Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Arrangören Capture-C: Högupplösta, Genome-wide profilering av promotorn interaktioner

doi: 10.3791/57320 Published: June 28, 2018
* These authors contributed equally

Summary

Regulatoriska DNA-element, såsom förstärkare, kontrollera genuttryck genom att fysiskt kontakta mål genen initiativtagare, ofta genom långväga kromosomala interaktioner som spänner över stora genomisk avstånd. Arrangören fånga Hi-C (PCHi-C) identifierar signifikanta interaktioner mellan initiativtagare och distala regioner, möjliggör tilldelning av potentiella reglerande sekvenser till deras målgener.

Abstract

Tredimensionella organisationen av genomet är kopplad till dess funktion. Till exempel styra föreskrivande element såsom transkriptionell enhancers plats och tid uttryck för deras målgener genom fysisk kontakt, ofta överbrygga betydande (i vissa fall hundratals av kilobases) genomisk avstånd och förbi närbelägna gener. Det mänskliga genomet hamnar en uppskattningsvis en miljon smakförstärkare, de allra flesta som har okänd gen mål. Tilldela distala regulatoriska regioner till deras målgener är därför avgörande att förstå gen uttryck kontroll. Vi utvecklat arrangören fånga Hi-C (PCHi-C) för att aktivera genome-wide detektion av distala arrangören-interagera regioner (PIRs), för alla initiativtagare i ett enda experiment. I PCHi-C, är mycket komplexa Hi-C-bibliotek speciellt berikad för arrangören sekvenser genom i-lösning hybrid urval med tusentals biotinylerade RNA beten komplement till ändarna av alla arrangören-innehållande begränsning fragment. Syftet är att sedan nedrullningsbara arrangören sekvenser och deras ofta förekommande samspel partners såsom förstärkare och andra potentiella rättsliga element. Efter hög genomströmning Parade-end sekvensering appliceras en statistisk test varje arrangören-sammanskrivna begränsning fragment att identifiera betydande PIRs på nivån begränsning fragment. Vi har använt PCHi-C för att generera en atlas för långväga arrangören interaktioner i dussintals mänskliga och mus celltyper. Dessa arrangören interactome kartor har bidragit till en större förståelse för däggdjur uttryck kontroll genom tilldela sin målgener förmodad regulatoriska regioner och avslöjar förmånliga rumsliga arrangören-promotorn interaktion nätverk. Denna information har också hög relevans för att förstå mänskliga genetiska sjukdomar och identifiering av potentiella sjukdomsgener, genom att länka icke-kodande sjukdomsassocierade sekvens varianter i eller nära styrförlopp till deras målgener.

Introduction

Ackumulerande bevis antyder att den tredimensionella organisationen av genomet spelar en viktig funktionell roll i en rad nukleära processer, inklusive gen aktivering1,2,3, förtryck4 ,5,6,7,8, rekombination9,10, DNA reparation11, DNA-replikering12,13, och cellulära åldras14. Avlägsna förstärkare finns i rumslig närhet till initiativtagarna de reglerar15,16,17, vilket är viktigt för korrekt plats och tid gen uttryck kontroll. Enhancer borttagningar visar att distala förstärkare är avgörande för målet gen transkription18,19,20,21,22, och 'tvingat kromatin looping' visar att bakåtkompilerade tjudra mellan en förstärkare och dess mål tillskyndare i det Hbb locus är tillräcklig för att driva transkriptionell aktivering23. Ytterligare, genomet omflyttningar som föra gener under kontroll av ektopisk förstärkare kan resultera i olämpligt gen aktivering och sjukdom24,25,26. Tillsammans, illustrerar dessa exempel att arrangören-enhancer interaktioner är väsentliga för genen kontroll och kräver snäva förordningen för att säkerställa lämpliga genuttryck. Människan och mus genomen uppskattas varje hamn cirka en miljon smakförstärkare. Målgener är okända för den stora majoriteten av dessa medel, och 'insatsreglerna' mellan initiativtagare och smakförstärkare är dåligt känd. Tilldela transkriptionell smakförstärkare till deras målgener således fortfarande en stor utmaning i dechiffrera däggdjur uttryck kontroll.

Genom införandet av 3C27 (kromosom konformation capture) och dess varianter28,29,30,31 har revolutionerat vår förståelse av tredimensionella genomets arkitektur . Den mäktigaste av dessa tekniker, Hi-C (hög genomströmning kromosom konformation capture) syftar till att identifiera hela ensemblen av kromosomala interaktioner inom en cell befolkning. Hi-C bibliotek, normalt genereras från miljontals celler, är mycket komplex med en beräknad 1011 oberoende ligering produkter mellan ~ 4 kb fragment i det mänskliga genom32. Som en följd, tillförlitliga och reproducerbara identifiering av interaktioner mellan enskilda begränsningen fragment (till exempel de som innehåller en promotor eller förstärkare) från är Hi-C data inte möjlig om inte Hi-C bibliotek utsätts för Ultra djupsekvensering, som inte är en ekonomiskt hållbar lösning för laboratorier förbereder Hi-C bibliotek rutinmässigt. För att kringgå denna brist, utvecklade vi arrangören fånga Hi-C för att specifikt berika arrangören-innehållande ligering produkter från Hi-C-bibliotek. Vi fokuserade på främjare av två skäl. Först arrangören-enhancer kontakter har visat sig vara avgörande för korrekt gen uttryck nivåer i ett flertal studier (se referenser ovan), och andra, som initiativtagare till stor del invarianta mellan celltyper, samma capture bete system kan användas att förhöra den reglerande kretsen över flera celltyper och villkor. Vår strategi bygger på in-lösning hybridisering av Hi-C-bibliotek med tiotusentals biotinylerade RNA 120mers komplement till arrangören-innehållande Hi-C ligering produkter och efterföljande fånga på streptividin-belagda magnetiska pärlor. Detta resulterar i PCHi-C-bibliotek med mycket mindre komplexitet jämfört med det ursprungliga Hi-C-biblioteket, med fokus på identifiering av fragment som är sammanskrivna att förslagsställare vid betydligt höga frekvenser.

Vi har använt PCHi-C i ett antal mänskliga och mus celltyper att bidra till en bättre förståelse av gen uttryck kontroll av avtäckning långväga distala arrangören samverkande regionerna med förmodad reglerande funktion, liksom icke-slumpmässigt Arrangören-promotorn kontakter i tredimensionella rymden av kärnan. Studierna har kartlagt hundratusentals arrangören-enhancer kontakter över många cell typer33,34,35,36,37,38, 39, identifierade Polycomb repressiva komplexa-medierad rumsliga genome organisation i mus embryonala stamceller7, visat storskaliga omkoppling av arrangören interactomes under celldifferentiering37, 38 , 39och länkade icke-kodande sjukdomsassocierade sekvens varianter till gen promotorer35.

PCHi-C är en idealisk metod för att kartlägga genome-wide ensemblen DNA-sekvenser som interagerar med initiativtagare. Relaterade metoder, såsom fånga Hi-C kontinuerlig genomisk regioner (se diskussion) är metoden för val att få högupplösta interaktion profiler för utvalda genomisk regioner. PCHi-C och fånga Hi-C är extremt lik från en experimentell synvinkel (den enda skillnaden är valet av capture system), så att de råd och riktlinjer som vi tillhandahåller är tillämpliga på båda tillvägagångssätten. Här presenterar vi en detaljerad beskrivning av PCHi-C. Vi redogöra för syftet och utformningen av en PCHi-C experiment, ger en steg för steg PCHi-C bibliotek generation protokollet och illustrera hur kvaliteten på PCHi-C-bibliotek kan övervakas vid olika steg i protokollet att ge högkvalitativa data.

Protocol

1. formaldehyd fixering

  1. Cell förberedelse: börja med ett minimum av 2 x 107 celler per experiment.
    1. För celler odlas i kultur, resuspendera cellerna i odlingsmedium. För ex vivo celler, blandas i 1 x Dulbeccos modifierade Eagle Medium (DMEM), kompletterad med 10% (vol/vol) fetalt bovint serum (FBS).
    2. Vidhäftande celler, ta bort odlingsmedium och lägga till 30.625 mL färsk medium med 10% (vol/vol) FBS vid rumstemperatur (RT; 20 – 25 ° C).
    3. För suspension celler, samla och centrifugera celler vid 400 x g och 20 ° C för 3 min. ta bort supernatanten och slamma cellpelleten i 30.625 mL medium med 10% (vol/vol) FBS på RT.
    4. För fasta vävnader, använda trypsin (0,05% till 2,5% slutlig koncentration, beroende på celltyp) eller dounce homogenisering för att få en enda cellsuspension. Efter detta ytterligare steg, behandla celler som suspension celler.
  2. Tillsätt 4.375 mL 16% metanol-fri PARAFORMALDEHYD (öppna ampullen bara före användning) till en slutlig koncentration på 2% (vol/vol). Fix för 10 min vid RT med mild blandning på en rocker.
    Varning: PARAFORMALDEHYD är en farlig kemikalie. Följ de lämpliga reglerna för hälsa och säkerhet.
  3. Släcka reaktion genom att tillsätta 5 mL av nylagade 1 M iskall glycin. Blanda i 5 min med mild gunga på RT och sedan ruva på is för 15 min med enstaka Invertera.
  4. Tvätta och samla fast celler.
    1. Vidhäftande celler, ta bort supernatanten, tillsätt 10 mL iskallt 1 x PBS pH 7,4 på plattan väggen och ta bort den. Tillsätt 1 mL iskallt 1 x PBS pH 7,4, samla celler som använder en cell skrapan och överföring i en 50 mL tub. Upprepa två gånger för att samla så många celler som möjligt. Lägga till iskall PBS upp till 50 mL slutlig volym.
    2. För suspension celler, centrifug celler vid 760 x g 4 ° C i 5 minuter ta bort supernatanten och slamma cellpelleten i 50 mL iskallt PBS pH 7,4.
  5. Centrifugera celler vid 400 x g och 4 ° C i 10 min och ta försiktigt bort supernatanten. Cellpelleten kan vara snapin fryst i flytande kväve och därefter lagras vid-80 ° C i flera månader.

2. cell Lysis

  1. Återsuspendering cellpelleten i 50 mL nylagade iskall lyseringsbuffert (10 mM Tris-HCl pH 8, 0,2% (vol/vol) Igepal CA-630, 10 mM NaCl, och en tablett proteashämmare cocktail) och blanda. Inkubera på is för 30 min, blanda ibland genom att vända. Centrifugera atomkärnor på 760 x g och 4 ° C i 5 minuter och ta bort supernatanten.

3. hindIII matsmältningen

  1. Tvätta cellkärna med 1,25 x begränsning buffert 2. Återsuspendering cellpelleten i 1 mL iskallt 1,25 x begränsning buffert 2 och överföring i en 1,5 mL tub. Snurra kärnan på 760 x g och 4 ° C i 5 minuter och ta bort supernatanten.
  2. Återsuspendering cellpelleten i 1790 µL 1,25 x begränsning buffert 2. Göra 5 portioner, varje innehållande 5 – 10 miljoner celler i 358 µL 1,25 x begränsning buffert 2.
  3. Tillsätt 11 µL 10% (wt/vol) SDS per delprov och skaka på 950 varv per minut (rpm) under 30 minuter vid 37 ° C i en thermomixer. Om cellen klumpar visas avstånd genom pipettering, att undvika bubblor.
  4. Tillsätt 75 µL 10% Triton x-100 (vol/vol) per delprov och skaka på 950 rpm och 37 ° C i 15 min i en thermomixer. Om cellen klumpar visas avstånd genom pipettering, att undvika bubblor.
  5. Tillsätt 12 µL av 100 U/µL HindIII 100 (1 200 enheter totalt) per delprov och inkubera vid 37 ° C över natten (O/N) under omskakning vid 950 rpm i en thermomixer.
    1. För matsmältningen kontroll, över 25 µL av provet (5 µL från varje alikvot) i en ny tub innan du lägger till enzymet (osmält kontroll) och upprepa samma procedur efter tillägger enzymet (smält kontroll). Inkubera båda rören på samma sätt som Hi-C-biblioteket.
  6. Följande morgon, tillsätt 5 µL 100 U/µL HindIII (500 enheter totalt) per delprov och inkubera vid 37 ° C i 2 h under omskakning vid 950 rpm i en thermomixer.
  7. Matsmältningen kontroll: smält och osmält kontrollerna (se 3.5.1), utföra crosslink återföring (steg 6), fenol: kloroform utvinning och DNA nederbörd (steg 7).
    1. Designa ett par primers som sträcker sig över en HindIII webbplats. I samma region, utforma ett annat par av primers som inte sträcker sig över en HindIII webbplats. Utforma primers för kvantitativ PCR (Q-PCR) med Primer3 (http://bioinfo.ut.ee/primer3-0.4.0/) och följande parametrar:
      Primer storlek: Optimal 20 (Min.: 18, Max.: 27); Primer Tm: Optimal 60 (Min.: 57, Max.: 63); Primer CG % innehåll: Min.: 20, Max.: 80; Kopiestorlek: RT-PCR ~ 100 bp (för konventionella PCR ~ 300 bp); Mispriming bibliotek: mänskliga (mänskliga primers) eller gnagare och enkel (mus primers).
    2. Utföra Q-PCR för att få 4 genomsnittlig KTS (tröskeln cykel): Ct [D; [H], smälta provets [D] med para av primers som sträcker sig över en HindIII webbplats [H]; CT [D;-], framställt av smält provet [D] med para av primers som inte sträcker sig över en HindIII webbplats [-]; CT [U; [H], osmält provets [U] med para av primers som sträcker sig över en HindIII webbplats; CT [U;-], framställt av osmält provet [U] med para av primers som inte sträcker sig över en HindIII webbplats [-]. Beräkna procentandelen av matsmältningen som: % matsmältningen = 100-100/2(Ct[D,H]-Ct[D,-]) - (Ct[U,H]-Ct[U,-]).

4. Biotinylation av begränsning Fragment överhäng

  1. Förbereda biotinylation master mix: 30,6 µL 10 x begränsning buffert 2, 10,2 µL av H2O (molekylär biologi klass), 7.65 µL 10 mM dCTP, 7.65 µL 10 mM dGTP, 7.65 µL 10 mM dTTP, 191.25 µL av 0,4 mM biotin-14-dATP och 51 µL av 5000 E/mL DNA-polymeras jag stor () Klenow) fragment.
  2. Tillsätt 60 µL av biotinylation master mix per delmängd, mix och inkubera vid 37 ° C för 1 h skakar vid 700 rpm (thermomixer) för 5 s, varje 30 s. Efter 1 h, placera alikvoter på is.

5. i-nucleus ligatur

  1. Förbereda ligering master mix: 510 µL 10 x T4 DNA-ligase buffert, 51 µL 10 mg/ml bovint serumalbumin (100 x BSA), 1754.4 µL av vatten (molekylär biologi årskurs) och 127,5 µL av 1 U/µL T4 DNA-ligase (se Tabell för material).
  2. Tillsätt 479 µL av ligering huvudmixen per alikvotens mix och inkubera vid 16 ° C i 4 h skakar vid 700 rpm för 5 s varje 2 min i en thermomixer.
  3. Inkubera i 30 min på RT.

6. Crosslink återföring

  1. Kombinera alla alikvoter i ett 50 mL centrifugrör (lämplig för höghastighetståg centrifugering).
  2. Tillsätt 62,5 µL 10 mg/ml RNase A, mix, och inkubera i 30 minuter vid 37 ° C.
  3. Tillsätt 300 µL 10 mg/ml proteinas K, mix, och inkubera i 30 minuter vid 37 ° C.
  4. Inkubera reaktion O/N (eller minst 4 h) vid 65 ° C. Följande morgon, tillsätt 300 µL 10 mg/ml proteinas K, mix, och inkubera i 1 h vid 65 ° C.

7. DNA-rening

  1. Tillsätt 4337.5 µL TLE buffert (10 mM Tris-HCl pH 8,0; 0.1 mM EDTA pH 8,0) och blanda.
  2. Lägga till 1 volym (10 mL) fenol pH 8,0, virvel för 10 s och centrifugera på RT och 20 000 x g för 3 min. överföra 9 mL av övre (vattenfas) i en ny 50 mL tub.
    Varning: Fenol är en farlig kemikalie. Följ de lämpliga reglerna för hälsa och säkerhet.
  3. Tillsätt 2 mL TLE buffert till återstående vattenfasen, vortex för 10 s och centrifugera vid RT och 20 000 x g för 3 min. 2,5 mL av vattenfasen i nya röret från steg 7.2, att göra den slutliga volymen 11,5 mL. Kassera rör som innehåller den lägsta (organiska) fasen.
  4. Tillsätt 1 volym (11,5 mL) av fenol: kloroform: isopentanol (25:24:1), virvel för 10 s och centrifugera på RT och 20 000 x g för 3 min. Transfer 11 mL av övre (vattenfas) till en ny 50 mL tub. Upprepa steg 7,3. Nu blir den totala provvolymen 13,5 mL.
  5. Lägg till 1,35 mL 3 M natrium acetat pH 5.2 och 33,75 mL iskallt 100% etanol, mix, och inkubera vid-80 ° C i 45 min, eller alternativt övernattning på-20 ° C.
  6. Centrifugera vid 4 ° C och 20 000 x g i 10 min, ta bort supernatanten, resuspendera pelleten i 1 mL av nylagade 70% (vol/vol) etanol och överföra till en ny tub.
  7. Centrifugera vid 4 ° C och i full fart i 3 min i en bänkmonterade Centrifugera, ta sedan bort supernatanten.
  8. Resuspendera pelleten i 1 mL is kallt 70% (vol/vol) etanol och upprepa steg 7,7. Torka pelleten vid 37 ° C i 10 min och resuspendera i 650 µL TLE buffert. Bestämma DNA avkastningen genom att använda en fluorescens-baserad analys för att kvantifiera dubbelsträngat DNA.
    Obs: Protokollet kan pausas här av snapin infrysning och lagring av provet vid-80 ° C under flera månader eller vid-20 ° C under en kortare tid.

8. kvalitetskontroller

  1. Övervaka bibliotek integritet och ligering av DNA elektrofores. Kör 200 ng av biblioteket på en 0,8% agaros/1 x TBE gel. DNA ska köras som ett band över 10 kb.
  2. Upptäcka kända cell-typ invarianta kort - och lång - Long-Range interaktioner med konventionella PCR. Använd 100 ng av DNA per PCR-reaktion. Design PCR primers nära och mot de begränsning platser följa instruktionerna ovan (se 3.7.1). Primer sekvenser för kvalitetskontroll av mus och mänskliga Hi-C biblioteken listas i tabell 1.
  3. Fylla i och ligatur kontroll: klipp ut banden gel som innehåller amplikoner från styra 8,2, gel-extrahera DNA och använda DNA som mall för 4 individuella PCR reaktioner med identiska primer kombinationer.
    1. Rena amplikoner med hjälp av en PCR-rening kit och kvantifiera den DNA-koncentrationen.
    2. Förbereda fyra matsmältningen reaktioner (HindIII [a], NheI [b], HindIII + NheI [c] och ingen enzym [d]) för varje amplikon i en slutlig volym av 15 µL: 500 ng Restriktionsenzymanalys av kopian, 1,5 µL 10 x begränsning buffert 2.1, 0,15 µL 10 mg/ml bovint serumalbumin (100 x BSA) , och 0.1 µL (10 enheter) av enzym (HindIII [a], NheI [b], HindIII + NheI [c] eller vatten [d]).
    3. Smälta för 1 h vid 37 ° C och sedan köra matsmältningen reaktioner på en 1,5% (wt/vol) agaros/1 x TBE gel.

9. DNA-fragmentering

  1. Överföra 50,5 µg av provet i en ny tub och Lägg TLE buffert till en slutlig volym av 655 µL. Split prov i 5 ultraljudsbehandling flaskor (se Tabell för material) genom att lägga till 130 µL av bibliotek (10 µg) till en injektionsflaska. Skeva till en storlek på ~ 400 bp i en ultra-någon sonikator (se Tabell för material) med följande parametrar: plikt faktor: 10%; infallande toppeffekt (w): 140; cykler per burst: 200; tid: 55 s.
  2. Samla sonicated provet i en färsk 2 mL tub.

10. dubbelsidig SPRI-pärla storlek urval

  1. Mix SPRI (fast fas reversibel immobilisering) pärla lösning väl genom att invertera, överföra 1,85 mL pärla lösning till en ny tub och föra till RT i 15 min.
  2. Tillsätt 350 µL av vatten (molekylär biologi klass) (slutlig volym 1 mL).
  3. Lägga till 600 µL SPRI pärla lösning i provet (total volym 1,6 mL; baserat på SPRI lösning till DNA: 0,6 till 1), inkubera i 5 min på RT och snurra prov i en bänkmonterade centrifug för 2 – 3 s att samla in prov.
  4. Öppna locket, placera provet på magnetisk separering står för 5 min, överföring klar supernatant in i en ny tub och kasta pärlor.
  5. Koncentrera sig SPRI pärlor för andra storlek urval steg: överföra 930 µL av SPRI pärlor i en ny tub, placera på magnetisk separering står för 5 min och släng klar supernatant. Återsuspendering pärlorna i 310 µL SPRI pärla lösning.
  6. Tillsätt 300 µL koncentrerad SPRI pärlor (steg 10.5) i provet (total volym 1,9 mL; baserat på SPRI lösning att DNA är nu 0,9 till 1), inkubera vid RT i 5 min och spin prov i en bänkmonterade centrifug för 2 – 3 s. försiktigt öppna locket , Ställ röret på magnetisk separering står i 5 min, och Kassera supernatanten.
  7. Tillsätt 1 mL nyberedd 70% etanol (vol/vol) till provet röret på magnetisk separering stativet, inkubera i 30 s, och Kassera supernatanten. Upprepa två gånger.
  8. Torra pärlor vid 37 ° C i en thermomixer (tube lock öppen) för mer än 5 min. Tillsätt 300 µL TLE buffert till provet, blanda och inkubera i 10 minuter vid rumstemperatur.
  9. Snurra prov i en bänkmonterade centrifug för 2 – 3 s, öppna locket och plats röret på magnetisk separation står för 5 min. Transfer klara supernatanten till en ny tub och kasta pärlor.

11. biotin/streptividin Pull-down av ligering produkter

  1. Förbereda buffertar: 1 x TB buffert (5mM Tris-HCl pH 8,0, 0,5 mM EDTA, 1 M NaCl; 0,05% Tween-20); 2 x NTB buffert (10 mM Tris-HCl pH 8,0; 1 mM EDTA, 2 M NaCl); 1 x NTB buffert (5 mM Tris-HCl pH 8,0; 0,5 mM EDTA; 1 M NaCl).
  2. Tillsätt 200 µL av magnetiska streptividin-kopplade pärlor (se Tabell för material) i en ny tub, placera den på magnetisk separering står för 1 min och ta bort supernatanten.
  3. Tvätta pärlor två gånger med 500 µL av 1 x TB buffert.
    1. För varje TVÄTTNINGSSTEGET under biotin pull-down, slutet reparation och borttagning av biotin på icke-sammanskrivna DNA-ändarna, dATP tailing och adapter ligering steg, återsuspendering pärlorna i motsvarande bufferten, rotera på RT och 15 rpm för 3 min, snurra röret i en bänkmonterade centrifug 2 – 3 s, placera röret på magnetisk separering står för 3 min och ta bort supernatanten.
  4. Återsuspendering pärlor i 300 µL 2 x NTB buffert. Blanda pärlor och prov (600 µL totala volym) och inkubera vid RT i 15 min på ett roterande hjul vid 3 rpm.
  5. Återta pärlor på magnetisk separering står för 3 min och ta bort klara supernatanten. Tvätta pärlor dubbelt i 500 µL 1 x NTB buffert först och sedan i 200 µL 1 x ligering buffert. Återsuspendering pärlorna i 50 µL 10 x ligering buffert.

12. avsluta reparation och borttagning av Biotin i icke-sammanskrivna DNA ändar

  1. Kombinera provet (50 µL totalt) med 50 µL av 2,5 mM dNTP mix (12,5 µL 10 mm för varje dNTP), 18,1 µL av 3.000 U/mL T4 DNA-polymeras, 18,1 µL av 10.000 U/mL T4 PNK, 3,7 µL av 5000 E/mL DNA-polymeras jag stora (Klenow) fragment , och 360.1 µL av H2O.
  2. Blanda och inkubera vid 20 ° C under 1 h, skakar 5 s vid 700 rpm varje 2 min i en thermomixer.
  3. Återta pärlor på magnetisk separering stativet, ta bort klara supernatanten och tvätta pärlor dubbelt i 500 µL av 1 x TB buffert.
  4. Tvätta pärlor i 500 µL 1 x NTB buffert, följt av en tvätt i 500 µL av 1 x TLE.
  5. Återta pärlor på magnetisk separering stativet, ta bort klara supernatanten och slamma pärlor i 415 µL 1 x TLE buffert.

13. dATP förföljer

  1. Kombinera prov (415 µL) med 50 µL 10 x begränsning buffert 2, 5 µL 10 mM dATP och 30 µL 5 U/µL Klenow exo-minus.
  2. Blanda och inkubera vid 37 ° C i 30 min, skaka 5 s vid 700 rpm varje 2 min i en thermomixer.
  3. Återta pärlor på magnetisk separering stativet, ta bort klara supernatanten och tvätta pärlor dubbelt i 500 µL av 1 x TB buffert.
  4. Tvätta pärlor i 500 µL 1 x NTB buffert.

14. adapter ligatur

  1. Tvätta pärlor i 200 µL 1 x ligering reaktion buffert (se Tabell för material).
  2. Återsuspendering pärlor i 200 µL 1 x ligering reaktion buffert. Tillsätt 4 µL av DNA-ligase (se Tabell av material) och 16 µL 15 µm glödgas före PE adaptrar (pre glödga PE korten genom att blanda lika stora volymer av PE adapter 1 och PE adapter 2 (båda på 30 µM) och ruvar i några minuter på RT). Inkubera vid RT i 15 min.
  3. Återta pärlor på magnetisk separering stativet, ta bort klara supernatanten och tvätta pärlor dubbelt i 500 µL av 1 x TB buffert.
  4. Tvätta pärlor i 500 µL 1 x NTB buffert. Sedan, tvätta pärlor i 100 µL av 1 x begränsning buffert 2, återsuspendering pärlor i 50 µL 1 x begränsning buffert 2 och överför till en ny tub.

15. Hej-C bibliotek förstärkning

  1. Förbered PCR master mix: 100 µL av 5 x Phusion buffert; 6 µL av 25 µM PE PCR primer 1,0; 6 µL av 25 µM PE PCR primer 2.0; 14 µL av dNTP mix (10 mM varje); 6 µL av Phusion polymeras; 318 µL av H2O.
  2. PCR-mix master mix med pärlor (500 µL totalt), dela i 10 portioner av 50 µL och förstärka med PCR med följande villkor:
    30s vid 98 ° C
    7 cykler av: 10 s på 98 ° C; 30 s vid 65 ° C; 30 s vid 72 ° C
    7 min vid 72 ° C
  3. Samla in PCR-reaktioner i en ny tub, återta pärlor på magnetisk separering stativ och överför supernatanten (500 µL) in i en ny tub.
  4. Rena bibliotek DNA med SPRI pärlor.
    1. Mix SPRI pärlor, överför 460 µL av pärlor i en ny tub, ta till RT för 15 min. Tillsätt 450 µL av SPRI pärlor till PCR-reaktioner (slutlig volym 950 µL), inkubera i 5 min på RT och snurra prov i en bänkmonterade centrifug för 2 – 3 s att samla in prov.
    2. Öppna locket och placera provet på magnetisk separering står för 5 min bort supernatanten.
    3. Att hålla pärlorna på magnetisk separering stativet, tillsätt 1 mL 70% etanol (vol/vol) att prova tube över ett område som är tydligt av pärlor, lämna för 30 s och Kassera supernatanten.
    4. Upprepa steg 15.4.3 dubbelt mer.
    5. Torka pärlor vid 37 ° C i en thermomixer (tube lock öppen) för mer än 5 min.
    6. Tillsätt 51 µL TLE buffert i provet, mix, och inkubera i 10 minuter vid 37 ° C, skaka på 950 rpm i en thermomixer.
    7. Snurra prov i en bänkmonterade centrifug för 2 – 3 s, öppna locket och plats röret på magnetisk separation står för 5 min. Transfer klara supernatanten till en ny tub och kasta pärlor.
    8. Kvantifiera koncentration av Hi-C-biblioteket. Efter 7 omgångar av PCR-amplifiering erhåller vi rutinmässigt 500 – 1500 ng av Hi-C-bibliotek.

16. hybrid i-lösning Capture

Obs: Blocker och buffert (SHS1-4) lösningar nedan är från SureSelect kit (se Tabell för material).

  1. Överföring 500 ng 1 µg Hi-C biblioteket till en ny tub och avdunsta prov på en vakuum koncentrator (se Tabell för material; 45 ° C; vakuumtryck: nivå 30,0, ramp 5) tills den är torr.
  2. Återsuspendering avdunstat Hi-C-bibliotek genom att lägga till 3,6 µL av H2O (molekylär biologi klass), 2,5 µL blockerare 1, 2,5 µL blockerare 2, och 0.6 µL av anpassade blockerare.
  3. Överför provet till en väl en ny PCR-röret Strip, nära med en PCR-cap remsa och placera på is. Etiketten som ”D” (för Hi-C DNA).
  4. Förbereda hybridisering bufferten: 12,5 µL av SHS1 buffert; 0,5 µL av SHS2 buffert; 5 µL SHS3 buffert; 6.5 µL av SHS4 buffert.
  5. Inkubera vid 65 ° C i 5 min i en thermomixer. Överför till en väl en ny PCR-röret Strip, nära med en PCR-cap remsa och hålla på RT. etikett som ”H” (för hybridisering buffert).
  6. I en brunn en ny PCR-röret Strip, blanda 5 µL 100 ng/µL biotinylerade RNA sonder (store vid-80 ° C och Tina på isen strax innan användning); 0,5 µL SRNase B (RNase inhibitor) och 1,5 µL av H2O (molekylär biologi årskurs).
  7. Stäng den PCR-rör remsan med en PCR-cap strip och plats på is. Etiketten som ”R” (för RNA).
  8. Ställa in PCR-maskin med följande parametrar:
    5 min vid 95 ° C; 25 h vid 65 ° C; lock upphettas; 29 µL PCR-reaktionsvolym.
    Obs: Gå vidare så snabbt som möjligt under alla förfaranden medan PCR-maskinen körs för att undvika provavdunstning.
  9. Placera den D-PCR-rör remsan i PCR-maskinen, Stäng PCR-maskinen locket och starta PCR-reaktionen. När PCR-programmet når 65 ° C, öppna PCR-maskinen locket och placera ”H” PCR-röret remsan i PCR-maskinen. Stäng locket PCR-maskin och Inkubera under 3 min. öppna PCR-maskinen locket, plats ”R” PCR-röret remsa på PCR-maskinen och Stäng PCR-maskinen.
  10. Efter 2 min, öppna PCR-maskinen locket och alla PCR-röret remsor. Över 13 µL väl ”h” i väl ”R”, sedan alla volym av väl ”D” till väl ”R”. Pipettera upp och ned 3 gånger för att blanda reaktionen, nära PCR-röret remsan, ta bort ”H” D-PCR tube remsor och stänger locket på PCR-maskin. Inkubera reaktionen vid 65 ° C under 24 h.

17. isolering av promotorn Fragment som innehåller Ligation produkter

Obs: Följande steg rekommenderas att göras med SureSelect-adapter kit och bibliotek (se Tabell av Materals).

  1. Pre varma 1,5 mL tvättbuffert 2 per prov vid 65 ° C i förväg.
  2. Tillsätt 60 µL av streptividin-kopplade magnetiska pärlor (se Tabell för material) i en ny tub, placera på magnetisk separering står för 1 min och ta bort supernatanten.
  3. Tvätta pärlor tre gånger med 200 µL 1 x bindande buffert.
    Obs: För varje tvätt steg under post-Capture isolering av produkter som innehåller arrangören ligatur, återsuspendering pärlor i motsvarande bufferten, rotera för 3 min på RT och 15 rpm på ett roterande hjul, sakta snurra röret i en bänkmonterade centrifug för 2 – 3 s att samla prov, plats röret på magnetisk separation står för 3 min, och ta bort supernatanten.
  4. Återsuspendering pärlor i 200 µL 1 x bindande buffert. Öppna PCR-maskinen och PCR-röret remsor (medan PCR-programmet körs) och överföra hybridisering reaktionen i röret med magnetiska pärlor. Inkubera vid RT i 30 min på ett roterande hjul vid 3 rpm.
  5. Återta pärlor på magnetisk separering stativet och ta bort klara supernatanten. Återsuspendering pärlor till 500 μl tvättbuffert 1, mix, och inkubera i 15 min vid 20 ° C under omskakning vid 950 rpm i en thermomixer.
  6. Återta pärlor på magnetisk separering står för 3 min och ta bort klara supernatanten. Återsuspendering pärlor till 500 µL tvättlösning 2, blanda och inkubera 10 min vid 65 ° C under omskakning vid 950 rpm i en thermomixer. Upprepa steg 17,5 dubbelt mer.
  7. Återta pärlor på magnetisk separering stativet, ta bort klara supernatanten och slamma pärlor i 200 µL 1 x begränsning buffert 2. Återta pärlor på magnetisk separering stativet, avlägsna supernatanten och slamma pärlor in 30 µL av 1 x begränsning buffert 2.

18. PCHi-C bibliotek förstärkning

  1. Förbered PCR master mix: 60 µL av 5 x PCR buffert (Phusion buffert), 3.6 µL av 25 µM PE PCR primer 1.0, 3,6 µL av 25 µM PE PCR primer 2.0, 8,4 µL av dNTP mix (10 mM varje), 3.6 µL av Phusion polymeras och 190.8 µL av H2O.
  2. PCR-mix master mix med pärlor (300 µL totalt), dela upp i 6 portioner av 50 µL och PCR-förstärk med följande villkor:
    30 s vid 98 ° c.
    4 cykler av: 10 s på 98 ° C, 30 s vid 65 ° C, 30 s vid 72 ° C
    7 min vid 72 ° C
  3. Samla alla PCR-reaktioner i en ny tub, återta pärlorna på magneten och överför supernatanten (300 µL; innehåller PCHi-C bibliotek) i till en ny tub.
  4. Rena PCHi-C biblioteket med SPRI pärlor, följa stegen som beskrivs ovan under 15,4.
  5. Kvantifiera koncentration av PCHi-C-biblioteket.

Representative Results

Arrangören fånga Hi-C har använts för att berika mus7,34,36,39 och mänskliga33,35,37,38 Hi-C bibliotek för Arrangören interaktioner. En liknande protokoll (heter HiCap) har beskrivits av Sandberg gruppen40. Figur 1A visar schematiskt arbetsflödet för arrangören fånga Hi-C. I protokollet som beskrivs här, genereras Hi-C bibliotek med hjälp av i-nucleus ligering41, vilket resulterar i ett betydligt mindre antal falska ligering produkter42. För PCHi-C, mycket komplexa mus eller mänskliga Hi-C bibliotek utsätts för i-lösning hybridisering och fånga med hjälp av 39,021 biotinylerade RNAs kompletterar 22,225 mus arrangören-innehållande HindIII begränsning fragment eller 37,608 biotinylerade RNAs inriktning 22,076 mänskliga arrangören-innehållande HindIII begränsning fragment, respektive. Arrangören som innehåller begränsning fragment kan riktas på endera eller båda ändarna av enskilda biotinylerade RNAs (figur 1B). Vi hittade att fånga båda slutar förbättrad täckning av enskilda förslagsställare (figur 1 c; rå sekvens läsningar) nästan två gånger, som förväntat. Således, när möjligt (dvs. icke-upprepande regioner), rekommenderar vi för att använda biotinylerade RNAs komplement till båda ändarna av en begränsning fragment fångas.

För att bedöma PCHi-C bibliotek kvalitet i ett tidigt skede under bibliotek beredning, utför vi två kontroller efter DNA-ligering och rening, som tidigare beskrivits31. Först är att använda specifika primer par för att förstärka ligering produkter som i 3 C27. Vi använder primer par (tabell 1) för att förstärka celltyp invariant långväga ligering produkter, sådant mellan Myc genen och dess kända förstärkare ligger ca 2 Mb bort (figur 2A) eller mellan gener av Hist1 locus ( (avgränsade med 1.5 Mb), och mellan två regioner ligger i närheten av linjär ('short-range kontroll').

Den andra kvalitetskontrollen utförs för att avgöra effektiviteten av biotin införlivandet under Klenow-medierad ifyllning av begränsning webbplats överhäng med biotin-dATP. Framgångsrika Klenow ifyllning och efterföljande blunt-end ligering resulterar i försvinnandet av den ursprungliga begränsning platsen mellan DNA-molekylerna en ligatur produkt, och när det gäller HindIII i bildandet av en ny NheI erkännande webbplats (figur 2B ). Förhållandet mellan HindIII NheI smält ligering produkt är en direkt avläsning av biotin inkorporering effektivitet. En dålig kvalitet Hi-C bibliotek kommer att visa en hög nivå av HindIII matsmältning, medan högkvalitativa bibliotek har nästan fullständig NheI rötning av ligering produkter (figur 2B).

Efter Hi-C bibliotek förberedelse (dvs. efter biotin-streptividin dra ner av stoleken Hi-C ligering produkter, adapter ligering och före fånga PCR), bedöms integritet och storlek distribution av Hi-C biblioteket av Bioanalyzer (figur 2 C). samma kontroll utförs i slutet av PCHi-C bibliotek förberedelse (dvs. efter hybridisering tillfångatagandet av produkter som innehåller arrangören ligering och post-Capture PCR). Jämförelse av Hi-C och PCHi-C Bioanalyzer profiler visar att som förväntat, Hi-C bibliotek är mycket mer koncentrerad än de motsvarande PCHi-C-bibliotek, men storleksfördelning av biblioteken är mycket liknande, vilket tyder på att fånga steg i PCHi-C införa inte en storlek bias (figur 2 c, D).

Efter ihopkopplade-end sekvensering, den PCHi-C läser mappas, kvalitet kontrolleras och filtreras med HiCUP pipeline43. Hög kvalitet PCHi-C-bibliotek innehålla mellan 70-90% 'giltig par' (dvs, Parade-slutet sekvens läser mellan två begränsning fragment som inte angränsande på linjär genomisk kartan; Figur 3A, B). Använder den i-nucleus ligering protokoll41,42, Läs andelen trans par (dvs, Parade-slutet sekvens läser mellan två begränsning fragment som finns på olika kromosomer) är oftast låg, mellan 5 och 25%, vilket återspeglar förekomsten av kromosom territorier, och indikerade bra bibliotek kvalitet. Direkt jämförelse av andelen 'giltig par' mellan Hi-C-bibliotek och deras motsvarande PCHi-C bibliotek35, visar att i alla fall procentandelen av giltiga par är högre i PCHi-C-biblioteken (figur 3B). Detta åtföljs av en minskning av andelen icke-giltiga 'samma fragment inre' läser i PCHi-C (figur 3 c). Detta förväntas, som steget fånga inte bara berikar för arrangören-innehållande ligering produkter, men också för begränsning fragment upphör, på grund av placeringen av de fånga oligos om begränsning fragment (se figur 1B).

Efter HiCUP filtrering, bestämmer vi uppsamlingskapacitet. PCHi-C-bibliotek innehåller tre typer av giltig sekvens läser efter HiCUP filtrering:
(1) arrangören: genomet läser (dvs läsningar mellan ett fångade arrangören fragment och ett icke-arrangören HindIII begränsning fragment någonstans i genomet)
2.) arrangören: arrangören läser (läsningar mellan två fångade arrangören fragment)
3.) genomet: genomet läser (bakgrunden Hi-C ligering produkter där varken av ligering produkt partners kartor till fångade främjare). Dessa ignoreras före efterföljande analyser.

Hög kvalitet PCHi-C-bibliotek har fånga effektivitetsvinster (summan av kategorierna 1 och 2 ovan) mellan 65-90% (figur 3D). En direkt jämförelse att Hi-C bibliotek visar att PCHi-C resulterar i en ~ 15-fold anrikning för arrangören-produkter som innehåller ligatur (figur 3D), i vissa fall 17-fold. Detta är nära den hypotetiska maximalt (19.6-fold) berikning för PCHi-C, som är beroende av procentandelen av genomet begränsning fragment omfattas av systemet capture. Större anrikning kan uppnås genom att utforma capture system inriktning färre begränsning fragment44,45,46.

Analysen av arrangören interactomes visar cellen typ och härstamning-specificitet33,34,35, med uttalad förändringar under celldifferentiering37,38,39 . Figurerna 4 och 5 visar exempel på härstamning specificitet och differentiering dynamics på specifika initiativtagare. Till exempel ALAD är konstitutivt uttryckta i alla celler men dess uttryck är uppreglerad i erytroblaster47. ALAD arrangören kontaktar flera distalt fragment i alla hematopoetiska celler och engagerar sig i ytterligare interaktioner specifikt i erytroblaster (figur 4). IL-8 visar inga statistiskt signifikanta interaktioner i B-celler, mycket få interaktioner i T-celler, men dussintals interaktioner i celler av myeloisk härstamning, inklusive celltyp specifika interaktioner i megakaryocyter, monocyter och neutrofiler ( (Se figur 5). Dessa exempel visar hur PCHi-C kan användas att nysta celltyp specifika interactomes och identifiera arrangören-interagera regioner med föreskrivande potential.

Figure 1
Figur 1 : Arrangören fånga Hi-C motivering och fånga betesfisk design. (A) Schematisk arbetsflöde PCHi-c. I-nucleus ligering Hi-C41,42 (I) följs av i-lösning hybridisering med biotinylerade RNA beten (II) riktade begränsning fragment av alla mänskliga (avbildad här) eller mus gen promotorer (III). (B) bete design till PCHi-C. Biotinylerade RNA fånga beten (röda böjda linjer) är utformade mot ändarna av arrangören-innehållande begränsning fragment (grå; Observera att arrangören ordnar själva (röd) riktas endast av de RNA fånga beten om de är belägna på begränsning fragmentet slutar). Ligatur produkter bestående av arrangören-innehållande begränsning fragment (grå) och deras interagerande begränsning fragment (gul och grön) är isolerade genom sekvens-komplementaritet hybridisering mellan RNA bete och DNA-målet, och efterföljande Biotin-streptividin pulldown, som visas i A. (C) jämförelse av PCHi-C uppsamlingskapacitet för arrangören-innehållande begränsning fragment måltavla för en RNA bete fånga sonden vs två RNA bete fånga sonder (se Schematisk i B). Klicka här för att se en större version av denna siffra.

Figure 2
Figur 2 : PCHi-C före sekvensering kvalitetskontroller. (A) vänster, schematisk av rumsliga juxtaposition mellan arrangören och PIR, resulterar i en Hi-C ligering produkt bestående av en promotor-innehållande begränsning fragment (grå; arrangören sekvens i rött) och en PIR begränsning fragment (gul). Höger, DNA gel elektrofores visar exempel på Hi-C ligering produkter förstärks med specifika primer par (som skildras i schematisk till vänster). (B) vänster, representativa exempel på HindIII, NheI och HindIII/NheI begränsning smälter av Hi-C ligering produkter (PCR-produkter visas i A). Höger, Schematisk bild av DNA sekvens efter Hi-C ligering efter misslyckade (överst) eller framgångsrika (nederst) dNTP Klenow ifyllning av begränsning förenande och efterföljande ligering. (C) representant Hi-C bibliotek bioanalyzer profil (1/5 spädning). (D) representant PCHi-C bibliotek bioanalyzer profil (ingen utspädning). Klicka här för att se en större version av denna siffra.

Figure 3
Figur 3 : PCHi-C efter sekvensering kvalitetskontroller. (A) jämförelse av andelen giltig sekvens Läs par efter HiCUP43 bearbetning i PCHi-C vs motsvarande Hi-C-bibliotek (data från Javierre et al., 201635). (B) representant HiCUP PCHi-C resultatet visar giltig Läs par och andra sekvens kategorier som kastas före efterföljande analyser (data från Javierre et al., 201635). (C) jämförelse av procentsats 'samma fragment inre' läser efter HiCUP bearbetning i PCHi-C vs motsvarande Hi-C-bibliotek (data från Javierre et al., 201635). (D) jämförelsen av andelen sekvens läser involverar agnade arrangören fragment (uppsamlingskapacitet) i PCHi-C vs motsvarande Hi-C-bibliotek (uppgifter från Javierre et al., 201635). Klicka här för att se en större version av denna siffra.

Figure 4
Figur 4: ALAD PCHi-C profilen i mänskliga hematopoetiska celler. Arrangören interaktioner myeloisk celltyper visas som blå valv och arrangören interaktioner lymfoida celltyper visas som lila bågar. Erytroblast-specifika interaktioner indikeras med röda pilar (data från Javierre et al., 201635). Klicka här för att se en större version av denna siffra.

Figure 5
Figur 5 : IL8 PCHi-C profilen i mänskliga hematopoetiska celler. Arrangören interaktioner myeloisk celltyper visas som blå valv och arrangören interaktioner lymfoida celltyper visas som lila bågar. Monocyt-specifika interaktioner är markerade med gröna pilar, neutrofila-specifika interaktioner indikeras med röda pilar och en megakaryocyt-specifik interaktion indikeras med en brun pil (data från Javierre et al., 201635). Klicka här för att se en större version av denna siffra.

Mänskliga
Namn Sekvens Kromosom Strand Starta GRCh38/hg38 Slutet GRCh38/hg38 Primer kombinationer att testa 3C interaktioner och biotin inkorporering
HS AHF64 Dekker GCATGCATTAGCCTCTGCTGTTCTCTGAAATC 11 + 116803960 116803991 Använd i kombination med hs AHF66 Dekker
HS AHF66 Dekker CTGTCCAAGTACATTCCTGTTCACAAACCC 11 + 116810219 116810248 Använd i kombination med hs AHF64 Dekker
HS MYC locus GGAGAACCGGTAATGGCAAA 8 - 127733814 127733833 Använd i kombination med hs MYC +1820 eller hs MYC -538
HS MYC +1820 AAAATGCCCATTTCCTTCTCC 8 + 129554527 129554547 Använd i kombination med hs MYC locus
HS MYC -538 TGCCTGATGGATAGTGCTTTC 8 - 127195696 127195716 Använd i kombination med hs MYC locus
HS HIST1 F AAGCAGGAAAAGGCATAGCA 6 + 26207174 26207193 Använd i kombination med hs HIST1 R
HS HIST1 R TCTTGGGTTGTGGGACTTTC 6 + 27771575 27771594 Använd i kombination med hs HIST1 F
Mus
Sekvens Kromosom Strand Starta GRCm38/mm10 Slutet GRCm38/mm10 Primer kombinationer att testa 3C interaktioner och biotin inkorporering
TCATGAGTTCCCCACATCTTTG 8 + 84841090 84841111 Använd i kombination med mm Calr2
CTGTGGGCACCAGATGTGTAAAT 8 + 84848519 84848541 Använd i kombination med mm Calr1
TATCAAGGGTGCCCGTCACCTTCAGC 6 + 125163098 125163123 Använd i kombination med Gapdh4 Dekker
GGGCTTTTATAGCACGGTTATAAAGT 6 + 125163774 125163799 Använd i kombination med Gapdh3 Dekker
GGAGGAGGGAAAAGGAGTGATT 6 + 52212829 52212850 Använd i kombination med mm Hoxa13
CAGGCATTATTTGCTGAGAACG 6 - 52253490 52253511 Använd i kombination med mm Hoxa7
GGGTAATGGTGTCACTAACTGG 13 + 23571284 23571305 Använd i kombination med Hist1h3e eller mm Hist1h4i
GGGTTTGATGAGTTGGTGAAG 13 + 23566541 23566561 Använd i kombination med mm Hist1h2ae
TTGGGCCAAAGCCTATATGA 13 + 22043085 22043104 Använd i kombination med mm Hist1h2ae

Tabell 1: Primer sekvenser för kvalitetskontroll av mänskliga och mus Hi-C bibliotek.

Discussion

Modulär design för arrangören fånga Hi-C

Arrangören fånga Hi-C är utformad för att specifikt berika Hi-C-bibliotek för interaktioner som initiativtagare. Dessa interaktioner utgör endast en delmängd av ligering produkter finns i ett Hi-C-bibliotek.

Fånga Hi-C kan lätt ändras för att berika Hi-C-bibliotek för genomisk region eller regioner av intresse genom att ändra fånga systemet. Fånga regioner kan vara kontinuerlig genomisk segment44,45,46,48, smakförstärkare som har identifierats i PCHi-C (omvänd fånga Hi-C35) eller DNAS jag överkänslig platser49 . Storleken på capture systemet kan justeras beroende på experimentell omfattning. Till exempel Dryden et al. rikta 519 bete fragment i tre gene öknar är associerad med bröst cancer44. Fånga systemet av Martin et al. riktar sig till både kontinuerlig genomisk segment ('Region fånga': 211 genomisk regioner totalt; 2 131 begränsning fragment) och valt initiativtagare (3,857 gen promotorer)45.

SureSelect bibliotek finns i olika storlek prisklasser: 1 kb till 499 kb (5,190 – 4.806), 500 kb till 2,9 Mb (5,190 – 4,816), och 3 Mb till 5,9 Mb (5,190 – 4,831). Som varje enskild fånga biotin-RNA är 120 nukleotider långa, dessa fånga system rymma upp till 4,158, 24,166 och 49,166 enskilda fånga sonder, respektive. Detta motsvarar 2 079, 12,083 och 24,583 riktade begränsning fragment, respektive (Observera att siffrorna för begränsning fragment är nedre gränser utifrån antagandet att två enskilda fånga sonder kan utformas för varje begränsning fragmentet — i verkligheten på grund av repetitiva sekvenser kommer detta inte vara fallet för varje begränsning fragmenteras (se även figur 1B, C), vilket resulterar i ett högre antal targetable begränsning fragment för ett konstant antal tillgängliga fånga sonder ).

Protokollet beskrivs här baseras på användningen av ett restriktionsenzym med en 6 bp erkännande webbplats att avslöja långväga interaktioner. Använda ett restriktionsenzym med en 4 bp erkännande webbplats för större upplösning av mer proximala interaktioner är också möjliga40,49.

Begränsningar av PCHi-C

En inneboende begränsning av alla kromosom konformation fånga analyser är att deras upplösning bestäms av enzymet begränsning används för bibliotek generation. Samspel som sker mellan DNA-element som ligger på samma begränsning fragmentet är osynliga för 'C-type' analyser. Ytterligare, i PCHi-C, i vissa fall mer än en transkription startwebbplats kan finnas på samma arrangören-innehållande begränsning fragmentet och PIRs i vissa fall hyser både aktiva och repressiva Histon märken, vilket gör det svårt att sätta fingret som reglerande element medla interaktioner, och förutsäga reglerande produktionen av promotorn interaktioner. Med 4 bp erkännande platser restriktionsenzym mildrar problemet men kommer på bekostnad av kraftigt ökad Hi-C bibliotek komplexitet (Hi-C-bibliotek som genereras med 4 bp erkännande webbplats restriktionsenzym är minst 100 gånger mer komplexa än Hi-C bibliotek genereras med 6 bp erkännande webbplats restriktionsenzym), och de tillhörande kostnaderna för nästa generations sekvensering.

En annan begränsning är att det nuvarande PCHi-C-protokollet kräver miljontals celler som utgångsmaterial, utgör hinder för analysen av promotorn interaktioner i sällsynta celltyper. En modifierad version av PCHi-C aktivera förhör av promotorn kontakter i cellpopulationer med 10 000 till 100 000 celler (till exempel celler under tidig embryoutveckling eller hematopoetiska stamceller) skulle därför vara ett värdefullt tillskott till fånga Hi-C verktygslåda.

Slutligen, liksom alla metoder som förlitar sig på formaldehyd fixering, PCHi-C registrerar bara interaktioner som är 'frozen' vid tidpunkten av fixering. Således, för att studera kinetik och dynamiken i promotorn interaktioner, metoder såsom super-resolution mikroskopi levande cellen krävs tillsammans med PCHi-C.

Metoder att dissekera rumsliga kromosom organisation med hög upplösning

Den stora komplexiteten i kromosomala interaktion bibliotek förbjuder tillförlitlig Produktidentifikationen interaktion mellan två särskilda begränsningar fragment med statistisk signifikans. För att kringgå problemet, har sekvens capture använts för att berika antingen Hi-C33,34,40,44 eller 3 C50,51 bibliotek för specifika interaktioner. Den stora fördelen med att använda Hi-C bibliotek över 3C bibliotek för anrikning steg är att Hi-C, till skillnad från 3C, innehåller ett berikande steg för äkta ligering produkter. Som en följd är procentsatsen av giltig läser PCHi-C-bibliotek cirka 10 gånger högre än i Capture-C bibliotek50, som innehöll cirka 5 – 8 procent giltig läser efter HiCUP filtrering. Sahlen et al. har direkt jämfört Capture-C till HiCap, som som PCHi-C använder Hi-C-bibliotek för att fånga berikning, i motsats till Capture-C som använder 3 C bibliotek. Överensstämmer med våra fynd, fann de att fånga-C bibliotek främst består av un-ligated fragment40. Dessutom hade HiCap bibliotek en högre komplexitet än Capture-C bibliotek40.

En variant av Capture-C, kallad nästa generations Capture-C52 NG Capture-C använder en oligo per begränsning fragment ände som tidigare fastställts i PCHi-C33,34, i stället för överlappande sonder används i original Capture-C protokollet50. Detta ökar andelen giltig läsningar jämfört Capture-C blygsamt, men NG Capture-C sysselsätter två sekventiella rundor av capture anrikning, och ett relativt högt antal PCR cykler (20 till 24 cykler totalt, jämfört med 11 cykler typiskt för PCHi-C), som oundvikligen resulterar i högre siffror sekvens dubbletter och lägre bibliotek komplexitet. I rättegång experiment under optimering av PCHi-C, fann vi att andelen unika (dvs inte dupliceras) läser par var endast omkring 15% när vi använde 19 PCR-cykler (13 cykler före fånga + 6 cykler efter capture; inga data anges), men optimering till ett lägre antal PCR cykler, ger normalt 75 – 90% unika Läs par. Således ökar minska antalet PCR cykler avsevärt mängden av informativ sekvensdata.

En nyligen metod kombinerar ChIP med Hi-C att fokusera på kromosomala interaktioner medierade av ett specifikt protein av intresse (HiChIP53). HiChIP data jämfört med ChIA-PET54, som är baserad på en liknande logik, och innehåller ett större antal informativa sekvensen läser, vilket möjliggör högre förtroende interaktion ringer53. Det ska bli mycket intressant att direkt jämföra de motsvarande HiChIP och fånga Hi-C datamängder de blir när tillgängliga (till exempel HiChIP med en antikropp mot de cohesin enhet Smc1a53 med fånga Hi-C för alla Smc1a bunden begränsning «««fragment) sida vid sida. En inneboende skillnad mellan dessa två synsätt är att fånga Hi-C inte är beroende av kromatin immunoprecipitation, och därför kan förhör kromosomala interaktioner oberoende proteinet beläggning. Detta möjliggör jämförelse av 3D genome organisation i närvaro eller frånvaro av specifika faktor bindande, som har använts för att identifiera PRC1 som en nyckelroll i regulering av mus ESC rumsliga genomets arkitektur7.

PCHi-C och GWAS

Genome-wide associationsstudier (GWAS) har visat att mer än 95% av sjukdomsassocierade sekvens varianter är belägna i icke-kodande regioner i genomet, ofta på stora avstånd till protein-kodande gener55. GWAS varianter är ofta finns i närheten av DNAS I överkänsliga platser, vilket är ett signum för sekvenser med potentiella lagstiftningsverksamhet. PCHi-C och fånga Hi-C har använts i stor utsträckning att länka initiativtagare till GWAS risk loci inblandad i bröst cancer44, kolorektal cancer48och autoimmun sjukdom35,45,46. En PCHi-C studie om 17 olika mänskliga hematopoetiska celler typer hittade SNP är associerad med autoimmun sjukdom berikades i PIRs i lymfoida celler, medan sekvens varianter associerade med trombocyter och röda blodkroppar specifika egenskaper återfanns huvudsakligen i den makrofager och erytroblaster, respektive35,56. Således, vävnadstyp specifika promotorn interactomes avslöjats av PCHi-C kan hjälpa till att förstå funktionen av icke-kodande sjukdomsassocierade sekvens varianter och identifiera nya potentiella sjukdomsgener för terapeutisk intervention.

Egenskaper hos arrangören-interagera regioner

Flera rader av bevis länk arrangören interactomes gen uttryck kontroll. Först flera PCHi-C studier har visat att genomisk regioner interagerar med främjare av (mycket) uttryckt gener är berikad med märken som är associerad med förstärkare aktivitet, till exempel H3K27 acetylering och p300 bindande33,34 , 37. Vi fann en positiv korrelation mellan gen uttryck nivå och antalet samverkande förstärkare, vilket tyder på att additiva effekter av enhancers resultera i ökat genuttryck nivåer34,35. Andra naturligt förekommande uttrycket kvantitativa loci (eQTLs) är berikad med PIRs som är anslutna till samma gener vars uttryck påverkas av de eQTLs35. För det tredje genom att integrera resa57 och PCHi-C data, fann Cairns et al. att resa reporter gener mappning till PIRs i mus ESCs visar starkare reporter genuttryck än reporter gener på integration platser i icke-arrangören-interagera regioner 58, som anger att PIRs besitter transkriptionell lagstiftningsverksamhet. Tillsammans, tyder dessa fynd på att arrangören interactomes avslöjats av PCHi-C i olika mus och mänsklig celltyper inkluderar viktiga reglerande moduler för gen uttryck kontroll.

Det är värt att notera att förstärkare utgör endast en liten del (~ 20%) av alla PIRs avslöjats av PCHi-C33,34. Andra PIRs kunde ha strukturella eller topologiska roller i stället för direkt transkriptionell tillsynsuppdrag. Det finns dock också bevis för att PCHi-C kan avslöja DNA-element med reglerande funktion som inte hamnen klassiskt enhancer märken. I en mänsklig lymfoida cell linje hittades BRD7 arrangören för att interagera med en region saknar enhancer märken som visades att inneha enhancer aktivitet i reporter gen analyser33. Reglerande element med liknande egenskaper kan vara rikligare än för närvarande uppskattas. Till exempel markerar en CRISPR-baserad skärm för regulatoriska DNA element identifierade omärkta reglerande element (åtgärder) som kontrollera genuttryck, men saknar enhancer59.

I andra fall har PIRs visat sig hysa kromatin-Märken associerade med transkriptionell förtryck. PIRs och samverkande initiativtagare bundna av PRC1 i mus ESCs var engagerade i ett omfattande rumsliga nätverk av bortträngda gener bär den repressiva Markera H3K27me37. I mänskliga lymfoblastoida celler, en avlägsen element interagerar med BCL6 promotorn förträngde transgenens reporter gen uttryck33, vilket tyder på att den kan fungera för att förtränga BCL6 transkription i sitt ursprungliga sammanhang.

PIRs berikad för beläggning av kromatin isolator protein SAP i mänskliga och sociala råden och nationella Europass-centrum37 kan representera ännu en klass av PIRs. Sammantaget tyder dessa resultat på att PIRs hyser en samling av genen tillsynsverksamhet ännu att präglas funktionellt.

Disclosures

Författarna inte har något att avslöja.

Acknowledgments

Vi tackar Valeriya Malysheva för kritisk läsning av manuskript och sakkunnig hjälp med figur 1. Detta arbete stöddes av medicinska forskningsrådet, UK (herr/L007150/1) och UK bioteknik och biologiska Sciences Research Council, UK (BB/J004480/1).

Materials

Name Company Catalog Number Comments
16% (vol/vol) paraformaldehyde solution Agar Scientific R1026
Dulbecco's Modified Eagle Medium (DMEM) 1x Life Technologies 41965-039
Fetal bovine serum (FBS) sterile filtered Sigma  F9665
Low-retention filter tips  Starlab S1180-3810, S1180-1810, S1180-8810 and S1182-1830
10x PBS pH 7.4 Life Technologies 70011-036
Molecular biology grade water Sigma-Aldrich W4502
1 M Tris-HCl pH 8.0 Life Technologies 15568-025
IGEPAL CA-630  Sigma-Aldrich I8896
5 M NaCl  Life Technologies 24740-011
Protease inhibitor cocktail (EDTA-free)  Roche Diagnostics 11873580001
Restriction buffer 2 (10x NEBuffer 2) New England Biolabs B7002
DNA LoBind tube, 1.5 mL  Eppendorf 0030 108.051
DNA LoBind tube, 2 mL Eppendorf 30108078
20% (wt/vol) SDS   Bio-Rad Laboratories 161-0418
20% (vol/vol) Triton X-100  Sigma-Aldrich T8787
HindIII, 100 U/uL New England Biolabs R0104
10 mM dCTP  Life Technologies 18253-013
10 mM dGTP Life Technologies 18254-011
10 mM dTTP  Life Technologies 18255-018
0.4 mM Biotin-14-dATP Life Technologies 19524-016
DNA polymerase I large (Klenow) fragment 5000 units/mL New England Biolabs M0210
10x T4 DNA ligase reaction buffer  New England Biolabs B0202
100x 10mg/ml Bovine Serum Albumin  New England Biolabs B9001
T4 DNA ligase, 1 U/μL  Invitrogen 15224-025
RNase A  Roche 10109142001
Proteinase K, recombinant, PCR grade  Roche 3115836001
20 000×g 50 ml centrifuge tube VWR 525-0156
0.5 M EDTA pH 8.0  Life Technologies 15575-020
Phenol pH 8.0  Sigma P4557
Phenol: Chloroform: Isoamyl Alcohol 25:24:1  Sigma P3803
Sodium acetate pH 5.2  Sigma S7899
Quant-iT PicoGreen  Invitrogen P7589
QIAquick Gel Extraction Kit Qiagen 28704
QIAquick PCR Purification Kit Qiagen 28104
Restriction buffer 2.1 (10x NEBuffer 2.1) New England Biolabs B7202
NheI, 100U/uL New England Biolabs R0131
Micro TUBE AFA Fiber Pre-slit snap cap 6x16mm vials  Covaris 520045 For sonication
SPRI beads (Agencourt AMPure XP)  Beckman Coulter A63881
Dynabeads MyOne Streptavidin C1 beads  Invitrogen 65001
Tween 20  Sigma P9416
10 mM dATP  Life Technologies 18252-015
T4 DNA polymerase 3000 units/mL New England Biolabs M0203
T4 PNK 10000 units/mL New England Biolabs M0201
Klenow exo minus 5000 units/mL  New England Biolabs M0212
Quick ligation reaction buffer  New England Biolabs B6058
NEB DNA Quick ligase  New England Biolabs M2200
PE adapter 1.0 (5'-P-GATCGGAAGAGCGGTTCAGC
AGGAATGCCGAG-3')
Illumina
PE adapter 2.0 (5'-ACACTCTTTCCCTACACGACGCT
CTTCCGATCT-3')
Illumina
NEB Phusion PCR kit  New England Biolabs M0530
PE PCR primer 1.0 (5'-AATGATACGGCGACCACCGA
GATCTACACTCTTTCCCTAC
ACGACGCTCTTCCGATCT-3')
Illumina
PE PCR primer 2.0 (5'-CAAGCAGAAGACGGCATACGA
GATCGGTCTCGGCATTCCT
GCTGAACCGCTCTTCCGATCT-3') 
Illumina
PCR strips  Agilent Technologies 410022 and 401425
SureSelect SSEL TE Reagent ILM PE full adaptor kit  Agilent Technologies 931108
SureSelect custom 3-5.9 Mb library  Agilent Technologies 5190-4831 custom design mouse or human PCHi-C system
Dynabeads MyOne Streptavidin T1 beads  Invitrogen 65601
E220  high-performance focused ultra-sonicator Corvaris E220

DOWNLOAD MATERIALS LIST

References

  1. Osborne, C. S., et al. Active genes dynamically colocalize to shared sites of ongoing transcription. Nature Genetics. 36, 1065-1071 (2004).
  2. Schoenfelder, S., et al. Preferential associations between co-regulated genes reveal a transcriptional interactome in erythroid cells. Nature Genetics. 42, 53-61 (2010).
  3. de Wit, E., et al. The pluripotent genome in three dimensions is shaped around pluripotency factors. Nature. 501, 227-231 (2013).
  4. Bantignies, F., et al. Polycomb-dependent regulatory contacts between distant Hox loci in Drosophila. Cell. 144, 214-226 (2011).
  5. Engreitz, J. M., et al. The Xist lncRNA exploits three-dimensional genome architecture to spread across the X chromosome. Science. 341, 1237973 (2013).
  6. Denholtz, M., et al. Long-range chromatin contacts in embryonic stem cells reveal a role for pluripotency factors and polycomb proteins in genome organization. Cell Stem Cell. 13, 602-616 (2013).
  7. Schoenfelder, S., et al. Polycomb repressive complex PRC1 spatially constrains the mouse embryonic stem cell genome. Nature Genetics. 47, 1179-1186 (2015).
  8. Kundu, S., et al. Polycomb Repressive Complex 1 generates discrete compacted domains that change during differentiation. Molecular Cell. 65, 432-446 (2017).
  9. Skok, J. A., Gisler, R., Novatchkova, M., Farmer, D., de Laat, W., Busslinger, M. Reversible contraction by looping of the Tcra and Tcrb loci in rearranging thymocytes. Nature Immunology. 8, 378-387 (2007).
  10. Zhang, Y., et al. Spatial organization of the mouse genome and its role in recurrent chromosomal translocations. Cell. 148, 908-921 (2012).
  11. Aymard, F., et al. Genome-wide mapping of long-range contacts unveils clustering of DNA double-strand breaks at damaged active genes. Nature Structural & Molecular Biology. 24, 353-361 (2017).
  12. Ryba, T., et al. Evolutionarily conserved replication timing profiles predict long-range chromatin interactions and distinguish closely related cell types. Genome Research. 20, 761-770 (2010).
  13. Pope, B. D., et al. Topologically associating domains are stable units of replication-timing regulation. Nature. 515, 402-405 (2014).
  14. Chandra, T., et al. Global reorganization of the nuclear landscape in senescent cells. Cell Reports. 10, 471-483 (2015).
  15. Carter, D., Chakalova, L., Osborne, C. S., Dai, Y. F., Fraser, P. Long-range chromatin regulatory interactions in vivo. Nature Genetics. 32, 623-626 (2002).
  16. Tolhuis, B., Palstra, R. J., Splinter, E., Grosveld, F., de Laat, W. Looping and interaction between hypersensitive sites in the active beta-globin locus. Molecular Cell. 10, 1453-1465 (2002).
  17. Amano, T., Sagai, T., Tanabe, H., Mizushina, Y., Nakazawa, H., Shiroishi, T. Chromosomal dynamics at the Shh locus: limb bud-specific differential regulation of competence and active transcription. Developmental Cell. 16, 47-57 (2009).
  18. Zuniga, A., et al. Mouse limb deformity mutations disrupt a global control region within the large regulatory landscape required for Gremlin expression. Genes & Development. 18, 1553-1564 (2004).
  19. Sagai, T., Hosoya, M., Mizushina, Y., Tamura, M., Shiroishi, T. Elimination of a long-range cis-regulatory module causes complete loss of limb-specific Shh expression and truncation of the mouse limb. Development. 132, 797-803 (2005).
  20. D'Haene, B., et al. Disease-causing 7.4 kb cis-regulatory deletion disrupting conserved non-coding sequences and their interaction with the FOXL2 promotor: implications for mutation screening. PLoS Genet. 5, e1000522 (2009).
  21. Sur, I. K., et al. Mice lacking a Myc enhancer that includes human SNP rs6983267 are resistant to intestinal tumors. Science. 338, 1360-1363 (2012).
  22. Herranz, D., et al. A NOTCH1-driven MYC enhancer promotes T cell development, transformation and acute lymphoblastic leukemia. Nature Medicine. 20, 1130-1137 (2014).
  23. Deng, W., et al. Controlling long-range genomic interactions at a native locus by targeted tethering of a looping factor. Cell. 149, 1233-1244 (2012).
  24. Groschel, S., et al. A single oncogenic enhancer rearrangement causes concomitant EVI1 and GATA2 deregulation in leukemia. Cell. 157, 369-381 (2014).
  25. Lupianez, D. G., et al. Disruptions of topological chromatin domains cause pathogenic rewiring of gene-enhancer interactions. Cell. 161, 1012-1025 (2015).
  26. Franke, M., et al. Formation of new chromatin domains determines pathogenicity of genomic duplications. Nature. 538, 265-269 (2016).
  27. Dekker, J., Rippe, K., Dekker, M., Kleckner, N. Capturing chromosome conformation. Science. 295, 1306-1311 (2002).
  28. Simonis, M., et al. Nuclear organization of active and inactive chromatin domains uncovered by chromosome conformation capture-on-chip (4C). Nature Genetics. 38, 1348-1354 (2006).
  29. Zhao, Z., et al. Circular chromosome conformation capture (4C) uncovers extensive networks of epigenetically regulated intra- and interchromosomal interactions. Nature Genetics. 38, 1341-1347 (2006).
  30. Dostie, J., et al. Chromosome Conformation Capture Carbon Copy (5C): A massively parallel solution for mapping interactions between genomic elements. Genome Research. 16, 1299-1309 (2006).
  31. Lieberman-Aiden, E., et al. Comprehensive mapping of long-range interactions reveals folding principles of the human genome. Science. 326, 289-293 (2009).
  32. Belton, J. M., McCord, R. P., Gibcus, J. H., Naumova, N., Zhan, Y., Dekker, J. Hi-C: a comprehensive technique to capture the conformation of genomes. Methods. 58, 268-276 (2012).
  33. Mifsud, B., et al. Mapping long-range promoter contacts in human cells with high-resolution capture Hi-C. Nature Genetics. 47, 598-606 (2015).
  34. Schoenfelder, S., et al. The pluripotent regulatory circuitry connecting promoters to their long-range interacting elements. Genome Res. 25, 582-597 (2015).
  35. Javierre, B. M., et al. Lineage-specific genome architecture links enhancers and non-coding disease variants to target gene promoters. Cell. 167, 1369-1384 (2016).
  36. Wilson, N. K., et al. Integrated genome-scale analysis of the transcriptional regulatory landscape in a blood stem/progenitor cell model. Blood. 127, e12-e23 (2016).
  37. Freire-Pritchett, P., et al. Global reorganisation of cis-regulatory units upon lineage commitment of human embryonic stem cells. Elife. 6, (2017).
  38. Rubin, A. J., et al. Lineage-specific dynamic and pre-established enhancer-promoter contacts cooperate in terminal differentiation. Nature Genetics. 49, 1522-1528 (2017).
  39. Siersbaek, R., et al. Dynamic rewiring of promoter-anchored chromatin loops during adipocyte differentiation. Molecular Cell. 66, 420-435 (2017).
  40. Sahlen, P., et al. Genome-wide mapping of promoter-anchored interactions with close to single-enhancer resolution. Genome Biology. 16, 156 (2015).
  41. Nagano, T., et al. Single-cell Hi-C reveals cell-to-cell variability in chromosome structure. Nature. 502, 59-64 (2013).
  42. Nagano, T., Varnai, C., Schoenfelder, S., Javierre, B. M., Wingett, S. W., Fraser, P. Comparison of Hi-C results using in-solution versus in-nucleus ligation. Genome Biology. 16, 175 (2015).
  43. Wingett, S., et al. HiCUP: pipeline for mapping and processing Hi-C data. F1000 Res. 4, 1310 (2015).
  44. Dryden, N. H., et al. Unbiased analysis of potential targets of breast cancer susceptibility loci by Capture Hi-C. Genome Research. 24, 1854-1868 (2014).
  45. Martin, P., et al. Capture Hi-C reveals novel candidate genes and complex long-range interactions with related autoimmune risk loci. Nature Communications. 6, 10069 (2015).
  46. McGovern, A., et al. Capture Hi-C identifies a novel causal gene, IL20RA, in the pan-autoimmune genetic susceptibility region 6q23. Genome Biol.ogy. 17, 212 (2016).
  47. Hodge, D., et al. A global role for EKLF in definitive and primitive erythropoiesis. Blood. 107, 3359-3370 (2006).
  48. Jager, R., et al. Capture Hi-C identifies the chromatin interactome of colorectal cancer risk loci. Nature Communications. 6, 6178 (2015).
  49. Joshi, O., et al. Dynamic reorganization of extremely long-range promoter-promoter Interactions between two states of pluripotency. Cell Stem Cell. 17, 748-757 (2015).
  50. Hughes, J. R., et al. Analysis of hundreds of cis-regulatory landscapes at high resolution in a single, high-throughput experiment. Nature Genetics. 46, 205-212 (2014).
  51. Kolovos, P., et al. Targeted Chromatin Capture (T2C): A novel high-resolution high-throughput method to detect genomic interactions and regulatory elements. Epigenetics Chromatin. 7, 10 (2014).
  52. Davies, J. O., et al. Multiplexed analysis of chromosome conformation at vastly improved sensitivity. Nature Methods. 13, 74-80 (2016).
  53. Mumbach, M. R., et al. HiChIP: efficient and sensitive analysis of protein-directed genome architecture. Nature Methods. 13, 919-922 (2016).
  54. Fullwood, M. J., et al. An oestrogen-receptor-alpha-bound human chromatin interactome. Nature. 462, 58-64 (2009).
  55. Maurano, M. T., et al. Systematic localization of common disease-associated variation in regulatory DNA. Science. 337, 1190-1195 (2012).
  56. Petersen, R., et al. Platelet function is modified by common sequence variation in megakaryocyte super enhancers. Nat. Commun. 8, 16058 (2017).
  57. Akhtar, W., et al. Chromatin position effects assayed by thousands of reporters integrated in parallel. Cell. 154, 914-927 (2013).
  58. Cairns, J., et al. CHiCAGO: Robust detection of DNA looping interactions in Capture Hi-C data. Genome Biology. 17, 127 (2016).
  59. Rajagopal, N., et al. High-throughput mapping of regulatory DNA. Nature Biotechnology. 34, 167-174 (2016).
Arrangören Capture-C: Högupplösta, Genome-wide profilering av promotorn interaktioner
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Schoenfelder, S., Javierre, B. M., Furlan-Magaril, M., Wingett, S. W., Fraser, P. Promoter Capture Hi-C: High-resolution, Genome-wide Profiling of Promoter Interactions. J. Vis. Exp. (136), e57320, doi:10.3791/57320 (2018).More

Schoenfelder, S., Javierre, B. M., Furlan-Magaril, M., Wingett, S. W., Fraser, P. Promoter Capture Hi-C: High-resolution, Genome-wide Profiling of Promoter Interactions. J. Vis. Exp. (136), e57320, doi:10.3791/57320 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter