Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Genetics

एंटीबायोटिक प्रतिरोध के विकास में Multicopy Plasmids की भूमिका का परीक्षण

doi: 10.3791/57386 Published: May 2, 2018

Summary

यहाँ हम एंटीबायोटिक प्रतिरोध के विकास में multicopy plasmids की भूमिका का परीक्षण करने के लिए एक प्रयोगात्मक विधि पेश करते हैं ।

Abstract

Multicopy plasmids prokaryotes में बेहद प्रचुर मात्रा में हैं लेकिन जीवाणु विकास में उनकी भूमिका खराब समझी जाती है. हम हाल ही में पता चला कि multicopy plasmids द्वारा प्रदान की सेल प्रति जीन प्रति संख्या में वृद्धि प्लाज्मिड के विकास में तेजी लाने के जीन इनकोडिंग सकता है । इस काम में, हम एक प्रयोगात्मक प्रणाली वर्तमान multicopy plasmids की क्षमता का परीक्षण करने के लिए जीन विकास को बढ़ावा देने के । सरल आणविक जीवविज्ञान विधियों का प्रयोग, हम एक मॉडल प्रणाली का निर्माण किया, जहां एक एंटीबायोटिक प्रतिरोध जीन ई कोलाई MG1655 में डाला जा सकता है, या तो गुणसूत्र में या एक multicopy प्लाज्मिड पर. हम एक प्रयोगात्मक विकास दृष्टिकोण का उपयोग करने के लिए एंटीबायोटिक दवाओं की बढ़ती सांद्रता के तहत अलग उपभेदों प्रचार और हम समय के साथ बैक्टीरियल आबादी का अस्तित्व उपाय । एंटीबायोटिक अणु और प्रतिरोध जीन का चुनाव इतना है कि जीन केवल उत्परिवर्तनों के अधिग्रहण के माध्यम से प्रतिरोध प्रदान कर सकते हैं । यह "विकासवादी बचाव" दृष्टिकोण एंटीबायोटिक प्रतिरोध के अधिग्रहण को बढ़ावा देने के लिए multicopy plasmids की क्षमता का परीक्षण करने के लिए एक सरल तरीका प्रदान करता है । प्रायोगिक प्रणाली के अगले कदम में, एंटीबायोटिक प्रतिरोध के आणविक ठिकानों की विशेषता है । एंटीबायोटिक प्रतिरोध के अधिग्रहण के लिए जिंमेदार उत्परिवर्तनों की पहचान करने के लिए हम पूरी आबादी और क्लोन से प्राप्त नमूनों की गहरी डीएनए अनुक्रमण का उपयोग करें । अंत में, अध्ययन के तहत जीन में उत्परिवर्तनों की भूमिका की पुष्टि करने के लिए, हम उंहें पैतृक पृष्ठभूमि में पुनर्निर्माण और परिणामस्वरूप उपभेदों के प्रतिरोध phenotype परीक्षण ।

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

बैक्टीरिया में एंटीबायोटिक प्रतिरोध एक प्रमुख स्वास्थ्य समस्या है1। एक बुनियादी स्तर पर, रोगजनक बैक्टीरिया में एंटीबायोटिक प्रतिरोध के प्रसार प्राकृतिक चयन2,3द्वारा विकास का एक सरल उदाहरण है । रखो बस, एंटीबायोटिक दवाओं का उपयोग प्रतिरोधी उपभेदों के लिए चयन उत्पंन करता है । विकासवादी जीवविज्ञान में एक महत्वपूर्ण समस्या है, इसलिए, कारकों है कि जीवाणु आबादी की क्षमता को प्रभावित करने के लिए एंटीबायोटिक दवाओं के लिए प्रतिरोध विकसित समझ है । चयन प्रयोगों बैक्टीरिया की विकासवादी जीवविज्ञान की जांच करने के लिए एक बहुत शक्तिशाली उपकरण के रूप में उभरा है, और इस क्षेत्र विकासवादी समस्याओं की एक विस्तृत श्रृंखला में अविश्वसनीय अंतर्दृष्टि का उत्पादन किया गया है4,5,6। प्रयोगात्मक विकास में, एक एकल पैतृक तनाव से शुरू बैक्टीरियल आबादी प्रश्नपत्र परिभाषित और कसकर नियंत्रित शर्तों के तहत पारित कर रहे हैं । उत्परिवर्तनों के कुछ है कि इन संस्कृतियों के विकास के दौरान हो बैक्टीरियल स्वास्थ्य में वृद्धि, और इन संस्कृतियों के माध्यम से प्राकृतिक चयन द्वारा फैल गया । प्रयोग के दौरान, आबादियों के नमूनों को आवधिक रूप से एक गैर-जमे हुए जीवाश्म रिकॉर्ड तैयार करने के लिए रखा जाता है । दृष्टिकोण की एक विस्तृत संख्या के लिए इस्तेमाल किया जा सकता है बैक्टीरियल आबादी विकसित विशेषताएं, लेकिन दो सबसे आम तरीकों फिटनेस परख रहे हैं, कि विकसित बैक्टीरिया की क्षमता को मापने के लिए उनके दूर पूर्वजों के खिलाफ प्रतिस्पर्धा, और पूरे जीनोम अनुक्रमण, कि है आनुवंशिक परिवर्तन है कि ड्राइव अनुकूलन की पहचान करने के लिए इस्तेमाल किया । रिचर्ड Lenski और सहयोगियों7,8द्वारा अग्रणी काम के बाद, प्रयोगात्मक विकास में मानक दृष्टिकोण को दोहराने की आबादी की एक अपेक्षाकृत छोटी संख्या को चुनौती दी गई है (आमतौर पर < 10) एक नया करने के लिए अनुकूल के साथ इस तरह के नए कार्बन स्रोतों, तापमान, या एक शिकारी फेज के रूप में पर्यावरण चैलेंज, ।

एंटीबायोटिक प्रतिरोधी बैक्टीरिया की वजह से संक्रमण एक बड़ी समस्या बन जाता है जब प्रतिरोध पर्याप्त उच्च है कि रोगी के ऊतकों में घातक स्तर के लिए एंटीबायोटिक सांद्रता को बढ़ाने के लिए संभव नहीं है । चिकित्सकों इसलिए क्या बैक्टीरिया एंटीबायोटिक की उच्च खुराक है कि इस सीमा एंटीबायोटिक एकाग्रता, नैदानिक विराम बिंदु से ऊपर है के लिए प्रतिरोध विकसित करने की अनुमति देता में रुचि रखते हैं । इस प्रयोग का अध्ययन कैसे करें? अगर बैक्टीरियल आबादी की एक छोटी संख्या एंटीबायोटिक की एक उच्च खुराक के साथ चुनौती दी है, के रूप में एक Lenski शैली प्रयोग में है, तो सबसे अधिक संभावना परिणाम यह है कि एंटीबायोटिक लुप्त होने के लिए आबादी के सभी ड्राइव करेंगे । एक ही समय में, अगर एंटीबायोटिक की खुराक है कि प्रयोग किया जाता है कम है, माता पिता के तनाव के ंयूनतम निरोधात्मक एकाग्रता (MIC) नीचे, तो यह संभावना नहीं है कि जीवाणु आबादी प्रतिरोध के नैदानिक प्रासंगिक स्तर विकसित होगा, खासकर अगर प्रतिरोध एक बड़ी लागत वहन करती है । इन दो परिदृश्यों के बीच एक समझौता एक "विकासवादी बचाव" प्रयोग9,10,11का उपयोग करने के लिए है । इस दृष्टिकोण में, संस्कृतियों की एक बहुत बड़ी संख्या (आमतौर पर > 40) एंटीबायोटिक दवाओं की खुराक के साथ चुनौती दी है कि समय के साथ वृद्धि, आमतौर पर एंटीबायोटिक एकाग्रता दोहरीकरण द्वारा हर दिन12. इस प्रयोग की बानगी यह है कि किसी भी आबादी है कि वृद्धि प्रतिरोध विकसित नहीं विलुप्त होने के लिए प्रेरित किया जाएगा । ज्यादातर आबादी है कि इस रास्ते में चुनौती दी है विलुप्त होती संचालित किया जाएगा, लेकिन एक छोटे से अल्पसंख्यक प्रतिरोध के उच्च स्तर पर विकसित होने से बनी रहेगी । इस पत्र में, हम बताते है कि कैसे इस प्रयोगात्मक डिजाइन प्रतिरोध के विकास के लिए multicopy प्लाज्मिड योगदान की जांच करने के लिए इस्तेमाल किया जा सकता है ।

बैक्टीरिया दो प्रमुख मार्गों के माध्यम से एंटीबायोटिक दवाओं के लिए प्रतिरोध प्राप्त, गुणसूत्र उत्परिवर्तनों, और मोबाइल आनुवंशिक तत्वों के अधिग्रहण, ज्यादातर plasmids13। Plasmids एंटीबायोटिक प्रतिरोध के विकास में एक महत्वपूर्ण भूमिका निभाते हैं, क्योंकि वे विकार14,15द्वारा बैक्टीरिया के बीच प्रतिरोध जीन हस्तांतरण करने में सक्षम हैं । Plasmids अपने आकार और जीव विज्ञान के अनुसार दो समूहों में विभाजित किया जा सकता है: "छोटे", जीवाणु कोशिका और "बड़े" प्रति उच्च प्रति संख्या के साथ, कम कॉपी संख्या16,17के साथ. एंटीबायोटिक प्रतिरोध के विकास में बड़े plasmids की भूमिका बड़े पैमाने पर प्रलेखित किया गया है क्योंकि वे conjugative plasmids, जो प्रतिरोध और बैक्टीरिया के बीच बहु प्रतिरोध के प्रसार के प्रमुख ड्राइवरों15शामिल हैं । छोटे multicopy plasmids भी बहुत बैक्टीरिया17,18में आम हैं, और वे अक्सर एंटीबायोटिक प्रतिरोध जीन19के लिए कोड । हालांकि, एंटीबायोटिक प्रतिरोध के विकास में छोटे multicopy plasmids की भूमिका एक हद तक कम करने के लिए अध्ययन किया गया है ।

हाल के एक काम में, हम प्रस्ताव किया है कि multicopy plasmids जीन के विकास में तेजी लाने के लिए वे जीन उत्परिवर्तन उच्च सेल के प्रति अधिक जीन प्रति संख्या के कारण दरों में वृद्धि से ले सकता है12ई. कोलाई तनाव MG1655 और β-lactamase जीन ब्लॅकउनि-1 के साथ एक प्रयोगात्मक मॉडल का उपयोग कर यह दिखाया गया था कि multicopy plasmids की उपस्थिति की दर त्वरित उनि-1 तीसरी पीढ़ी के प्रतिरोध को प्रदान उत्परिवर्तनों cephalosporin ceftazidime. इन परिणामों से संकेत दिया कि multicopy plasmids एंटीबायोटिक प्रतिरोध के विकास में एक महत्वपूर्ण भूमिका निभा सकता है ।

यहाँ, हम एंटीबायोटिक प्रतिरोध की multicopy प्लाज्मिड-मध्यस्थता विकास की जांच करने के लिए विकसित की है कि विधि का एक विस्तृत वर्णन प्रस्तुत करते हैं । इस विधि तीन अलग कदम है: पहले, अध्ययन के तहत जीन की प्रविष्टि या तो एक multicopy प्लाज्मिड या मेजबान बैक्टीरिया के गुणसूत्र में । दूसरा, प्रयोगात्मक विकास का उपयोग (विकासवादी बचाव) के लिए अलग उपभेदों की क्षमता का आकलन करने के लिए चयनात्मक दबाव के अनुकूल । और तीसरा, आणविक आधार प्लाज्मिड अंतर्निहित डीएनए अनुक्रमण का उपयोग कर विकास और माता पिता के जीनोटाइप में व्यक्तिगत रूप से संदिग्ध उत्परिवर्तनों के पुनर्निर्माण का निर्धारण ।

अंत में, हालांकि प्रोटोकॉल यहां वर्णित एंटीबायोटिक प्रतिरोध के विकास की जांच के लिए डिज़ाइन किया गया था, एक तर्क है कि इस विधि आम तौर पर किसी भी multicopy में उत्परिवर्तनों द्वारा अधिग्रहीत नवाचारों के विकास का विश्लेषण उपयोगी हो सकता है प्लाज्मिड-एनकोडेड जीन ।

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. प्रायोगिक प्रणाली एंकोडिंग एंटीबायोटिक प्रतिरोध जीन का निर्माण

नोट: यहां ई. कोलाई MG1655 प्लाज्मिड के प्राप्तकर्ता तनाव या गुणसूत्र-एंटीबायोटिक प्रतिरोध जीन इनकोडिंग के रूप में इस्तेमाल किया गया था । एंटीबायोटिक प्रतिरोध जीन गुणसूत्र या एक अंयथा isogenic तनाव में एक multicopy प्लाज्मिड में इनकोडिंग है (चित्रा 1) ।

  1. MG1655 के गुणसूत्र के λ फेज एकीकरण स्थल (attB)20 में एंटीबायोटिक प्रतिरोध जीन का सम्मिलन ।
    1. ५०० bp-लंबे क्षेत्र पीसीआर द्वारा गुणसूत्र attB साइट के दोनों किनारों पर बढ़ाना । वाम GCCCGCCACCCTCCGGGCCGGTATAAAAAAGCAGGCTTCA क्षेत्र के लिए oligonucleotides YbhC-एफ (5 '-CCTGTACCGTACAGAGTAAT-3 ') और attB-R (5 '-समरूपता-3 ') का उपयोग करें और attB-एफ (5 '-AGCGCCCTAGCGCCCGCTCCTTATACTAACTTGAGCGAAA-3 ') और YbhB/R (5 '- TGGCGATAATATTTCACCGC-3 ') सही एक के लिए । बढ़ाना ब्लॅकउनि-1 प्रतिरोध जीन का उपयोग प्राइमरी Tem1-pBAD-एफ (5 '-TGAAGCCTGCTTTTTTATACCGGCCCGGAGGGTGGCGGGC-3 ') और Tem1-pBAD-आर (5 '-TTTCGCTCAAGTTAGTATAAGGAGCGGGCGCTAGGGCGCT-3 '). लगभग 20 बीपी के साथ डिजाइन प्राइमरों (5 ' अंत में) टुकड़ा है कि करने के लिए जुड़े होने जा रहा है complementarity दिखा अनुक्रम के ।
    2. फ्यूज समरूपता क्षेत्रों एंटीबायोटिक प्रतिरोध जीन पीसीआर उत्पाद के लिए (अपने प्रवर्तक क्षेत्र सहित) इज़ोटेर्माल विधानसभा21का उपयोग कर, 30 मिनट के लिए ५० डिग्री सेल्सियस पर.
    3. प्लाज्मिड pKOBEG युक्त Electroporate MG1655 कोशिकाएं ।
      नोट: pKOBEG एक thermosensitive वेक्टर है कि λ लाल मशीनरी शामिल है, गुणसूत्र और पीसीआर उत्पादों के बीच समरूपता-आधारित allelic एक्सचेंजों को बढ़ावा देने के22
      1. 2 मिमी cuvettes में 4 डिग्री सेल्सियस और २.५ केवी में electrocompetent कोशिकाओं के ४० µ एल में कदम 1.1.223 से उत्पाद के 1 µ एल का उपयोग करें । λ लाल मशीनरी की अभिव्यक्ति को बनाए रखने के लिए पौंड शोरबा + ०.२% arabinose की 1 मिलीलीटर में कोशिकाओं को पुनर्निलंबित करें ।
      2. एक microfuge ट्यूब के लिए कुल मात्रा हस्तांतरण और 30 डिग्री सेल्सियस पर 2 ज (pKOBEG के लिए स्वतंत्र तापमान) तीव्र मिलाते के साथ (एक कक्षीय शेखर में २०० rpm) के लिए अनुमति देने के प्रतिरोध मार्करों में डाला phenotypic अभिव्यक्ति ।
      3. प्लेट पौंड पर कोशिकाओं को एंटीबायोटिक प्रतिरोध जीन के लिए चयन करने के लिए उपयुक्त एंटीबायोटिक युक्त आगर (एम्पीसिलीन या carbenicillin पर १०० mg/l के लिए ब्लॅकउनि-1).
    4. एक पेट्री डिश पर प्लेट १०० µ एल, और मात्रा के बाकी नीचे स्पिन, ताजा पौंड शोरबा के १०० µ एल में यह reसस्पेंड और एक और पेट्री डिश पर यह थाली । ४२ डिग्री सेल्सियस पर रात भर गर्मी ।
      नोट: यह तापमान pKOBEG की प्रतिकृति के लिए गैर-स्वतंत्र है । इन परिस्थितियों में विकसित करने में सक्षम कालोनियों pKOBEG खो दिया है और प्रतिरोध के लिए attB साइट में एकीकृत जीन पेश करेंगे (सादगी के लिए इस तनाव MG1655 कहा जाएगा ::रेसा पर यहां से) ।
    5. क्लॉरॅंफेनिकोल के साथ प्लेटों में ब्याज की कालोनियों की नकल करके pKOBEG के नुकसान के लिए परीक्षण (एंटीबायोटिक जिसके खिलाफ pKOBEG एक प्रतिरोध मार्कर होता है) ।
      नोट: 30 º c के स्वतंत्र तापमान पर क्लॉरॅंफेनिकोल प्लेटों में वृद्धि की कमी प्लाज्मिड के अभाव का संकेत है ।
    6. आदेश में क्लोन सत्यापित करने के लिए, पीसीआर बाह्य प्राइमरों YbhC-Extern (5 '-TTTGTGACCAGAAGACCGCA-3 ') और YbhB-Extern (5 '-CTCATCAGTAACGATCTGCG-3 ') का उपयोग कर निर्माण बढ़ाना, जेल के माध्यम से सत्यापित ट्रो और अनुक्रम का सही आकार शुद्ध उत्पाद सुनिश्चित करने के लिए कि डाला जीन के अनुक्रम सही है ।
  2. एक multicopy प्लाज्मिड में एंटीबायोटिक प्रतिरोध जीन डालें ।
    नोट: क्योंकि बहुत-उच्च प्रतिलिपि संख्या के साथ plasmids बैक्टीरियल मेजबान स्वास्थ्य में एक बड़ी कमी थोपने के लिए करते हैं, हम अनुशंसा करते हैं multicopy plasmids के एक प्राकृतिक मूल के साथ प्रतिकृति, जैसे p3655 (pSU18T-pBADgfp2, ColE1-प्रकार के मूल के 24प्रतिकृति) । ये plasmids आमतौर पर प्रति कक्ष के बारे में 15-20 प्रतियों की एक मॉडरेट प्रतिलिपि संख्या प्रस्तुत करते हैं ।
    1. पीसीआर पसंद के एंटीबायोटिक प्रतिरोध जीन बढ़ाना (प्रमोटर क्षेत्र सहित), पीसीआर उत्पाद phosphorylate और यह पीसीआर को ligate-प्रवर्धित रीढ़ की प्लाज्मिड:
      1. पीसीआर एंटीबायोटिक प्रतिरोध जीन बढ़ाना; त्यात ब्लॅकउनि-१ फीमेल प्राइमर्स Tem1-pBAD-एफ (५ '-TGAAGCCTGCTTTTTTATACCGGCCCGGAGGGTGGCGGGC-३ ') आणि Tem1-pBAD-आर (५ '-TTTCGCTCAAGTTAGTATAAGGAGCGGGCGCTAGGGCGCT-३ ').
      2. Phosphorylate टी-4 polynucleotide कळेनासे का उपयोग कर शुद्ध उत्पाद, निर्माता के निर्देशों का पालन ।
      3. पीसीआर एक उच्च निष्ठा पोलीमरेज़ और oligonucleotides pBAD-एफ (5 '-CGTTGATCGGCACGTAAGAG-3 ') और pBAD-R (5 '-AAACGACGGCCAGTGCCAAG-3 ') का उपयोग कर प्लाज्मिड रीढ़ बढ़ाना ।
      4. Ligate-ligase निम्न निर्माता के दिशानिर्देशों का उपयोग करके दोनों पीसीआर अंशों को विभाजित करें ।
    2. Electroporate, जैसा कि पहले वर्णित है, ४० µ एल के electrocompetent ई. कोलाई DH5-α कोशिकाओं की एक अधिकतम 1 µ एल के साथ बंधाव उत्पाद और एंटीबायोटिक प्रतिरोध जीन के लिए उपयुक्त एंटीबायोटिक दवाओं पर चयन (एम्पीसिलीन या carbenicillin पर १०० mg/L त्यात ब्लॅकउनि-१) आणि प्लाज्मिड रीढ़ आहे.
      नोट: arabinose के साथ £ पूरक यहां अनावश्यक है ।
    3. व्यावसायिक मिनी पाठक की पसंद की तैयारी किट का उपयोग कर प्लाज्मिड निकालें:
      1. फसल कमरे के तापमान पर १२,००० x g पर केंद्रापसारक द्वारा एक रात संस्कृति के 5 मिलीलीटर । resuspension समाधान के २५० µ एल में कोशिकाओं reसस्पेंड और अच्छी तरह से मिश्रण । जोड़ें lysis समाधान के २५० µ एल और अच्छी तरह से मिश्रण । बेअसर के ३५० µ एल जोड़ें और अच्छी तरह से मिश्रण ।
      2. किट के साथ प्रदान की डीएनए बंधन कॉलम को supernatant स्थानांतरण, 1 मिनट के लिए केंद्रापसारक और प्रवाह के माध्यम से त्यागें । धोने समाधान के ५०० µ एल के साथ कॉलम दो बार धोने, एक मिनट के लिए केंद्रापसारक और प्रत्येक धोने पर flowthrough त्याग । अवशिष्ट धोने बफर हटाने के लिए 1 अतिरिक्त मिनट के लिए खाली कॉलम केंद्रापसारक ।
      3. एक साफ ट्यूब में स्तंभ रखें और शुद्ध डीएनए elute करने के लिए झिल्ली को अल्ट्रा शुद्ध पानी की ५० µ एल जोड़ें । 1-2 मिनट के लिए केंद्रापसारक और प्रवाह के माध्यम से इकट्ठा कि शुद्ध प्लाज्मिड शामिल हैं । सैंज सीक्वेंस प्लाज्मिड में रुचि का जीन डाला अनुक्रम के बाहर से प्राइमर का उपयोग कर पुष्टि करने के लिए कि अनुक्रम सही है और कोई परिवर्तन प्रतिरोध जीन में मौजूद है विकास प्रयोगों से पहले ।
    4. एक बार अनुक्रम सत्यापित है, electroporate में प्लाज्मिड ई. कोलाई MG1655 तनाव, ऊपर वर्णित के रूप में.
      नोट: यह पैदावार तनाव MG1655/pRESA ।

2. विकास बचाव दृष्टिकोण प्रयोग करने के लिए एंटीबायोटिक प्रतिरोध विकसित (चित्रा 1)

  1. पौंड प्लेटों पर अध्ययन के तहत उपभेदों बाहर लकीर: MG1655::रेसा और MG1655/pRESA प्लस अतिसंवेदनशील अभिभावक तनाव, MG1655 ।
    नोट: प्लाज्मिड pRESA MG1655 में स्थिर होना चाहिए, इसलिए इसमें कोई भी एंटीबायोटिक दवाओं को पौंड प्लेटों में जोड़ने की जरूरत नहीं है । ई. कोलाई में उत्परिवर्तन दर काफी कम है तो एक बार निर्माण सत्यापित है यह आवश्यक नहीं है हर कदम पर प्लाज्मिड अनुक्रम सत्यापित है ।
  2. तैयार ९६-अच्छी तरह से प्रत्येक अच्छी तरह से और inoculate ४८ स्वतंत्र कुओं में प्रत्येक तनाव की अलग कालोनियों में पौंड के २०० µ एल के साथ प्लेटें (तनाव प्रति एक प्लेट) । ३७ डिग्री सेल्सियस और २०० rpm पर रात भर प्लेटें । इन फाउंडर आबादियों का जम कर स्टॉक रखें ।
    नोट: रोकने के लिए और संस्कृति पार के लिए नियंत्रण ९६ में संदूषण-अच्छी तरह से प्लेटें, ९६ अच्छी तरह से थाली भर में बैक्टीरिया मुक्त माध्यम के साथ intercalating inoculated कुओं द्वारा एक चेकरबोर्ड प्लेट डिजाइन का उपयोग करें । पूरे प्रयोगात्मक विकास के दौरान इस थाली डिजाइन का प्रयोग करें ।
  3. नई ९६ में संस्थापक आबादी के साथ प्लेटों की एक अच्छी तरह से inoculating 2 µ एल द्वारा विकासवादी बचाव प्रयोग प्रारंभ करें-खैर एक उप के साथ अच्छी तरह से १९८ µ एल पौंड के साथ प्लेटों में एंटीबायोटिक के अध्ययन के अधीन निरोधात्मक एकाग्रता । विकासवादी बचाव दृष्टिकोण के लिए ¼ या 1/8 न्यूनतम निरोधात्मक एकाग्रता के साथ शुरू (MIC, तीन उपभेदों में से प्रत्येक के लिए पौंड में एंटीबायोटिक के पहले से ही निर्धारित25) और एंटीबायोटिक दैनिक की एकाग्रता दोगुना. इस दृष्टिकोण का प्रयोग आबादी की संभावना को अधिकतम करने के लिए प्रतिरोध उत्परिवर्तनों26प्राप्त करते हैं । 20 एच के लिए ३७ ° c और २०० rpm पर प्लेटें मशीन ।
    नोट: संस्थापक आबादी के रातोंरात ओडी उपाय । अगर वहां के बीच में महत्वपूर्ण मतभेद है आयुध डिपो के साथ प्रयोग शुरू करने के लिए प्रारंभिक इनोक्युलम सही कोशिकाओं की एक ही संख्या के साथ प्रति ।
  4. हर दिन, प्रत्येक जनसंख्या के आयुध डिपो को मापने रातोंरात संस्कृति के बाद और संस्कृतियों के एक हस्तांतरण प्रदर्शन, के रूप में २.३ में वर्णित है, नए ९६ के लिए अच्छी तरह से प्लेटें डबल दिन से पहले एंटीबायोटिक की एकाग्रता के साथ । ३७ डिग्री सेल्सियस और २०० rpm पर प्लेटें 20 एच मशीन ।
    नोट: 1:100 कमजोर पड़ने फैक्टर प्रति दिन लगभग 6-7 पीढ़ियों का उत्पादन ।
  5. समानांतर में, २.३ और २.४ में वर्णित के रूप में एक ही स्थिति में प्रत्येक तनाव के नियंत्रण आबादी का प्रचार, लेकिन एंटीबायोटिक दवाओं के अभाव में ।
    नोट: नियंत्रण आबादी परिवर्तन एंटीबायोटिक दवाओं और सामांय बैक्टीरिया की मदद करने के लिए प्रयोगात्मक शर्तों के अनुकूल परिवर्तन की उपस्थिति के कारण उत्पंन होने वाले उत्परिवर्तनों के बीच भेदभाव में मदद मिलेगी । समानांतर एंटीबायोटिक दवाओं के अभाव में उत्पंन होने की संभावना है बैक्टीरिया की मदद करने के लिए प्रयोगात्मक शर्तों के अनुकूल नहीं है और एंटीबायोटिक प्रतिरोध करने के लिए संबंधित नहीं है ।
  6. एक प्लेट रीडर का उपयोग संस्कृतियों के ६०० एनएम (आयुध डिपो) के एक तरंग दैर्ध्य पर अवशोषित मापने के द्वारा हर दिन जीवित आबादी की संख्या को ट्रैक ।
    नोट: ऑप्टिकल घनत्व ०.१ से कम मूल्यों जनसंख्या के विलुप्त होने का संकेत मिलता है । अस्तित्व घटता का एक उदाहरण के लिए चित्रा 2 देखें ।
  7. (हर 3-5 दिन) आबादी के सभी का एक जमे हुए शेयर रखें ।
  8. उपयोग लॉग-रैंक परीक्षण [पैकेज RStudio में "अस्तित्व" (संस्करण 0.99.486)] एंटीबायोटिक दवाओं की बढ़ती एकाग्रता के तहत समय पर अलग उपभेदों की आबादी के अस्तित्व में सांख्यिकीय मतभेदों को निर्धारित करने के लिए12
    नोट: यह प्रयोग अगर multicopy plasmids शक्ति प्रदान विशेष एंटीबायोटिक और अध्ययन के तहत जीन के लिए एंटीबायोटिक प्रतिरोध के विकास का निर्धारण करेगा ।

3. एंटीबायोटिक प्रतिरोध के विकास का आणविक आधार (चित्रा 1)

  1. आबादियों और उपभेदों और उपचार के पार क्लोनों के एक प्रतिनिधि संख्या से कुल डीएनए निकालने प्रदर्शन । प्रयोग के दौरान जमा उत्परिवर्तनों का पता लगाने में सक्षम होने के लिए माता पिता के उपभेदों (MG1655, MG1655::रेसा और MG1655/pRESA) शामिल हैं ।
    नोट: डीएनए निष्कर्षण किट के उदाहरण के लिए सामग्री की तालिका देखें । प्रत्येक किट अलग प्रोटोकॉल है; निर्माताओं के निर्देशों का पालन करें ।
  2. डीएनए की गुणवत्ता और एकाग्रता को बढ़ाता है । डीएनए की गुणवत्ता और एकाग्रता का निर्धारण करने के लिए अलग तरीके हैं । २६० एनएम/280 एनएम और २६० एनएम/230 एनएम के अनुपात को मापने गुणवत्ता का निर्धारण । एक फ्लोरोसेंट, डीएनए बाध्यकारी डाई का प्रयोग करें निर्माता के निर्देशों के बाद डीएनए एकाग्रता को मापने के लिए, और agarose जेल ट्रो की पुष्टि करने के लिए कि कोई डीएनए क्षरण या आरएनए संदूषण है ।
  3. एंटीबायोटिक प्रतिरोध के आनुवंशिक आधार की जांच करने के लिए पूरी आबादी और व्यक्तिगत क्लोन के नमूनों से गहरे डीएनए अनुक्रमण का प्रयोग करें ।
    नोट: हम मानव आनुवंशिकी, ऑक्सफोर्ड, ब्रिटेन के लिए वेलकम ट्रस्ट केंद्र में सभी अनुक्रमण आयोजित किया । अधिक जानकारी के लिए सैन Millan एट अल देखें. २०१६१२
  4. breseq 0.26.1 पाइपलाइन27का प्रयोग करें,28 उत्परिवर्तनों का पता लगाने के लिए, बहुरूपता मोड का उपयोग करने के लिए आबादी में उत्परिवर्तनों की आवृत्ति का अनुमान है । प्रयोग के दौरान जमा किया है कि उत्परिवर्तनों का पता लगाने के लिए पैतृक जीनोम के लिए अलग विकसित जीनोम की तुलना करें ।
  5. की आबादी के लोगों के साथ नियंत्रण आबादी में समानांतर में संचित उत्परिवर्तनों एंटीबायोटिक दवाओं की बढ़ती एकाग्रता के बीच अंतर करने के लिए बैक्टीरिया की मदद करने के लिए सामांय प्रयोगात्मक शर्तों के अनुकूल परिवर्तन की तुलना ( नियंत्रण आबादी में पाया उन) और एंटीबायोटिक प्रतिरोध में शामिल उन (विशेष रूप से उन की आबादी में पाया एंटीबायोटिक दबाव के अधीन) ।
    नोट: समानांतर उत्परिवर्तनों की संख्या आमतौर पर कम है, तो विभिंन उपचार के बीच समानांतर उत्परिवर्तनों आसानी से मूल्यांकन किया जा सकता है । अध्ययन के तहत एंटीबायोटिक प्रतिरोध जीन में उत्परिवर्तनों के अलावा यह गुणसूत्र में एंटीबायोटिक प्रतिरोध के साथ जुड़े अन्य उत्परिवर्तनों को खोजने के लिए काफी संभावना है, porins या समाप्ति प्रणालियों में इस तरह के उत्परिवर्तनों12.
  6. माता पिता के दबाव में एंटीबायोटिक प्रतिरोध जीन में उत्परिवर्तनों का पुनर्निर्माण इस प्रोटोकॉल के खंड 1 में के रूप में एक ही दृष्टिकोण का उपयोग कर । १.१ अंक और प्रोटोकॉल के १.२ का पालन करने के लिए माता पिता की पृष्ठभूमि में नए उत्परिवर्तनों परिचय (एक पीसीआर टेंपलेट के रूप में विकसित जीन का प्रयोग) । इन नए निर्माणों के एंटीबायोटिक प्रतिरोध phenotypes का विश्लेषण करने के लिए उत्परिवर्तनों की भूमिका की पुष्टि करें ।

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

हमारे पिछले काम में, विकास β-lactamase जीन उनि-1 तीसरी पीढ़ी cephalosporin ceftazidime12 के लिए प्रतिरोध की दिशा में जांच की थी । इस जीन का चयन किया गया क्योंकि, हालांकि उनि-1 ceftazidime प्रतिरोध प्रदान नहीं करता है, ब्लॅकउनि-1 में उत्परिवर्तनों उनि-1 की गतिविधि की सीमा का विस्तार कर सकते हैं जैसे ceftazidime29hydrolyze सेफालोस्पोरिन्स. ऐसे β-लैक्टमेज़ या aminoglycoside गतिविधि की अपनी सीमा में परिवर्तन करने के लिए अग्रणी एंजाइमों को संशोधित करने के रूप में एंटीबायोटिक प्रतिरोध एंजाइमों में उत्परिवर्तनों आम है29,30। इस प्रायोगिक प्रणाली के लिए एंजाइमों के इस प्रकार के विकास का पता लगाने के आदर्श है । इस प्रोटोकॉल के बाद एक सफल प्रयोग की एक विस्तृत रिपोर्ट के लिए कृपया सैन Millan एट अलदेखें । २०१६१२

यहां, इस प्रयोगात्मक प्रणाली के संभावित परिणामों का एक उदाहरण के लिए प्रोटोकॉल वर्णन प्रस्तुत किया है (ध्यान दें कि इस उदाहरण के लिए इस्तेमाल डेटा असली नहीं है) । इस उदाहरण में अध्ययन के तहत एंटीबायोटिक प्रतिरोध जीन के विकास में multicopy plasmids की संभावित भूमिका की जांच (चलो यह फोन रेसा), हम ऊपर वर्णित प्रोटोकॉल के खंड 1 के बाद प्रयोगात्मक प्रणाली विकसित करना । प्रयोगों तीन उपभेदों का उत्पादन: MG1655, MG1655::रेसा और MG1655/pRESA । दो अलग ß-लस्टम एंटीबायोटिक दवाओं (ceftazidime और meropenem) के लिए प्रतिरोध का विकास प्रोटोकॉल के खंड 2 में वर्णित चरणों के बाद परीक्षण किया गया था । चित्रा 2 अध्ययन के तहत आबादी के अस्तित्व curves से पता चलता है । इस उदाहरण में, MG1655 या MG1655 से उन लोगों की तुलना में ceftazidime में विकसित होने वाली MG1655/pRESA से संबंधित आबादी के अस्तित्व में उल्लेखनीय वृद्धि हुई है::रेसा (लॉग-रैंक परीक्षण, P< ०.०५) । दूसरी ओर, meropenem के मामले में, वहां अलग उपभेदों (प्रवेश रैंक परीक्षण, पी> ०.०५) से संबंधित आबादी के अस्तित्व में कोई महत्वपूर्ण अंतर कर रहे हैं । इसलिए, इन परिणामों का सुझाव है कि एक multicopy प्लाज्मिड में जीन रेसा की उपस्थिति ceftazidime के लिए प्रतिरोध के विकास potentiates नहीं बल्कि meropenem ।

प्रयोग के अंतिम चरण में, एंटीबायोटिक प्रतिरोध के आणविक आधार की जांच की है, के रूप में प्रोटोकॉल की धारा 3 में बताया । सबसे पहले, डीएनए अनुक्रमण रेसा कि प्रतिरोध phenotype के लिए जिंमेदार हो सकता है में उत्परिवर्तनों प्रकट होगा । और दूसरा, पैतृक MG1655 (गुणसूत्र और प्लाज्मिड में दोनों) में रेसा उत्परिवर्तनों के पुनर्निर्माण की पुष्टि या एंटीबायोटिक प्रतिरोध phenotype पर अपनी भूमिका को त्यागना होगा ।

Figure 1
चित्र 1 . प्रोटोकॉल के विभिंन चरणों का योजनाबद्ध प्रतिनिधित्व । बाएं से दाएं: (i) प्रायोगिक प्रणाली का निर्माण: MG1655, MG1655::रेसा और MG1655/pRESA । बैक्टीरियल गुणसूत्र भूरे रंग में प्रतिनिधित्व किया है, नीले रंग में प्लाज्मिड और लाल रंग में रेसा जीन । (ii) विकासवादी बचाव दृष्टिकोण के लिए प्रयोग एंटीबायोटिक प्रतिरोध विकसित: विभिंन उपभेदों की कई आबादी एंटीबायोटिक की बढ़ती एकाग्रता के तहत प्रचारित कर रहे हैं । (iii) एंटीबायोटिक प्रतिरोध के आणविक आधार का विश्लेषण: विकसित आबादी और क्लोन से डीएनए नमूने के अनुक्रमण, एंटीबायोटिक प्रतिरोध उत्परिवर्तनों का पता लगाने और माता पिता के दबाव में इन उत्परिवर्तनों के पुनर्निर्माण । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 2
चित्र 2एंटीबायोटिक दवाओं की बढ़ती सांद्रता के साथ अस्तित्व घटता है । व्यावहारिक आबादी की संख्या का प्रतिनिधित्व उपभेदों MG1655, MG1655::रेसा, और MG1655/pRESA समय के साथ । प्रत्येक तनाव की ४८ आबादी एंटीबायोटिक दवाओं ceftazidime और meropenem की बढ़ती सांद्रता के तहत प्रचारित किया गया, 1 दिन पर MIC के 1/8 के साथ शुरू करने और एंटीबायोटिक एकाग्रता हर दिन दोहरीकरण । लाल धराशायी ऊर्ध्वाधर लाइन अध्ययन के तहत एंटीबायोटिक दवाओं की MIC का प्रतिनिधित्व करता है । ध्यान दें कि ceftazidime के मामले में समय के साथ विभिंन उपभेदों से संबंधित आबादी के अस्तित्व में महत्वपूर्ण मतभेद है (प्रवेश रैंक टेस्ट, पी< ०.०५) । महत्वपूर्ण, केवल प्लाज्मिड ले जाने वाली आबादी एंटीबायोटिक की उच्च स्तर की सांद्रता तक जीवित रहने में सक्षम हैं । दूसरी ओर, meropenem के मामले में, वहां समय पर विभिंन आबादी के अस्तित्व में कोई महत्वपूर्ण मतभेद है (प्रवेश रैंक टेस्ट, पी> ०.०५) । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

हम एक नया आणविक जीवविज्ञान, प्रयोगात्मक विकास और गहरे डीएनए sequencing बैक्टीरिया में एंटीबायोटिक प्रतिरोध के विकास में multicopy plasmids की भूमिका की जांच करने के लिए डिज़ाइन के संयोजन प्रोटोकॉल प्रस्तुत करते हैं । हालांकि इस प्रोटोकॉल विभिंन क्षेत्रों से तकनीक को जोड़ती है, यह सब विकसित करने के लिए आवश्यक तरीकों सरल कर रहे हैं, और एक नियमित रूप से माइक्रोबायोलॉजी प्रयोगशाला में प्रदर्शन किया जा सकता है । प्रोटोकॉल में सबसे महत्वपूर्ण कदम शायद मॉडल प्रणाली उपभेदों और उत्परिवर्तनों के पुनर्निर्माण के निर्माण कर रहे है प्रयोगात्मक विकास के बाद मनाया (जो सटीक एक ही विधि का उपयोग किया जाता है) । हालांकि, इज़ोटेर्माल विधानसभा प्रणाली21, महत्वपूर्ण इस प्रोटोकॉल इतना सरल है आणविक जीवविज्ञान में अनुभव के एक मध्यवर्ती स्तर के साथ किसी भी उपयोगकर्ता इसे लागू कर सकते हैं ।

प्रोटोकॉल की एक और महत्वपूर्ण कदम एंटीबायोटिक दवाओं की बढ़ती सांद्रता के तहत प्रयोगात्मक विकास है । एक उदाहरण के रूप में, इस प्रोटोकॉल उपभेदों के MIC के ¼-1/8 के साथ प्रयोग शुरू होता है और फिर हर दिन एंटीबायोटिक की एकाग्रता दोगुनी । हालांकि, एंटीबायोटिक बदलने की कम दर से26विलुप्त होने से विकासवादी बचाव का मौका बढ़ सकता है । इसलिए, एंटीबायोटिक सांद्रता के परिवर्तन की दर एक पैरामीटर है कि एंटीबायोटिक प्रतिरोध के विकास को बढ़ावा देने के लिए संशोधित किया जा सकता है ।

डीएनए अनुक्रमण और विश्लेषण भी प्रयोगात्मक डिजाइन के महत्वपूर्ण पहलू हैं । जब sequencing पूरी आबादी से और व्यक्तिगत क्लोन दोनों से डीएनए नमूने पर किया जाता है परिणाम और अधिक सरल कर रहे हैं, प्रयोग में अलग समय बिंदुओं पर । आबादी से अनुक्रमण परिणाम उपचार के बीच उत्परिवर्तन प्रोफाइल में सामान्य मतभेद प्रकट होगा, साथ ही समय पर लाभकारी उत्परिवर्तनों के चुनिंदा राज्यभर और क्लोनल हस्तक्षेप की संभावित घटनाओं. जब आबादी से दृश्यों का विश्लेषण, यह फिल्टर उत्परिवर्तनों कि किसी भी आबादी में 10% आवृत्ति को पार कर कभी नहीं बेहतर है । व्यक्तिगत क्लोन से अनुक्रम आबादी से प्राप्त परिणामों की पुष्टि करने में मदद और सबसे महत्वपूर्ण बात, जनसंख्या के स्तर पर मनाया अलग उत्परिवर्तनों के बीच विशिष्ट संयोजन प्रकट करते हैं । इन विशिष्ट संघों उत्परिवर्तनों के बीच epistatic बातचीत को उजागर करने में मदद कर सकते हैं, जो बैक्टीरियल अनुकूलन में एक महत्वपूर्ण भूमिका निभाते हैं31.

इस विधि का प्रयोग, हम हाल ही में दिखाया है कि multicopy plasmids एंटीबायोटिक प्रतिरोध के विकास में तेजी लाने, उपंयास उत्परिवर्तनों की उपस्थिति की दर में वृद्धि से पहले और फिर वृद्धि हुई जीन खुराक 12 के कारण उत्परिवर्तनों के प्रभाव को बढ़ाना द्वारा . इसलिए, हम एंटीबायोटिक प्रतिरोध के विकास की जांच करने के लिए एक उपकरण के रूप में विधि विकसित की है, लेकिन यह आवेदनों की एक बहुत व्यापक रेंज हो सकता है । अर्थात्, इस प्रणाली के लिए किसी भी जीवाणु जीन की क्षमता की जांच के लिए एक और अधिक सामांय तरीके से एक नया या बेहतर समारोह की ओर विकसित किया जा सकता है । इस प्रणाली का इस्तेमाल किया जा सकता है, उदाहरण के लिए, एक चयापचय एंजाइम की क्षमता का परीक्षण करने के लिए/ इसके अलावा, यह बजाय hypermutators (डीएनए बेमेल मरंमत में शामिल सेलुलर सिस्टम में एक दोष के साथ बैक्टीरिया) इस्तेमाल किया जा सकता है बैक्टीरिया में अनुकूली जीन विकास की जांच, उत्परिवर्तन hypermutators द्वारा शुरू पूर्वाग्रह से परहेज ।

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

लेखकों का खुलासा करने के लिए कुछ नहीं है ।

Acknowledgments

यह काम Instituto de Salud कार्लोस III द्वारा समर्थित किया गया था (योजना Estatal de i + D + मैं 2013-2016): अनुदान CP15-00012, PI16-00860, और CIBER (CB06/02/0053), सह यूरोपीय विकास क्षेत्रीय कोष द्वारा वित्त पोषित ' ' एक तरह से यूरोप को प्राप्त करने के लिए ' ' (ERDF) । जॅ मैड्रिड के क्षेत्र की सरकार के Atracción de talento कार्यक्रम द्वारा समर्थित है (2016-T1/बायो-1105) और स्पेनिश Ministerio de Economía के I + D Excelencia, Industria y Competitividad (2017-85056-P). एएसएम Instituto de Salud कार्लोस III (MS15/00012) सह से एक Miguel Servet फैलोशिप द्वारा समर्थित है यूरोपीय सामाजिक कोष द्वारा वित्त पोषित "अपने भविष्य में निवेश" (ESF) और ERDF ।

Materials

Name Company Catalog Number Comments
Thermocycler BioRad C1000
Electroporator BiorRad 1652660
Electroporation cuvettes Sigma-Aldrich Z706078
NanoDrop 2000/2000c Thermo Fisher Scientific ND-2000 Determine DNA quality measuring the ratios of absorbance 260nm/280nm and 260nm/230nm
Incubator Memmert UF1060
Incubator (shaker) Cole-Parmer Ltd SI500
Electrophoresis power supply BioRad 1645070 Agarose gel electrophoresis
Electrophoresis chamber BioRad 1704405 Agarose gel electrophoresis
Pippettes Biohit 725020, 725050, 725060, 725070
Multi-channel pippetes Biohit 728220, 728230,
728240
Plate reader Synergy HTX BioTek BTS1LF
Inoculating loops Sigma-Aldrich I8388
96-well plates Falcon 351172
LB BD Difco DF0446-17-3
LB agar Fisher scientific BP1425-500
Phusion Polymerase Thermo Fisher Scientific F533S
Gibson Assembly New England Biolabs E2611S
Resctriction enzymes Fermentas FastDigest
Antibiotics Sigma-Aldrich
QIAprep Spin Miniprep Kit Qiagen 27104 Plasmid extraction kit
Wizard Genomic DNA Purification Kit Promega A1120 gDNA extraction kit
DNeasy Blood & Tissue Kits Qiagen 69506 gDNA extraction kit
Electroporation cuvettes Sigma-Aldrich Z706078
Petri dishes Sigma-Aldrich D9054
Cryotubes ClearLine 390701
96-well plates (-80ºC storage) Thermo Fisher Scientific 249945
QuantiFluor dsDNA System Promega E2670 Quantification of DNA concentartion
Agarose BioRad 1613100 Agarose gel electrophoresis
50x TAE buffer BioRad 1610743 Agarose gel electrophoresis
T4 Polynucleotide Kinase Thermo Fisher Scientific EK0031
T4 DNA Ligase Thermo Fisher Scientific EL0014

DOWNLOAD MATERIALS LIST

References

  1. Neill, J. TACKLING DRUG-RESISTANT INFECTIONS GLOBALLY: FINAL REPORT AND RECOMMENDATIONS. Review on Antimicrobal Resistance. (2016).
  2. Palmer, A. C., Kishony, R. Understanding, predicting and manipulating the genotypic evolution of antibiotic resistance. Nat Rev Genet. 14, (4), 243-248 (2013).
  3. MacLean, R. C., Hall, A. R., Perron, G. G., Buckling, A. The population genetics of antibiotic resistance: integrating molecular mechanisms and treatment contexts. Nat Rev Genet. 11, (6), 405-414 (2010).
  4. Buckling, A., Maclean, R. C., Brockhurst, M. A., Colegrave, N. The Beagle in a bottle. Nature. 457, (7231), 824-829 (2009).
  5. Barrick, J. E., Lenski, R. E. Genome dynamics during experimental evolution. Nature Reviews Genetics. 14, (12), 827-839 (2013).
  6. Elena, S. F., Lenski, R. E. Evolution experiments with microorganisms: The dynamics and genetic bases of adaptation. Nature Reviews Genetics. 4, (6), 457-469 (2003).
  7. Lenski, R. E., Rose, M. R., Simpson, S. C., Tadler, S. C. Long-Term Experimental Evolution in Escherichia coli. I. Adaptation and Divergence During 2,000 Generations. The American Naturalist. 138, (6), 1315-1341 (1991).
  8. Bennett, A. F., Dao, K. M., Lenski, R. E. Rapid evolution in response to high-temperature selection. Nature. 346, (6279), 79-81 (1990).
  9. Bell, G. Evolutionary rescue and the limits of adaptation. Philosophical Transactions of the Royal Society B-Biological Sciences. 368, (1610), (2013).
  10. Bell, G., Gonzalez, A. Adaptation and Evolutionary Rescue in Metapopulations Experiencing Environmental Deterioration. Science. 332, (6035), 1327-1330 (2011).
  11. Bell, G., Gonzalez, A. Evolutionary rescue can prevent extinction following environmental change. Ecology Letters. 12, (9), 942-948 (2009).
  12. San Millan, A., Escudero, J. A., Gifford, D. R., Mazel, D., MacLean, R. C. Multicopy plasmids potentiate the evolution of antibiotic resistance in bacteria. Nature Ecology & Evolution. 1, 0010 (2016).
  13. Alekshun, M. N., Levy, S. B. Molecular mechanisms of antibacterial multidrug resistance. Cell. 128, (6), 1037-1050 (2007).
  14. Ochman, H., Lawrence, J. G., Groisman, E. A. Lateral gene transfer and the nature of bacterial innovation. Nature. 405, (6784), 299-304 (2000).
  15. Carattoli, A. Plasmids and the spread of resistance. Int J Med Microbiol. 303, (6-7), 298-304 (2013).
  16. Smillie, C., Garcillán-Barcia, M. P., Francia, M. V., Rocha, E. P., de la Cruz, F. Mobility of plasmids. Microbiol Mol Biol Rev. 74, (3), 434-452 (2010).
  17. San Millan, A., Heilbron, K., Maclean, R. C. Positive epistasis between co-infecting plasmids promotes plasmid survival in bacterial populations. ISME J. (2013).
  18. Stoesser, N., et al. Evolutionary History of the Global Emergence of the Escherichia coli Epidemic Clone ST131. MBio. 7, (2), (2016).
  19. San Millan, A., et al. Multiresistance in Pasteurella multocida is mediated by coexistence of small plasmids. Antimicrob Agents Chemother. 53, (8), 3399-3404 (2009).
  20. Escudero, J. A., et al. Unmasking the ancestral activity of integron integrases reveals a smooth evolutionary transition during functional innovation. Nat Commun. 7, 10937 (2016).
  21. Gibson, D. G., et al. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nat Methods. 6, (5), 343-345 (2009).
  22. Datsenko, K. A., Wanner, B. L. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci U S A. 97, (12), 6640-6645 (2000).
  23. Chaveroche, M. K., Ghigo, J. M., d'Enfert, C. A rapid method for efficient gene replacement in the filamentous fungus Aspergillus nidulans. Nucleic Acids Res. 28, (22), 97 (2000).
  24. Le Roux, F., Binesse, J., Saulnier, D., Mazel, D. Construction of a Vibrio splendidus mutant lacking the metalloprotease gene vsm by use of a novel counterselectable suicide vector. Appl Environ Microbiol. 73, (3), 777-784 (2007).
  25. Performance standards for antimicrobial susceptibility testing; 19th ed. Approved standard M100-S19. Clinical and Laboratory Standards Institute. Wayne, PA, USA. (2009).
  26. Lindsey, H. A., Gallie, J., Taylor, S., Kerr, B. Evolutionary rescue from extinction is contingent on a lower rate of environmental change. Nature. 494, (7438), 463-467 (2013).
  27. Deatherage, D. E., Barrick, J. E. Identification of mutations in laboratory-evolved microbes from next-generation sequencing data using breseq. Methods Mol Biol. 1151, 165-188 (2014).
  28. Barrick, J. E., et al. Identifying structural variation in haploid microbial genomes from short-read resequencing data using breseq. BMC Genomics. 15, 1039 (2014).
  29. Salverda, M. L., De Visser, J. A., Barlow, M. Natural evolution of TEM-1 β-lactamase: experimental reconstruction and clinical relevance. FEMS Microbiol Rev. 34, (6), 1015-1036 (2010).
  30. Ramirez, M. S., Tolmasky, M. E. Aminoglycoside modifying enzymes. Drug Resist Updat. 13, (6), 151-171 (2010).
  31. Jerison, E. R., Desai, M. M. Genomic investigations of evolutionary dynamics and epistasis in microbial evolution experiments. Current Opinion in Genetics & Development. 35, 33-39 (2015).
  32. Toll-Riera, M., San Millan, A., Wagner, A., MacLean, R. C. The Genomic Basis of Evolutionary Innovation in Pseudomonas aeruginosa. PLoS Genet. 12, (5), 1006005 (2016).
एंटीबायोटिक प्रतिरोध के विकास में Multicopy Plasmids की भूमिका का परीक्षण
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Escudero, J. A., MacLean, R. C., San Millan, A. Testing the Role of Multicopy Plasmids in the Evolution of Antibiotic Resistance. J. Vis. Exp. (135), e57386, doi:10.3791/57386 (2018).More

Escudero, J. A., MacLean, R. C., San Millan, A. Testing the Role of Multicopy Plasmids in the Evolution of Antibiotic Resistance. J. Vis. Exp. (135), e57386, doi:10.3791/57386 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter