC colonizado y localización en anfitrión murino8. Sin embargo, nos ofrecen el protocolo de detalle de cómo administrar la inoculación a ratones EHEC intragástrica y cómo preparar cuidadosamente las bacterias bioluminiscentes para oral por sonda nasogástrica. En particular, para el ratón oral por sonda nasogástrica de EHEC (paso 3.7), la posición de la cabeza de ratón es crítica cuando se inserta la aguja de la sonda nasogástrica. Si la posición no es vertical, va a ser difícil pasar la aguja y posiblemente podría lesionar el ratón. En el paso 3.8, cuando la aguja de la sonda nasogástrica esté dentro de la boca del ratón, la lengua se pone fuera de la boca ligeramente. Si se encuentra resistencia al pasar la aguja de la sonda nasogástrica hacia el esófago, se detiene la aguja hacia adelante y retirarse inmediatamente. Alterar la posición de la aguja para asegurarse de que la aguja entra en el esófago. La aguja podría estar entrando en la tráquea cuando se produce resistencia, que daría lugar a la inyección de bacterias en los pulmones en vez del estómago.

Aplicación de la proteína verde fluorescente (GFP) como un biosensor es común en experimentos biológicos. Sin embargo, usando GFP como reportero para observar que la infección/colonización del patógeno en los animales vivos por proyección de imagen en vivo no es recomendable, ya que la absorción por la hemoglobina, las proteínas y el agua son altos entre 200-650 nm26, que coincide con GFP (excitación 480 nm, emisión a 510 nm)27. Por lo tanto, usando GFP señal como reportero en vivo la proyección de imagen puede ser interrumpida por hemoglobina, proteínas y agua en animales26. La fluorescencia de infrarrojo cercano (NIR) es ideal para en vivo la proyección de imagen porque su ventana de absorbancia es alrededor de 650-900 nm28, que se encuentra en la región de más bajo coeficiente de absorción de la hemoglobina (< 650 nm) y agua (> 900 nm)26 ,28 . Por otra parte, cuando el tejido absorbe la luz, es una oportunidad para inducir la autofluorescencia. Cuando la gama de las longitudes de onda de excitación y emisión en la ventana GFP, induce más autofluorescence de NIR29. Uso de NIR puede mejorar la relación señal a fondo en comparación con la de GFP eliminando el autofluorescence fondo29. Bioluminiscencia no requieren excitación de energía para generar luz visible. Depende de la reacción para catalizar luciferin del substrato por su luciferase enzima y generar luz. Puesto que la bioluminiscencia no requiere luz directa en una muestra, la señal de fondo de una muestra es muy baja. Por lo tanto, el uso de la bioluminiscencia como reportero es más general y fácil para la proyección de imagen en vivo . En contraste, la fluorescencia requiere excitación luz para inducir la luz de la señal. Cuando los tejidos absorben la luz, existe la posibilidad de que la luz fluorescente se emite e inducir autofluorescencia para que su señal de ruido más alto es comparada con la de bioluminiscencia.

Teniendo en cuenta EHEC es naturalmente menos colonizado en ratones de la infección oral2,22, un patógeno natural de mucosa de los ratones, llamado Citrobacter rodentium, se ha utilizado para estudiar el mecanismo de colonización a anfitrión murino como un sustituta de bacteria22,30. Ambos de EHEC y C. rodentium colonizan la mucosa intestinal e inducen la formación de lesiones A/E en host22,30. Contienen también la isla de patogenicidad LEE, que codifica un T3SS y varias proteínas efectoras que indujo A/E lesión22,30. Por lo tanto, el uso de luciferase expresando plásmido como reportero en C. rodentium para detectar la patología de la colonización y estudiar el mecanismo de colonización a través de un sistema de proyección de imagen en vivo también ha sido reportado14, 15. sin embargo, mientras que C. rodentium infección de ratones es un modelo útil para investigar la función de T3SS y el mecanismo de lesión A/E, C. rodentium carece de Shiga toxina (Stx)30, que es dominante factor de virulencia que provoca insuficiencia renal en EHEC, especialmente el serotipo O157: H73. Aunque se ha construido una cepa Stx-expresión C. rodentium recientemente31, que es más realista a la infección por EHEC, no incluye otros posibles factores de virulencia de ECEH que son cruciales para la colonización o infección. Además, C. rodentium comparte el 67% de sus genes con EHEC32, que sugiere que EHEC puede usar una virulencia distinta de C. rodentium durante la colonización o infección.

Fue modificada la luciferasa expresando plásmido utilizado aquí, pWF27913, pAKlux29 cuya columna vertebral es pBBR1MCS433. Aunque pBBR1MCS4 han sido probados y replicados en diferentes bacterias33, es crucial asegurar el origen de replicación (ORI) de este plásmido es conveniente para el anfitrión bacteriano antes de usar este sistema luciferasa basado en el plásmido por el experimento y lo que confirma que este luciferase expresando plásmido puede replicar en el anfitrión bacteriano. Utilizamos antibióticos estrés para mantener la estabilidad del plásmido en la bacteria. Cuando las bacterias entran animales en ausencia de antibióticos, se ha detectado la señal bioluminiscente de tipo salvaje EHEC por al menos 2 días. Sin embargo, no después de la infección por más de 2 días porque ya habíamos visto una diferencia significativa en la intensidad luminiscente entre peso de EHEC y EHEC Asociación (que codifica un gen para sintetizar LPS intactos de EHEC) mutante en 2 días. Para mantener el plásmido estable en las bacterias bajo la ausencia de antibióticos, un plásmido pCM1710,34 puede utilizarse para este propósito. pCM17 codifica un sistema de particionamiento de dos plásmidos y un mecanismo de matanza post-segregational para garantizar el mantenimiento del plásmido en la bacteria en ausencia de antibióticos10,34. El plásmido pCM17 que contiene el operón luxCDABE impulsado por el promotor OmpC puede detectarse señales bioluminiscentes para por lo menos 7 días8. Un método alternativo para obtener una bacteria continua expresión bioluminiscente en ausencia de antibióticos es insertar luxABCDE gen en el cromosoma bacteriano35. Transposon de Francis et al utiliza inserta el casete de operon y antibióticos luxABCDE que inserta al azar en el cromosoma de Streptococcus pneumoniae a obtener la bioluminiscencia cepa estable35.

En nuestro anterior estudio13, utilizamos este sistema modelo para estudiar la colonización de EHEC en un host y comparar la diferencia de capacidad de colonización entre el EHEC tipo salvaje (WT) y mutante13. Cuando los ratones fueron administrados el mutante bioluminiscente de Asociación EHEC, las señales bioluminiscentes disminuidas dramáticamente en comparación con el que de EHEC de peso después de 2 días post infección. Proporciona evidencia que este modelo murino puede analizar el efecto de la mutación de la colonización de la ECEH en el host. Además, tratamientos terapéuticos para reducir la colonización de EHEC es una solución considerada, potencial a la infección por EHEC ya que el uso de antibióticos está contraindicado5,36. Por lo tanto, merece la pena probar si este sistema modelo puede ser utilizado para examinar la eficacia de la colonización medicamentos/tratamientos contra la colonización de enterobacterias en el host. Creemos que mediante este sistema de modelo, es posible examinar el momento y el lugar de EHEC no sólo, sino también otras enterobacterias colonización en vivo. Mediante el uso de este modelo animal, el proceso de colonización de EHEC en ratones puede ser monitoreado y la carga de la colonización en el host puede cuantificarse para determinar la colonización espacial y temporal de ECEH en los animales vivos. La visualización y cuantificación de la colonización de enterobacterias mediante este modelo es una gran herramienta para investigar y analizar los mecanismos finos de colonización enterobacterianas y así compensar la deficiencia de la investigación de la colonización y mejorar el conocimiento actual.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Los autores no tienen nada que revelar.

Acknowledgments

Reconocemos a Chi-Chung Chen del Departamento de investigación médica, centro médico de Chi Mei (Tainan, Taiwan) la ayuda del ratón para la infección y el apoyo del centro de animales de laboratorio de la Universidad Nacional Cheng Kung. Este trabajo es apoyado por el Ministro de ciencia y tecnología (MOST) subvenciones (más 104-2321-B-006-019, 105-2321-B-006-011,-005 de and106-2321-B-006) a CC.

Materials

Name Company Catalog Number Comments
Shaker incubator YIH DER LM-570R bacteria incubation 
Orbital shaking incubator FIRSTEK S300 bacteria incubation 
pBSL180 source of nptII gene
pAKlux2 source of luxCDABE operon
T&A Cloning Kit Yeastern Biotech FYC001-20P use for TA cloning 
Nsi I NEB R0127S use for plasmid cloning 
Sca I NEB R0122S use for plasmid cloning 
Spe I-HF NEB R0133S use for plasmid cloning 
Sma NEB R0141S use for plasmid cloning 
T4 ligase NEB M0202S use for plasmid cloning 
Ex Taq TaKaRa RR001A use for PCR amplification
10X Ex Taq Buffer TaKaRa RR001A use for PCR amplification
dNTP Mixture  TaKaRa RR001A use for PCR amplification
PCR machine applied Biosystem  2720 thermal cycler   for PCR amplification
Glycerol SIGMA G5516-1L use for bacteria stocking solution
NaCl Sigma 31434-5KG-R chemical for making LB medium, 10 g/L
Tryptone CONDA pronadisa Cat 1612.00 chemical for making LB medium, 10 g/L
Yeast Extract powder Affymetrix 23547-1 KG chemical for making LB medium, 5 g/L
Agar CONDA pronadisa Cat 1802.00 chemical for making LB agar
kanamycin  Sigma K4000-5G antibiotics, use for seleciton
streptomycin  Sigma S6501-100G antibiotics, eliminate the microbiota in mice
EDL933 competent cell Homemade method is on supplemental document 
Electroporator MicroPulser for electroporation
Electroporation Cuvettes Gene Pulser/MicroPulser 1652086 for electroporation
High-speed centrifuge Beckman Coulter Avanti, J-26S XP use for centrifuging bacteria 
Fixed-Angle Rotor Beckman Coulter JA25.5 use for centrifuging bacteria 
Fixed-Angle Rotor Beckman Coulter JLA10.5 use for centrifuging bacteria 
centrifuge bottles Beckman Coulter REF357003 use for centrifuging bacteria 
centrifuge bottles Thermo Fisher scientific 3141-0500 use for centrifuging bacteria 
eppendorf biophotometer plus  eppendorf AG 22331 hamburg for measuring the OD600 value of bacteria
C57BL/6 mice  Laboratory Animal Center of NCKU
lab coat, gloves for personnel protection 
isoflurane  Panion & BF Biotech Inc. G-8669 for mice anesthesia, pharmaceutical grade
1ml syringe  use for oral gavage of mice
Reusable 22 G ball-tipped feeding needle φ0.9 mm X L 50 mm use for oral gavage of mice
surgical  scissors  use for mice experiment
Xenogen IVIS 200 imaging system Perkin Elmer IVIS spectrum use for bioluminescent image capture 
Living Image Software Perkin Elmer version 4.1 use for quantifying the image data

DOWNLOAD MATERIALS LIST

References

  1. Pennington, H. Escherichia coli O157. Lancet. 376, (9750), 1428-1435 (2010).
  2. Mayer, C. L., Leibowitz, C. S., Kurosawa, S., Stearns-Kurosawa, D. J. Shiga toxins and the pathophysiology of hemolytic uremic syndrome in humans and animals. Toxins (Basel). 4, (11), 1261-1287 (2012).
  3. Tarr, P. I., Gordon, C. A., Chandler, W. L. Shiga-toxin-producing Escherichia coli and haemolytic uraemic syndrome. Lancet. 365, (9464), 1073-1086 (2005).
  4. Obrig, T. G. Escherichia coli Shiga Toxin Mechanisms of Action in Renal Disease. Toxins (Basel). 2, (12), 2769-2794 (2010).
  5. Nguyen, Y., Sperandio, V. Enterohemorrhagic E. coli (EHEC) pathogenesis. Front Cell Infect Microbiol. 2, 90 (2012).
  6. Wiles, S., Robertson, B. D., Frankel, G., Kerton, A. Bioluminescent monitoring of in vivo colonization and clearance dynamics by light-emitting bacteria. Methods Mol Biol. 574, 137-153 (2009).
  7. Hutchens, M., Luker, G. D. Applications of bioluminescence imaging to the study of infectious diseases. Cell Microbiol. 9, (10), 2315-2322 (2007).
  8. Rhee, K. J., et al. Determination of spatial and temporal colonization of enteropathogenic E. coli and enterohemorrhagic E. coli in mice using bioluminescent in vivo imaging. Gut Microbes. 2, (1), 34-41 (2011).
  9. Karsi, A., Lawrence, M. L. Broad host range fluorescence and bioluminescence expression vectors for Gram-negative bacteria. Plasmid. 57, (3), 286-295 (2007).
  10. Lane, M. C., Alteri, C. J. S., Smith, S. N., Mobley, L. H. Expression of flagella is coincident with uropathogenic Escherichia coli ascension to the upper urinary tract. Proc Natl Acad Sci U S A. 104, (42), 16669-16674 (2007).
  11. Roxas, J. L., et al. Enterohemorrhagic E. coli alters murine intestinal epithelial tight junction protein expression and barrier function in a Shiga toxin independent manner. Lab Invest. 90, (8), 1152-1168 (2010).
  12. Siragusa, G. R., Nawotka, K., Spilman, S. D., Contag, P. R., Contag, C. H. Real-Time Monitoring of Escherichia coli O157:H7 Adherence to Beef Carcass Surface Tissues with a Bioluminescent Reporter. (1999).
  13. Kuo, C. J., et al. Mutation of the Enterohemorrhagic Escherichia coli Core LPS Biosynthesis Enzyme RfaD Confers Hypersusceptibility to Host Intestinal Innate Immunity In vivo. Front Cell Infect Microbiol. 6, 82 (2016).
  14. Wiles, S., et al. Organ specificity, colonization and clearance dynamics in vivo following oral challenges with the murine pathogen Citrobacter rodentium. Cell Microbiol. 6, (10), 963-972 (2004).
  15. Wiles, S., Pickard, K. M., Peng, K., MacDonald, T. T., Frankel, G. In vivo bioluminescence imaging of the murine pathogen Citrobacter rodentium. Infect Immun. 74, (9), 5391-5396 (2006).
  16. Contag, C. H., Contag, P. R., Mullins, J. I., Spillman, S. D., Stevenson, D. K., Benaron, D. A. Photonic detection of bacterial pathogens in living hosts. Mol Microbiol. 18, (4), 593-603 (1995).
  17. Hardy, J., Francis, K. P., DeBoer, M., Chu, P., Gibbs, K., Contag, C. H. Extracellular replication of Listeria monocytogenes in the murine gall bladder. Science. 303, (5659), 851-853 (2004).
  18. Kaniga, K., Sory, M. P., Delor, I., Saegerman, C., Limet, J. N., Cornelis, G. R. Monitoring of Yersinia enterocolitica in Murine and Bovine Feces on the Basis of the Chromosomally Integrated luxAB Marker Gene. Appl Environ Microbiol. 58, (3), 1024-1026 (1992).
  19. Trcek, J., Fuchs, T. M., Trulzsch, K. Analysis of Yersinia enterocolitica invasin expression in vitro and in vivo using a novel luxCDABE reporter system. Microbiology. 156, (Pt 9), 2734-2745 (2010).
  20. Morin, C. E., Kaper, J. B. Use of stabilized luciferase-expressing plasmids to examine in vivo-induced promoters in the Vibrio cholerae vaccine strain CVD 103-HgR. FEMS Immunol Med Microbiol. 57, (1), 69-79 (2009).
  21. Law, R. J., Gur-Arie, L., Rosenshine, I., Finlay, B. B. In vitro and in vivo model systems for studying enteropathogenic Escherichia coli infections. Cold Spring Harb Perspect Med. 3, (3), a009977 (2013).
  22. Ritchie, J. M. Animal Models of Enterohemorrhagic Escherichia coli Infection. Microbiol Spectr. 2, (4), EHEC-0022-2013 (2014).
  23. Chou, T. C., et al. Enterohaemorrhagic Escherichia coli O157:H7 Shiga-like toxin 1 is required for full pathogenicity and activation of the p38 mitogen-activated protein kinase pathway in Caenorhabditis elegans. Cell Microbiol. 15, (1), 82-97 (2013).
  24. Alexeyev, M. F., Shokolenko, I. N. Mini-Tnl 0 transposon derivatives for insertion mutagenesis and gene delivery into the chromosome of Gram-negative bacteria. Gene. 160, (1), 59-62 (1995).
  25. Wiegand, I., Hilpert, K., Hancock, R. E. Agar and broth dilution methods to determine the minimal inhibitory concentration (MIC) of antimicrobial substances. Nat Protoc. 3, (2), 163-175 (2008).
  26. Pansare, V., Hejazi, S., Faenza, W., Prud'homme, R. K. Review of Long-Wavelength Optical and NIR Imaging Materials: Contrast Agents, Fluorophores and Multifunctional Nano Carriers. Chem Mater. 24, (5), 812-827 (2012).
  27. Heim, R., Cubitt, A. B., Tsien, R. Y. Improved green fluorescence. Nature. 373, (6516), 663-664 (1995).
  28. Weissleder, R. A clearer vision for in vivo imaging. Nat Biotechnol. 19, (4), 316-317 (2001).
  29. Frangioni, J. In vivo near-infrared fluorescence imaging. Current Opinion in Chemical Biology. 7, (5), 626-634 (2003).
  30. Collins, J. W., et al. Citrobacter rodentium: infection, inflammation and the microbiota. Nat Rev Microbiol. 12, (9), 612-623 (2014).
  31. Mallick, E. M., et al. A novel murine infection model for Shiga toxin-producing Escherichia coli. J Clin Invest. 122, (11), 4012-4024 (2012).
  32. Petty, N. K., et al. The Citrobacter rodentium genome sequence reveals convergent evolution with human pathogenic Escherichia coli. J Bacteriol. 192, (2), 525-538 (2010).
  33. Kovach, M. E., Elzer, P. H., Hill, D. S., Robertson , G. T., Farris, M. A., Roop, R. M. II, Peterson, K. M. Four new derivatives of the broad-host-range cloning vector pBBR1MCS, carrying different antibiotic-resistance cassettes. Gene. 166, (1), 175-176 (1995).
  34. Galen, J. E., Nair, J., Wang , J. Y., Wasserman, S. S., Tanner, M. K., Sztein , M. B., Levine, M. M. Optimization of Plasmid Maintenance in the Attenuated Live Vector Vaccine Strain Salmonella typhiCVD 908-htrA. Infect Immun. 67, (12), 6424-6433 (1999).
  35. Francis, K. P., et al. Visualizing pneumococcal infections in the lungs of live mice using bioluminescent Streptococcus pneumoniae transformed with a novel gram-positive lux transposon. Infect Immun. 69, (5), 3350-3358 (2001).
  36. Goldwater, P. N., Bettelheim, K. A. Treatment of enterohemorrhagic Escherichia coli (EHEC) infection and hemolytic uremic syndrome (HUS). BMC Med. 10, (2012).
Detección de la colonización de <em>Escherichia Coli</em> enterohemorrágica en anfitrión murino no invasiva <em>In Vivo</em> el sistema de bioluminiscencia
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Kuo, C. J., Wang, S. T., Chen, C. S. Detection of Enterohemorrhagic Escherichia Coli Colonization in Murine Host by Non-invasive In Vivo Bioluminescence System. J. Vis. Exp. (134), e56169, doi:10.3791/56169 (2018).More

Kuo, C. J., Wang, S. T., Chen, C. S. Detection of Enterohemorrhagic Escherichia Coli Colonization in Murine Host by Non-invasive In Vivo Bioluminescence System. J. Vis. Exp. (134), e56169, doi:10.3791/56169 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter