Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Een Protocol voor het laboratorium huisvesting van Turquoise Killifish (Nothobranchius furzeri)

doi: 10.3791/57073 Published: April 11, 2018

Summary

Laboratorium behuizing van turkoois poolfish kan worden opgeschaald naar huis en duizenden afzonderlijke vissen efficiënt te verhogen in een gecentraliseerde water filtratie-systeem, met dezelfde infrastructuur gebruikt voor standaard zebrafish faciliteiten. Hier detail we een aantal gestandaardiseerde procedures waarmee efficiënte poolfish onderhoud.

Abstract

De ontwikkeling van veehouderijpraktijken in niet-model laboratorium vis voor experimentele doeleinden gebruikte heeft sterk geprofiteerd van de oprichting van referentie vis modelsystemen, zoals zebravis en medaka. In de afgelopen jaren is een opkomende vis – de turquoise poolfish (Nothobranchius furzeri)-goedgekeurd door een groeiend aantal onderzoeksgroepen op het gebied van biologie van veroudering en ecologie. Met een captive levensduur van 4-8 maanden, deze soort is de massiever gewervelde opgegroeid in gevangenschap en maakt van de wetenschappelijke gemeenschap test – in een korte tijd – experimentele interventies die tot wijzigingen van het groeitempo van de veroudering en levensverwachting leiden kunnen. Gezien de unieke biologie van deze soort, gekenmerkt door embryonale diapauze, explosieve seksuele rijping, gemarkeerd morfologische en gedragsmatige seksueel dimorfisme- en hun volwassen relatief korte levensduur - ad hoc veehouderij praktijken in dringende zijn vraag. Dit protocol rapporteert een reeks belangrijke veehouderij maatregelen waarmee optimale turquoise poolfish laboratorium zorg, waardoor de wetenschappelijke gemeenschap te nemen van deze soort als een dierlijk model van krachtige laboratorium.

Introduction

Gezien hun korte levensduur en snelle levenscyclus, groeien turquoise poolfish snel als een veelbelovende nieuwe model-organisme in biologie1,2,3. Deze soort wordt gekenmerkt door een unieke life cycle voor een teleost, bestaande uit embryonale diapauze, snelle seksuele rijping en een langere levensduur van de post-reproductive fase4,5. Recent werk heeft bijgedragen aan het ophelderen van de biologie van deze soorten in gevangenschap zowel in het wild6,-7. Turquoise poolfish leven in seizoensgebonden verse waterlichamen die vorm tijdens het regenseizoen in de Afrikaanse savanne in Zimbabwe en Mozambique. Tijdens het droge seizoen overleven embryo's in de droge modder in de afwezigheid van water op grond van een stress-bestendig leven stadium genoemd diapauze.

Genetische kaarten voor deze soort geweest gegenereerde8,9, en onlangs hun genoom geweest gesequenceerd en gemonteerd10,11. Verschillende ingeteelde laboratorium vis stammen zijn ontwikkeld, en Transgenese en genoom bewerken via CRISPR/Cas9 zijn beschikbaar in deze soort, feitelijke bevordering van turquoise poolfish als een concurrerende laboratorium gewervelde modelorganisme geworden 12,13,14.

Hoewel een laboratorium protocol reeds gepubliceerd voor deze soorten15, in het huidige protocol ontwikkelen we een uitgebreide lijst van experimenteel laboratorium richtlijnen die specifiek gericht zijn op studies die veroudering en overleving onderzoeken. Dit protocol kan onderzoekers al vertrouwd met de zebravis en medaka veeteelt worden berijmd in turquoise poolfish veehouderij door vaststelling van een minimum aantal belangrijke aanpassingen. Op hetzelfde moment biedt dit protocol onderzoekers zonder voorafgaande ervaring in vis veehouderij met de essentiële instrumenten te verhogen van een bloeiende turquoise poolfish kolonie.

Protocol

Vissen zijn opgegroeid bij 28 ° C in een recirculatiesysteem water (Zie Water Parameters), met 10-20% dagelijks water verwijdering. Drie verschillende tank maten worden aanbevolen: 0.8 L, 2.8 L en 9.5 L. Elke tank ontvangt een constante waterstroom van 2 mL/s.

1. reagentia voorbereiding (niet inbegrepen in de materialen)

Opmerking: Afrikaanse turkoois poolfish (Nothobranchius furzeri) kan worden verstrekt uit de voorraad van een gevestigde laboratorium. De jaarlijkse poolfish uitdroging-resistente embryo's kunnen per post worden verstuurd. Het is essentieel om het schip van de embryo's binnen 8-30 ° C temperatuurbereik.

  1. Bereid humuszuur (uitkomen)-oplossing door het oplossen van 1 g/L humuszuur in systeem water. Autoclaaf en bewaren bij 4 ° C voor maximaal 10 weken.
  2. Voor het voorbereiden van HUFA Artemia verrijking, voeg toe HUFA verrijking aan Artemia hatcher dagelijks bij een concentratie 500 µL/L van Artemia oplossing.
  3. Bereid methyleenblauwoplossing door 100 µL/L van de stockoplossing methyleenblauw in eerder gesteriliseerde met autoclaaf systeem water oplost. Omdat methyleenblauw lichtgevoelig is, bewaar de oplossing in donkere flessen of dek af met folie. Winkel op RT.
  4. Voorbereiden op kokos vezel als een solide ondergrond embryo incubatie. Ook gebruiken een filtreerpapier (zie punt 1.5).
    1. Presoak kokos vezel met gedestilleerd water. Autoclaaf en bewaren bij 4 ° C voor maximaal 5 weken.
    2. Bereiden op de dag van de embryotransfer, petrischaal met vochtige kokos vezel.
    3. Vul een 90 mm diameter petrischaal met kokos vezel onder een zuurkast en naast een vlam, ter beperking van verontreiniging door gisten en bacteriën.
    4. Compacte kokos vezel tot een hoogte van 1 cm, met steriele weefsels. De meeste van het vocht uit de kokos vezel door te drukken op een papieren handdoek op de top van de plaat, om het papier te absorberen het overtollige water te laten verwijderen. Verwarm een metalen lepel in de vlam en druk naar beneden op het gehele oppervlak van kokos vezels. Hiermee voorkomt u dat kokos vezel schimmel/bacteriële besmetting.
  5. Voorbereiden op het filtreerpapier als solide substraat embryo incubatie.
    1. Op de dag van de overdracht van de embryo's, plaatst u 3 lagen filterpapier schijven die passen bij de petrischaal 90 mm. Voeg 5 mL humic zure oplossing te houden vochtigheid.

2. kweken

  1. Fokken van turquoise poolfish voor onderhoud van de stam
    Opmerking: Naar aanleiding van dit protocol, seksuele volwassenheid is bereikt op ~ 4 weken na uitkomen en vruchtbaarheid pieken tussen 7-9 weken. Het is van cruciaal belang om op te merken dat vruchtbaarheid is afhankelijk van voeding van de frequentie en de kwaliteit van de levensmiddelen; Daarom, ten minste twee voedingen per dag per tank fokken worden aanbevolen om de opbrengst van de embryo's (zie punt 5.6.)
    1. Setup een 9.5 L fokken tank. Vul met systeem water en voeg een mannelijke en twee vrouwelijke vissen.
    2. Als mannelijke Afrikaanse turkoois poolfish dominantie weergeven tijdens de paring, die tot intimidatie van vrouwen leiden kan, kiezen een mannetje met een licht lichaam kleiner dan het vrouwtje aan paring stress te verminderen en het voortplantingsresultaat te verhogen. Opgericht 5-week-oude mannetjes met 6/7 weken oude vrouwtjes.
    3. Vul een plastic container (10 x 10 x 5 cm) met gesteriliseerde met autoclaaf zand voor het bereiken van een definitieve diepte van ~ 2-3 cm en plaats de zandbak in het midden van de fok tank.
    4. Laat turkoois poolfish voortdurend kweken en oogsten van embryo's een keer per week voor de embryo incubatie.
      Opmerking: Het gebruik van zand substraat uitdagingen tot centrale filtersystemen plaatst en moet worden vervangen door alternatieve methoden in de toekomst. Mogelijke alternatieven zou het gebruik van zebravis fokken van tanks.
  2. Fokken voor Transgenese
    Opmerking: Embryo's te gebruiken voor injecties moeten worden gesynchroniseerd in de een-cel-stadium, en dit vereist dat ze worden verzameld onmiddellijk na bevruchting.
    1. Het verkrijgen van een-cel-fase embryo's te gebruiken voor injectie en generatie transgene lijnen, instellen een fok tank met een mannelijke en twee vrouwelijke vissen (zelfde als 2.1.).
    2. Twee dagen vóór de embryo's worden verzameld, isoleren de man in een individuele tank en het mannetje in visueel contact houden met volwassen vrouwtjes.
    3. Op de dag van inzameling, het mannetje en een zandbak toevoegen aan de tank fokken en laten paaien gedurende 2 uur.

3. de embryo veehouderij

  1. Embryo's worden verzameld
    Opmerking: De embryo's worden verzameld wordt uitgevoerd door zeven en oogsten van embryo's uit de zandbak. Onder normale omstandigheden, moet elke zandbak bevatten van 30 tot 200 embryo's.
    1. Op de dag van inzameling, zandbak uit de fok tank te verwijderen. De zandbak in een zeef (~0.9 mm stam grootte) leeg en spoel met water van het systeem. Dit kan worden gedaan over een grote tank voor het verzamelen van zand voor de autoclaaf.
    2. Gedeeltelijk de zeef in systeem water dompelen en swirl zachtjes, laten de embryo's te groeperen in het midden.
    3. Het verzamelen van embryo's met 10 mL Pipet van Pasteur.
    4. Embryo's overbrengen in een 90 mm petrischaal in ~ 40 mL water systeem.
    5. Inspecteren van embryo's in de petrischaal onder een lichte stereomicroscoop en verwijder de presentatie van de gescheurde chorion en tekenen van schade.
    6. Ga direct naar het Embryo bleken.
      Opmerking: Gebruik altijd een zeef per vis spanning om te voorkomen dat potentiële Kruis-stam embryo verontreinigingen.
  2. Embryo bleken
    Noot: Embryo bleken voorkomt dat micro-organismen aanwezig in aquaria van verontreiniging van de incubatie-media.
    1. Voorafgaand aan bleken, gebruik een wegwerp Pipet van Pasteur de systeem om water te verwijderen uit de petrischaal met verzamelde embryo's.
    2. Voorkom ongewenste schimmel en bacteriële groei en voeg 50 mL vers bereide H2O2 (1% v/v in gesteriliseerde met autoclaaf systeem water) op de verzamelde embryo's.
    3. Schud embryo's gedurende 5 minuten op een lage snelheid in petrischalen 90 mm in 50 mL oplossing.
    4. Verwijder H2O-2 oplossing met Wegwerp pipet van Pasteur en embryo's drie keer voor 5 min met 50 mL methyleenblauwoplossing wassen. Verwijder methyleenblauwoplossing.
    5. Voeg 50 mL H2O2 (1% v/v in gesteriliseerde met autoclaaf systeem water) op embryo's en schud gedurende 5 minuten.
    6. H2O2 -oplossing verwijderen en wassen drie keer, gedurende 5 min met 50 mL methyleenblauwoplossing.
    7. Incubeer embryo's bij 28 ° C tot synchrone embryo's ontwikkelen, op een maximale dichtheid van 100 embryo's per 90 mm petrischaal in 40 mL methyleenblauwoplossing verhogen.
      Opmerking: Geen embryo incubatie in de bleken oplossing uitbreiden Dit kan leiden tot schade aan de chorion ei en verhogen embryo sterfte. Embryo bleken kan grote fysisch-chemische veranderingen veroorzaken in het ei chorion die kan resulteren in gewijzigde chorion fysiologie en broedeieren van succes.
  3. Embryo incubatie methyleen blauw
    Opmerking: Vloeibare incubatie in methyleenblauwoplossing voorkomt de groei van de parasiet en maakt detectie van dode embryo's en onbevruchte eieren.
    1. Inspecteer bebroede embryo's, verwijderen van alle dode embryo's (blauw gekleurd door methyleenblauw) uit de petrischaal om te voorkomen dat schimmel en bacteriële besmetting die invloed hebben op het voortbestaan van levende gezonde embryo's.
    2. Oude methyleenblauwoplossing verwijderen en vervangen door verse oplossing.
    3. Petrischaal terug naar 28 ° C incubator (figuur 1A). Binnen 7-10 dagen, te controleren of de ontwikkelde embryo's zichtbare zwarte ogen. Deze embryo's overbrengen in de kokos vezel of het filtreerpapier solide substraat medium (figuur 1B).
    4. Behouden van onontwikkelde embryo's in methyleenblauw, dagelijks controleren en overbrengen naar solide substraat medium zodra zwarte ogen hebben ontwikkeld.
    5. Herhaal de stappen 3.3.1-3.3.3 dagelijks embryo's hebben zichtbaar zwarte ogen.
      Opmerking: Constante Gasbedwelming met behulp van embryo's methyleenblauw op lange termijn veranderingen in de Fysiologie van de volwassen vis veroorzaken.
  4. Embryotransfer met filtreerpapier
    Opmerking: Turquoise poolfish embryo's kunnen ontwikkelen op een droge ondergrond, Recapitulerend natuurlijke omstandigheden. Bovendien, kan droge embryo incubatie onderzoekers ze uitkomen op dezelfde dag te synchroniseren van embryo's.
    1. Aangezien ontwikkelde embryo's zichtbare zwarte ogen binnen 7-10 dagen, kunt een wegwerp Pipet van Pasteur of fijne gebogen pincet embryo's van de methyleenblauwoplossing op een eerder bereid filtreerpapier bord overbrengen.
    2. Verspreid embryo's ~ 5 mm uit elkaar met een tang, tot 100 embryo's per 90 mm plaat (figuur 1B).
    3. Het zegel van de petrischaal met parafilm.
    4. Incubeer embryo's bij 28 ° C gedurende 2-3 weken, totdat ze volledig gouden irissen hebben ontwikkeld en klaar zijn voor broedeieren (Figuur 1 c).
      Opmerking: Geen verlenging mee incubatie van klaar-aan-hatch embryo's voor meer dan 2 weken als hun levensvatbaarheid drastisch zal worden verminderd.
  5. Embryotransfer naar kokos fiber
    Opmerking: Gesteriliseerde met autoclaaf, steriele kokos vezel (of organische veenmos) kan worden gebruikt als een geldige alternatieve medium voor solide substraat incubatie.
    1. Gebruik een wegwerp Pipet van Pasteur of fijne gebogen pincet overdracht van embryo's van de methyleenblauwoplossing op een kant-en-klare kokos vezel bord.
    2. Verspreiden van embryo's ~ 5 mm uit elkaar, tot 100 embryo's per 90 mm plaat (figuur 1B).
    3. Het zegel van de petrischaal met parafilm.
    4. Incubeer embryo's bij 28 ° C gedurende 2-3 weken, totdat zij hebben volledig ontwikkeld gouden irissen (bv. in Figuur 1 c).
      Opmerking: Voor opslag op lange termijn (tot één jaar), transfer embryo's bij 3-daags bericht collectie van methyleenblauw oplossingen naar een solid-substraat plaat bij 17 ° C. Incubeer embryo's totdat zij zwarte ogen ontwikkelen.

4. broedeieren Turquoise poolfish

Opmerking: Turquoise poolfish embryo's kunnen met succes worden uitgebroed in een humic zuuroplossing14.

  1. Het gebruik van fijne gebogen pincet, ontwikkeld overdracht zorgvuldig 50-100 embryo's in het vak van de broedeieren gevuld met de humus zure oplossing bij 4 ° C. De humic zure oplossing bestaat uit 1 g/L humuszuur in systeem water. Autoclaaf en bewaren bij 4 ° C voor maximaal 10 weken. Zorg ervoor dat alle embryo's volledig worden ondergedompeld. De humic zure oplossing moet ondiepe, niet dieper dan 2 cm.
    Opmerking: Lage temperatuur van humic zuuroplossing verbetert broedeieren en volledige onderdompeling van de embryo's in de oplossing kunt gesynchroniseerde broedeieren.
  2. Plaats de broedeieren vak in de incubator 28 ° C uitkomen. Dekking van de broedeieren doos met het deksel. Sluit voor de levering van voldoende beluchting, broedeieren vak door buizen met luchttoevoer.
    Opmerking: Niet voldoende beluchting tijdens de incubatie resulteert in hoge tarieven van FRJ niet kundig voor vullen van de blaas gas ("buik-slider" fenotype, zie opmerking in punt 5.1)
  3. Vanaf de dag na het uitkomen, wilt behouden van de kwaliteit van voldoende water in het vak van broedeieren, voeg gesteriliseerde met autoclaaf systeem water eenmaal per dag in de verhouding van 1:1, houden een definitieve diepte van 2 cm.
  4. Overdracht van unhatched embryo's terug naar de vaste ondergrond, en proberen een week later broedeieren.
    Opmerking: Op broedeieren, turquoise poolfish zijn gemakkelijk in staat om de opname en levend voer verbruiken. Feed voor optimale groei, fry tweemaal per dag met overtollige vers gearceerde Artemia (Artemia salina). Het teken van volledige verzadiging is de oranje-gekleurde buikjes van FRJ na 10-15 min voor elke voeding. Sifon uit de overtollige, opgegeten en opgesplitste pekel garnalen met behulp van een pipet van Pasteur op een dagelijkse basis.

5. verbetering van de jeugd- en volwassen vis

  1. Vijf dagen na broedeieren, jonge exemplaren naar het watersysteem opnieuw omloop te verplaatsen. Gebruik wegwerp plastic pipetten (of een plastic lepel), zorgvuldig overdracht vijf jonge exemplaren per 0.8 L tank uitgerust met 400 µm fry scherm (Figuur 2).
    Opmerking: Het is mogelijk dat een deel van de jonge poolfish zal niet hebben vervuld de gas blaas, wat resulteert in een typische "buik-slider" fenotype, gekenmerkt door vis niet bereiken van de juiste drijfvermogen, dwingen hen continu zwemmen, waardoor ernstige misvormingen in volwassen vis. Deze vis kan niet worden gebruikt voor overleving testen of voor de efficiënte fokkerij en moeten worden gecensureerd.
  2. Voeden de jonge exemplaren tweemaal per dag met vers gearceerde Artemia in overmaat tot 14 dagen na broedeieren. Sifon uit puin vanaf de onderkant van elke tank dagelijks.
  3. Na 14 dagen oud, overdracht jonge vis 2.8 L tank uitgerust met een scherm van de FRJ 850 µm. Vanaf dit moment label elke tank met vis ID, datum, stam informatie, vis geslacht en vis identificatienummer (Figuur 3) die aangeeft uitkomen. Voor overleving testen, individueel huis elke vis in één tanks vanaf dit moment.
  4. Voor de volgende 7 dagen, jonge exemplaren tweemaal per dag te voeden met ~ 2 mL pekel garnalen per vis. In dit stadium vis kunnen worden aangevuld met live bloedwormen 1-3 (in het geval dat de worm-larven van bloed zijn te groot voor de vis, snijd ze in kleinere stukken met een scheermesje). Om te voorkomen dat een verslechtering van de waterkwaliteit, sifon opgegeten voedsel en extra afval tweemaal per week.
  5. Na 3 weken van broedeieren, fry scherm verwijderen vanaf de achterkant van de tank en beginnen te voeden elke vis tweemaal per dag ~ 2mL pekel garnalen en 0,5 mL bloed worm. In dit stadium, jonge exemplaren moeten 1 cm in de lichaamsgrootte hebben bereikt en moeten in staat zijn van inname van full-size bloed worm.
  6. Voeden op 4 weken leeftijd, elke vis tweemaal per dag met ~ 2mL pekel garnalen en 1 mL bloed worm. Vrouwtjes kunnen mede worden ondergebracht bij een dichtheid van maximaal 3 vrouwtjes per 2.8 L tank.
  7. Zorgen dat vis volledige seksuele rijping bereiken in dit stadium. Controleren op de aanwezigheid van grote caudal, dorsale en anale vinnen met tekenen van verkleuring bij mannen en ronde buikjes vol eieren bij vrouwtjes.
    Opmerking: Verhogen van volwassen vis in individuele tanks voor overleving cohortstudies negatief kan beïnvloeden, vis gedrag en gezondheid. Groepshuisvesting voor overleving cohortstudies voegt echter belangrijke storende factoren als gevolg van de invoering van sociale dominantie en mannelijke gebieden, wat leidt tot strikte sociale hiërarchieën.

6. feeding

Opmerking: Laboratorium turquoise poolfish kan worden gevoed een combinatie van baby Artemia (Artemia salina naupliën) en bloed worm (de larven van deChironomus spp. ). Turquoise poolfish fry zijn uitsluitend baby Artemia gevoed. Jeugd- en volwassen vis worden gevoed twee keer per dag Artemia zowel bloed worm (Figuur 2). In het ideale geval vis kan meerdere malen per dag worden gevoed, meer dan de 2 voedingen aangegeven in dit protocol.

  1. Artemia kweken
    1. 10 L van omgekeerde osmose (RO) water en 350 g rode zee zout toevoegen aan een Artemia hatcher en ontbinden door beluchting met een buis beluchting.
    2. Verrijken van de cultuur met 5 mL van sterk onverzadigde vetzuren (HUFA).
    3. Voeg 20 g van Artemia-cysten in de oplossing van de broedeieren. Inspecteren dat Artemia-cysten niet op het oppervlak van het water drijven en zorgen voor goede oxygenatie en verspreiding van de cultuur.
      Opmerking: Dagelijkse aliquots van droge Artemia-cysten kunnen worden opgeslagen bij 4 ° C.
    4. Op de middag van de volgende dag, leveren de cultuur met een andere hoeveelheid van 5 mL HUFA.
  2. Gearceerde Artemia oogsten
    Opmerking: Na ~ 36 h uit de startende cultuur, pekel garnalen zijn klaar voor oogst (instar II fase).
    1. 5 L van de cultuur in een container met behulp van de kraan aan de onderzijde van de hatcher verzamelen en laat het zitten voor 10 minuten.
    2. Na 10 min, verwijderen van Artemia schelpen (bruine kleur) vanaf de bovenkant van de container van 5 L en filteren de gearceerde Artemia (oranje kleur) via een Maas. Aandacht besteden aan het uitsluiten van het sediment gevonden op de bodem van de container, aangezien het bevat niet-gearceerde eieren en Artemia dood.
    3. Gearceerde Artemia met RO water spoel 2 L verpakkingsgasssen en laat het zitten voor 10 minuten.
    4. Na 10 min, Artemia weer door een mesh filter en verzamelen in 2 L van RO water.
    5. Herhaal de vorige drie stappen totdat Artemia oplossing vrij van niet-gearceerde cysten en Artemia schelpen is.
    6. Pipetteer Artemia uit de 2 L container in squeeze flessen voor het voederen.
      Opmerking: Het kweken van Artemia is vrij robuust en betrouwbaar. Om te voorkomen dat een tekort van Artemia in geval van mislukte broedeieren, kunnen kleinere (500 mL) back-uitkomstkasten echter worden gebruikt.
  3. Instellen van de back-hatcher
    1. Los 17,5 g rode zeezout in 500 mL RO water door beluchting.
    2. Verrijken van cultuur met 500 µL van HUFA.
    3. Voeg 2 g van Artemia-cysten.
    4. Na 18-24 h, leveren de cultuur nogmaals met 500 µL van HUFA.
      Opmerking: pekel garnalen zijn klaar om te oogsten na ~ 24 h.
  4. Voorbereiding van levende bloed worm
    1. Onmiddellijk voorafgaand aan het voederen van dieren, een passend bedrag van bloed worm wordt gefiltreerd door een zeef met behulp van RO water.
      Opmerking: Live bloed worm kan worden achtergelaten bij 4 ° C voor 7-10 dagen.
    2. Spoel de worm bloed met een kleine hoeveelheid van RO water in een plastic container.
    3. Met een kunststof Pasteur duren Pipet (smalle tip verwijderd), het bloed worm mengsel voor het voederen.
      Opmerking: Voederen van laboratorium poolfish kolonies met levend voer van VN-gecontroleerde bronnen een risico voor externe verontreinigingen van parasieten en potentieel pathogene microbiële gemeenschappen worden opgeteld. In de toekomst moet een ad hoc-steriele visvoer worden ontwikkeld.

7. killifish laboratorium stam genotypering

Opmerking: Om te onderscheiden tussen turquoise poolfish stammen, evenals om seks binnen elke stam, kunnen specifieke genetische (microsatelliet) markeringen gebruikte9 (tabel 1).

  1. Bemonstering
    1. Houden stevig de vis in een net op de bovenkant van natte spons.
    2. 2-3 schalen uit het lichaam van de vis van de operculum naar de caudal fin met katoenen wissers wisser.
    3. Kies schalen uit het staafje en overdracht van 2-3 schalen in een tube van 1 mL met NaOH-oplossing (200 µL 0,5 mol/L NaOH en 1% β-Mercaptoethanol 0,5% polyvinyl pyrrolidon).
    4. Draai de PCR-buizen voor 15 s om ervoor te zorgen dat de schalen worden volledig ondergedompeld in de NaOH-oplossing.
  2. Genomic DNA isolatie
    1. Incubeer het monster gedurende 20 minuten bij 95 ° C.
    2. Cool op RT, neutraliseren monster met 1/10 volume van 1 M Tris-HCl, pH 8,0.
    3. Centrifugeer het monster gedurende 5 minuten op volle snelheid.

8. water Parameters

Opmerking: Veehouderij van organismen waarvan het beoogde gebruik volwassen fenotypering is vereist zeer stabiele veehouderij voorwaarden gedurende de levensduur van de doelsoort. Daarom, culturing waterorganismen, zoals turquoise killifish, vereist strenge controle van water parameters. Water recirculatie, met extra vier-stappen water filtratie, zorgt voor een robuuste basis te bereiken controle over water parameters, alle tanks voorzien van dezelfde watervoorwaarden na verloop van tijd. Het is aanbevolen om het water systeem van omgekeerde-osmose (RO), toegevoegde water met commerciële mariene zout en natriumbicarbonaat te reconstrueren.

  1. Water circulatie systeem regeling: eerst, afvalwater van vis tanks stromen door vaste deeltjes metalen filter waarmee alle VN-gegeten voedsel puin en grotere deeltjes worden vastgelegd. Metalen filters zijn gespoeld drie keer of meer per week verschijnend Ten tweede, na de eerste mechanische filtratie, water is overgebracht in grote opslagrekken en vervolgens naar een biofilter, gepompt waar bacteriën omgezet in ammoniak nitrieten en nitraten; In de derde plaats van de biofilter, wordt water gepompt naar 25-µm filtermouwen, die val van fijnere deeltjes van de grootte. Tot slot water stroomt door ultraviolet (UV) lampen die water tegen bacteriën en virussen steriliseren. Na deze vier stappen, gefilterd water keert terug naar de aquaria.
  2. Voor het verminderen van de groei van micro-organismen in de tanks, voorkoming van accumulatie van nitraten en verminderen wordt totaal zoutgehalte, 10-20% van het water systeem vernietigd op een dagelijkse basis.
  3. Water temperatuur constant bij 28 ° C, pH-constante water binnen het bereik van 7.0 tot 7,5 handhaven.
  4. Hoewel poolfish breed scala van zoutgehalte tolereren, om te voorkomen dat oodinosis, handhaven geleidbaarheid binnen het bereik 650-710 micro-Siemens. Een jaar lang 12 h licht/donker cyclus zorgt voor kolonie gezondheid en productiviteit.
    Opmerking: Killifish kan tolereren water geleidbaarheid tot 1500 micro-Siemens.

Representative Results

Turquoise poolfish goede veehouderij resulteert in mediane overleving variërend tussen 12-18 weken in de GRZ stam (bijvoorbeeld figuur 4A). Variaties van de mediane overleving is afhankelijk van dieet, voeding van de frequentie, en woonomstandigheden van de temperatuur. Arme veehouderij resultaten in overleving curven presenteren gestegen vervroegde sterfte en repetitieve, plotselinge druppels overleving doorheen de tijd, gekenmerkt door meerdere buigpunten (figuur 4B).

Figure 1
Figuur 1: vertegenwoordiger embryonale ontwikkelingsstadia met respectieve incubatie-substraat. (A) vers verzamelde embryo's, geïncubeerd in methyleenblauwoplossing in de incubator bij 28 ° C. (B) embryo's klaar om te worden overgebracht naar solide medium, filteren of papier of kokos vezel. (C) embryo's klaar om te worden uitgebroed, typische gouden irissen weergeven. De schaal bar bedraagt tot 1 mm. Klik hier voor een grotere versie van dit cijfer.

Figure 2
Figuur 2: stadia van turquoise poolfish post broedeieren ontwikkeling. Klik hier voor een grotere versie van dit cijfer.

Figure 3
Figuur 3: vertegenwoordiger vis ID tag voor vis uit vanaf fase 3. Klik hier voor een grotere versie van dit cijfer.

Figure 4
Figuur 4: vertegenwoordiger overleving curve voor 70 mannelijke turquoise poolfish. (A) typische overleving curve voor turquoise poolfish laboratorium-aan de orde gesteld. (B) vergelijking voor overleving curves verkregen vis verhoogd onder omstandigheden van de optimale veehouderij (zwart) en slechte veehouderij (rood en blauw). De rode horizontale stippellijn geeft 50% overleving, snijdende overleving curve op gemiddelde levensduur (aangegeven op de x-as). Klik hier voor een grotere versie van dit cijfer.

ID Voorwaartse primer Omgekeerde primer Groottewaaier (bp)
* NfuSU0007 GGCTAAGCCTTGCTGACAGA CAGGGAGCTGAAAACCTCAG 166 - 214
* NfuSU0010 CGCAGTCTGATCAAATCGTGT TGTTTGAAGGTTCACATTCATTATC 220 - 272
NfuSU0016 CATGGCTAAACCGTGATGAA GAAGGACGCCAGCTATGAAG 209 - 240
NfuSU0022 AACACAGCTCTCGTAAGGAGGTA TTCAGACTTGTCTTACTACCATGTTT 198 - 238
NfuSU0027 TCCAGCTGAATCGGTAATGA AAACTCGAGGGTGCAATCTG 164 - 226
NfuSU0049 CTGGACAAAGTGCCAATCAC CTCCCACAGTCCCAAAACAT 196 - 197
NfuSU0050 CCAGAATGAACAATACTCAGATCAA GCAGCTTAGTTTAATGATATCACAATG 252 - 295
NfuSU0060 CTAGCCACTCCCCTGGTTTA CCGTCACGATGTGCTGATAC 216 - 248
NfuFLI0030 CAGAAGCTAAAGGCCAGACG GGGAAACAATAGGGAACCAC 174 - 205
* NfuFLI0091 ACGCTGACTCTACCCAGTC CTGCCTGCTACTGACAATG 355 - 373
* - sex bepaling markeringen

Tabel 1: Genotypering inleidingen voor identificatie van de stam.

Discussion

We beschrijven een protocol voor het laboratorium kweken van turquoise killifish, met inbegrip van de embryo's worden verzameld, incubatie, evenals volwassen vis huisvesting, fokken, en voeding. Ons protocol is specifiek gericht op de laboratoria die onderzoek gericht op de volwassen vis, in het bijzonder voor experimentele onderzoek naar veroudering en levensduur. Turquoise poolfish kan worden verhoogd op een standaard zebrafish faciliteit; belangrijke aspecten van poolfish veehouderij is echter afwijken van standaard zebrafish zorg16. Deze aanpassingen zijn vroege overgang van een Artemia enige voeding naar een dieet aangevuld met eiwitrijke bloed worm, evenals de specifieke stappen voor het embryo incubatie, bestaande uit een vloeibare en droge incubatie-fase.

Kritische stappen binnen het protocol bevatten scheepvaart embryo's binnen 8-30 ° C temperatuurbereik. In het geval van fok, vruchtbaarheid is afhankelijk van voeding van de frequentie en de kwaliteit van de levensmiddelen; Daarom raden we ten minste twee voedingen per dag per fokken tank te verhogen van de opbrengst van de embryo's (zie punt 5.6.). Tijdens het embryo bleken, embryo incubatie in de bleken oplossing niet te verlengen. Dit kan schade aan de ei chorion en verhoogde embryo sterfte veroorzaken. Wanneer het broeden van embryo's met methyleenblauw, niet verlengen incubatie van klaar-aan-hatch embryo's voor meer dan 2 weken als hun levensvatbaarheid drastisch zal worden verminderd. Broedeieren turquoise killifish, lage temperatuur van humic zuuroplossing verbetert broedeieren en volledige onderdompeling van de embryo's in de oplossing kunt gesynchroniseerde broedeieren. Onvoldoende beluchting tijdens de incubatie resultaten in hoge tarieven van FRJ niet kundig voor vullen van de blaas gas ("buik-slider" fenotype, zie opmerkingen in punt 5.1).

Beperking van het protocol voor de fokkerij omvat ook het gebruik van het zand substraat welke uitdagingen vormt voor gecentraliseerde filtratiesystemen en moeten worden vervangen door alternatieve methoden in de toekomst. Mogelijke alternatieven zou het gebruik van zebravis fokken van tanks. Embryo bleken kan grote fysisch-chemische veranderingen veroorzaken in het ei chorion die kan resulteren in gewijzigde chorion fysiologie en broedeieren van succes. Constante Gasbedwelming met behulp van embryo's methyleenblauw veroorzaken op lange termijn veranderingen in de Fysiologie van de volwassen vis. Verhogen van volwassen vis in individuele tanks voor overleving cohortstudies kan negatief beïnvloeden vis gedrag en gezondheid. Groepshuisvesting voor overleving cohortstudies voegt echter belangrijke storende factoren als gevolg van de invoering van sociale dominantie en mannelijke gebieden, wat leidt tot strikte sociale hiërarchieën. Daarom beoordelen we dat isolement van mannelijke vis voor overleving studies een redelijk compromis is. Voeding laboratorium poolfish kolonies met levend voer uit niet-gecontroleerde bronnen toevoegen een risico voor externe verontreinigingen van parasieten en potentieel pathogene microbiële gemeenschappen. In de toekomst moet een ad hoc-steriele visvoer worden ontwikkeld.

Toekomstige verbeteringen aan dit protocol zal zich richten op een gecontroleerde, niet-live dieet, dat nog steeds leidt tot voltooiing van de seksuele rijping binnen 3-4 weken. Kortom biedt ons protocol toegankelijkheid van turquoise poolfish laboratorium kweken voor een brede wetenschappelijke gemeenschap.

Disclosures

Alle auteurs verklaren geen concurrerende financiële en niet-financiële belangen.

Acknowledgments

Wij danken Alessandro Cellerino, Tyrone Genade, Anne Brunet, Sabrina Sharp, Mickie Powell, Simone Keil, Yumi Kim, Patrick Smith, Kai Mathar en alle leden van de lab Valenzano aan het Max Planck Instituut voor de biologie van de vergrijzing voor zijn bijdrage aan de verschillende aspecten van het huidige poolfish veehouderij protocol door de jaren heen.

Materials

Name Company Catalog Number Comments
Probe calibration buffer solution pH=7.0 Roth A518.1 1L buffer solution pH=7.0 to calibrate water system pH-electrode
Probe calibration buffer solution pH=4.0 Roth P712.1 1L buffer solution pH=4.0 to calibrate water system pH-electrode
Conductivity standard VWR 83607.260 500 mL Conductivity standard 1,413 uS/cm to calibrate water system conductivity-electrode
Easy Strips Test 6in1 JBL 2533900 Test strips for determination chlorine values of system water
Ammonia Test JBL 2536500 Test to determine ammonia content of system water
Red Sea Salt Red Sea 22 kg bucket
Sodium hydrogen carbonate VWR 27780.360
Humic acid Sigma- Aldrich 53680-50G
New HUFA Artemia enrichment ZM Systems UK 75g bottle
Methylene blue Roth AE64.1
Hydrogen peroxide solution Sigma- Aldrich 31642-1L 30% (w/w)
Coconut fiber Dragon ZCS010
Whatman paper GE healthcare 3030-690
Ethanol pure VWR 20821.467 100%
Silica sand local pet shop
Artemia Eggs Premium Grade Sanders
Bloodworm local distributor Poseidon Aquakultur Germany
dNTPs solution mix Biolabs N04472 10mM
Taq DNA polymerase Invitrogen 18038-042 5U/uL
PCR 10x Buffer Invitrogen 18038-042
MgCl2 Invitrogen 18038-042 50mM
NaOH Sigma- Aldrich S8045-500g 50mM
Tris-HCl, pH=8.0 solution Sigma- Aldrich T2694-1L 1M
HCl 37% Sigma- Aldrich H1758-500mL
Fish tanks Aquaneering volume: 0.8L, 2.8L, 9.5L; equipped with baffles, fry mesh and lids
Orbital shaker VWR 89032-100 model 5000
Microbiological incubator Thermo Scientific, Heratherm 50125882 model IMC18; for storage embryos in the liquid phase, set to t=27-28°C
Cooling Incubator Binder 9020-0209 model KT115; for storage embryos in the solid phase, set to t=27-28°C
Hatching incubator Thermo Scientific, Heratherm 51028114 model OGS180; for embryos hatching, set to t=27-28°C
Stereomicroscope Leica model M80
Breeding sand/hatching boxes Roth 1598.1 1000mL
Petri dish Sarstedt 82.1473 92x16mm
50 mL Conical tube Sarstedt 62.547.254
15 mL Conical tube Sarstedt 62.554.002
Disposable Plastic Pasteur pipette Roth EA71.1 2mL; For fish feeding with bloodworms, or embryos selection cut off the tip to open 3-4mm diameter
Serological pipette Sarstedt 86.1689.001 50mL
Syringe Henke Sass Wolf 4100-000V0 10mL
Metal strainer fineness <1mm; for embryos collection
Tweezers Dumont 0508-5/45-PO type5/45; for embryos transfer
25 L Brine shrimp hatcher Aquaneering ZHBS25 main hatcher
500 mL Brine shrimp hatcher JBL 6106100 model Artemio 1; backup hatcher
Narrow-mesh fish nets JBL
Sand beaker VWR BURK7102-5000 5000mL
Brine shrimp separation beaker VWR BURK7102-2000 2000mL
Plastic zipper bag Roth P279.2 for dead fish storage
Pipetboy Integra 155000 model Pipetboy acu2
Parafilm P-Lab P701605
Air tubing www.zajac.de AQ380 4-6 mm diameter
1 L Glass bottle VWR 215-1595
2 L Glass bottle VWR 215-1596
500 mL Squeeze bottle Roth K665.1 for fish feeding with brine shrimp
120-μm brine shrimp strainer Florida Aqua Farms BB-PC2 for brine shrimp/bloodworm collection
Finish filter socks Aquaneering MFVB025C 25-μm
Central filtration fish housing system Aquaneering, Techniplast, Aquatic Habitats, Aqua Schwarz

DOWNLOAD MATERIALS LIST

References

  1. Valenzano, D. R., Aboobaker, A., Seluanov, A., Gorbunova, V. Non-canonical aging model systems and why we need them. EMBO J. 36, (8), 959-963 (2017).
  2. Harel, I., Brunet, A. The African Turquoise Killifish: A Model for Exploring Vertebrate Aging and Diseases in the Fast Lane. Cold Spring Harb Symp Quant Biol. 80, 275-279 (2015).
  3. Smith, P., et al. Regulation of life span by the gut microbiota in the short-lived African turquoise killifish. Elife. 6, (2017).
  4. Cellerino, A., Valenzano, D. R., Reichard, M. From the bush to the bench: the annual Nothobranchius fishes as a new model system in biology. Biol Rev Camb Philos Soc. 91, (2), 511-533 (2016).
  5. Kim, Y., Nam, H. G., Valenzano, D. R. The short-lived African turquoise killifish: an emerging experimental model for ageing. Dis Model Mech. 9, (2), 115-129 (2016).
  6. Blazek, R., et al. Repeated intraspecific divergence in life span and aging of African annual fishes along an aridity gradient. Evolution. 71, (2), 386-402 (2017).
  7. Terzibasi, E., et al. Large differences in aging phenotype between strains of the short-lived annual fish Nothobranchius furzeri. PLoS One. 3, (12), e3866 (2008).
  8. Kirschner, J., et al. Mapping of quantitative trait loci controlling lifespan in the short-lived fish Nothobranchius furzeri--a new vertebrate model for age research. Aging Cell. 11, (2), 252-261 (2012).
  9. Valenzano, D. R., et al. Mapping loci associated with tail color and sex determination in the short-lived fish Nothobranchius furzeri. Genetics. 183, (4), 1385-1395 (2009).
  10. Reichwald, K., et al. Insights into Sex Chromosome Evolution and Aging from the Genome of a Short-Lived Fish. Cell. 163, (6), 1527-1538 (2015).
  11. Valenzano, D. R., et al. The African Turquoise Killifish Genome Provides Insights into Evolution and Genetic Architecture of Lifespan. Cell. 163, (6), 1539-1554 (2015).
  12. Harel, I., et al. A platform for rapid exploration of aging and diseases in a naturally short-lived vertebrate. Cell. 160, (5), 1013-1026 (2015).
  13. Valenzano, D. R., Sharp, S., Brunet, A. Transposon-Mediated Transgenesis in the Short-Lived African Killifish Nothobranchius furzeri, a Vertebrate Model for Aging. G3. 1, (7), Bethesda. 531-538 (2011).
  14. Harel, I., Valenzano, D. R., Brunet, A. Efficient genome engineering approaches for the short-lived African turquoise killifish. Nat Protoc. 11, (10), 2010-2028 (2016).
  15. Polacik, M., Blazek, R., Reichard, M. Laboratory breeding of the short-lived annual killifish Nothobranchius furzeri. Nat Protoc. 11, (8), 1396-1413 (2016).
  16. Avdesh, A., et al. Regular care and maintenance of a zebrafish (Danio rerio) laboratory: an introduction. J Vis Exp. (69), e4196 (2012).
Een Protocol voor het laboratorium huisvesting van Turquoise Killifish (<em>Nothobranchius furzeri</em>)
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Dodzian, J., Kean, S., Seidel, J., Valenzano, D. R. A Protocol for Laboratory Housing of Turquoise Killifish (Nothobranchius furzeri). J. Vis. Exp. (134), e57073, doi:10.3791/57073 (2018).More

Dodzian, J., Kean, S., Seidel, J., Valenzano, D. R. A Protocol for Laboratory Housing of Turquoise Killifish (Nothobranchius furzeri). J. Vis. Exp. (134), e57073, doi:10.3791/57073 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter