This article presents a simple and economic protocol for the straightforward isolation and purification of mesenchymal stem cells from New Zealand white rabbit synovial fluid.
Mesenchymal stem cells (MSCs) are the main cell source for cell-based therapy. MSCs from articular cavity synovial fluid could potentially be used for cartilage tissue engineering. MSCs from synovial fluid (SF-MSCs) have been considered promising candidates for articular regeneration, and their potential therapeutic benefit has made them an important research topic of late. SF-MSCs from the knee cavity of the New Zealand white rabbit can be employed as an optimized translational model to assess human regenerative medicine. By means of CD90-based magnetic activated cell sorting (MACS) technologies, this protocol successfully obtains rabbit SF-MSCs (rbSF-MSCs) from this rabbit model and further fully demonstrates the MSC phenotype of these cells by inducing them to differentiate to osteoblasts, adipocytes, and chondrocytes. Therefore, this approach can be applied in cell biology research and tissue engineering using simple equipment and procedures.
MSCs have been suggested as a valuable source for regenerative medicine, especially for cartilage lesions. MSCs, including chondrocytes, osteoblasts, adipocytes, skeletal myocytes, and visceral stromal cells, broadly expand the areas for stem cell transplantation due to their high expansion rate and multi-lineage differentiation potential1. MSCs can be isolated from the skeletal muscle, synovium, bone marrow, and adipose tissue2,3,4. Findings have also confirmed the presence of MSCs in synovial fluid, and previous research has identified synovial fluid-derived MSCs (SF-MSCs) as promising candidates for articular regeneration5,6.
However, research and preclinical experimentation on human samples are subject to many ethical issues. Instead, rabbits have been and continue to be the most commonly used animal species to demonstrate that transplantation of MSCs can repair cartilage damage. In recent years, an increasing number of researchers have studied rabbit mesenchymal stem cells (rbMSCs) both in vitro and in vivo, as these cells are similar to human MSCs in their cellular biology and tissue physiology. Similarly, the rbMSCs are capable of adhering to plastic surfaces, displaying spindle-fibroblast morphology as in human MSCs. Furthermore, rabbit mesenchymal samples are simple and easy to obtain7. Additionally, the most crucial points are that rbMSCs express surface markers, such as CD44, CD90, and CD105, and that the multi-lineage differentiation potential is preserved, which is in agreement with the criteria for identification of MSC populations as defined by the International Society for Cellular Therapy8,9. In particular, synovial fluid chondroprogenitors are capable of non-hypertrophic chondrogenesis when induced by TGF-β1, thus making them suitable cell sources for phenotypically articular cartilage regeneration10,11,12.
However, the isolation of SF-MSCs is greatly different from other tissues, including the umbilical cord, adipose tissue, peripheral blood, and bone marrow. Currently, the most common approaches for the purification and sorting of SF-MSCs are flow cytometry and immunomagnetic bead-based sorting, although the flow cytometry method requires a specific environment and highly expensive instruments13.
This article presents a procedure for the simple and minimally invasive collection of samples of synovial fluid from New Zealand white rabbits. During the procedure, the rbSF-MSCs are stably expanded in vitro and then isolated with CD90 positive magnetic bead-based procedures. Finally, the protocol shows how to obtain MSCs with a high purity and viability from the harvested cell sources.
In this protocol, the isolated rbSF-MSCs are characterized based on their morphology, expression of specific markers, and pluripotency for stem cells. Flow cytometry-based immunophenotyping reveals a significant positive expression of CD44 and CD105, whereas the expression of CD45 and CD34 is negative. Finally, an in vitro assay for rbSF-MSCs demonstrates the osteogenic, adipogenic, and chondrogenic differentiation of these cells.
All animal experiments were conducted in accordance with the regional Ethics Committee guidelines, and all animal procedures were approved by the Institutional Animal Care and Use Committee of Shenzhen Second People's Hospital, Shenzhen University.
1. Isolate and Culture the rbSF-MSCs
2. CD90-positive Magnetic Activated Cell Sorting (MACS) of the rbSF-MSCs and Primary Culture
3. Identification of rbSF-MSCs
Isolation, Purification, and Culture of the rbSF-MSCs:
This protocol uses MACS to isolate rbSF-MSCs, based on the expression of the MSC surface marker CD90. A process flow diagram of rbSF-MSCs' isolation, purification, and characterization and the in vitro culture protocol is shown in Figure 1.
Cell Morphology after Magnetic Activated Cell Sorting (MACS) with CD90:
Firstly, for MACS, immunolabel MSCs with CD90 magnetic beads. After centrifugation, resuspend a maximum of 107 cells in 80 µL of a precooled sorting buffer, and then add 20 µL of CD90 magnetic beads, followed by vortexing and incubation at 4 °C for 15 min. After that, wash the cells with 1 mL of the sorting buffer and resuspend them in 500 µL of the sorting buffer. Before proceeding with the magnetic sorting, repeat the washing step. This critical procedure is shown in Figure 2.
Before sorting, the adherent rabbit synovial fluid cell populations displayed heterogeneous morphology, containing diverse cell types and sizes (Figure 3A-C). Following MACS, the cell populations exhibited homogenous morphology. The cell number was increased with sub-culture (Figure 3D-F).
Surface Characteristics of MACS-enriched rbSF-MSCs:
Fluorescence-Activated Cell Sorting (FACS) was performed to analyze the enrichment of rbSF-MSCs by MACS with CD90. Prior to MACS, the cell population consisted of approximately 40% MSCs (Figure 4C,D; isotype controls in Figure 4A,B). Following MACS, the enriched population contained approximately > 99% MSCs (Figure 4E,F). The hematopoietic lineage cell markers CD34 and CD45 were, at 0.318%, both rarely expressed after MACS, which is a decline from their initial expression at 25.9%.Before selection, there were about 28% CD90+ cells (Figure 4G); after purification, about 98% CD90+ cells were obtained (Figure 4H).
Multilineage Differentiation Potential of rbSF-MSCs:
To characterize the capacity of rbSF-MSCs to differentiate into the various lineages such as osteogenic, adipogenic, and chondrogenic cells, the rbSF-MSCs enriched by MACS were simultaneously cultured in a specific differentiation medium and in a differentiation medium without cytokine to serve as controls. When the induction was completed, lineage-specific markers were analyzed by staining and RT-PCR. Alizarin red staining of calcium compounds demonstrated that mineralized nodules had formed in the rbSF-MSCs after 3 weeks under the osteogenic induction conditions (Figure 5A). After 3 weeks of adipogenic induction, an accumulation of lipid-rich vacuoles could be detected by intracellular Oil Red O staining (Figure 5B). For 21 days of chondrogenic induction, the cell pellet was histologically assayed with toluidine blue staining. Cells positive for staining (to proteoglycan) were regarded as chondrocyte-like cells (Figure 5C). Similar to this result, a quantitative analysis of the gene expression of differentiation potential also proved the differentiation capability of these cells. The expression levels of Agg (a chondrocyte marker), PPARγ (an adipogenic marker), and Runx2 (an osteoblast marker) were upregulated under induced conditions. These data proved the multipotent differentiation capability of rbSF-MSCs into trilineages (Figure 5D).
Figure 1: Full schematic of isolation, purification, and characterization of the SF-MSCs of New Zealand white rabbits. Please click here to view a larger version of this figure.
Figure 2: Protocol for magnetic activated cell sorting (MACS) with CD90. Please click here to view a larger version of this figure.
Figure 3: Morphology of the monolayer cultured rbSF-MSCs before and after MACS as examined under ordinary inverted microscopy. A-C) Before sorting, the adherent rabbit synovial fluid cell populations display heterogeneity. They contain diverse cell types and sizes, such as oval, long-spindle, short-spindle, and stellate morphology. The main morphology of P2 and P6 is a spindle morphology (A: P2, B: P3, C: P6). D-F) Following MACS with CD90, the cell populations exhibit a homogenous morphology. With a sub-culture, the cell number increases (D: P2, E: P3, F: P6). Scale bar = 100 µm. Please click here to view a larger version of this figure.
Figure 4: Identification of rbSF-MSC surface markers. Using flow cytometry analysis, the rbSF-MSCs are positive for the MSC markers CD44 and CD105, while negative for the endothelial cell marker CD34 and the hematopoietic cell marker CD45. Prior to MACS, these cells have a low rate of positivity for CD44 and CD105. However, after MACS, the rate of positivity was high. A,B) These top two images show the isotype control data. C,D) These results shows that before MACS the rbSF-MSC population is composed of approximately 40% MSC cells. E,F) After MACS, the enriched population contains > 99% MSC cells. G,H) These images show the flow cytometry analysis of the CD90+ marker, (G) before and (H) after MACS sorting. Please click here to view a larger version of this figure.
Figure 5: Analysis of lineage-specific markers by staining and RT-PCR. A) Alizarin red staining demonstrates that mineralized nodules form under the osteogenic induction for 3 weeks. B) After 3 weeks of adipogenic induction, the accumulation of lipid-rich vacuoles is detected by intracellular Oil Red O staining. C) For 3 weeks of chondrogenic induction, the cell pellet was histologically assayed with toluidine blue staining. Cells positive for staining (to proteoglycan) were regarded as chondrocyte-like cells. Scale bar = 100 µm. D) After culturing for 3 weeks, the relative mRNA expression of osteoblast markers (Runx2), adipogenic markers (PPARγ), and chondrogenic markers (Agg) is detected. For all analyses, p values < 0.01 were considered as statistically significant differences using the Kruskal-Wallis test (shown as **). Please click here to view a larger version of this figure.
Genes | Forward primer (5’–3’) | Reverse primer (5’–3’) |
Runx2 | TATGAAAAACCAAGTAGCAAGGTTC | GTAATCTGACTCTGTCCTTGTGGAT |
AGG | GCTACACCCTAAAGCCACTGCT | CGTAGTGCTCCTCATGGTCATC |
PPARγ2 | GCAAACCCCTATTCCATGCTG | CACGGAGCTGATCCCAAAGT |
GAPDH | GGAGAAAGCTGCTAA | ACGACCTGGTCCTCGGTGTA |
Table 1: List of genes and primers used in this study for quantitative real-time PCR.
The existence of MSCs in synovial fluid provides an alternative for cell-based therapy. Previous studies have shown that injury sites contain higher amounts of mesenchymal stem cells in their synovial fluid, which may be positively correlated with the post-injury period5. The MSCs in synovial fluid may be beneficial to tissue for enhancing the spontaneous healing after an injury18,19. The clinical application of SF-MSCs has rarely been covered in the literature, mainly because the mechanisms of the SF-MSCs in joints remain undefined20. Jones et al.21 reported that hSF-MSC numbers in knee joints significantly increase 7-fold during the early stages of osteoarthritis (OA). They thought that the increased SF-MSCs could contribute to maintaining the physiological homeostasis of joints.
An ideal animal model is an indispensable tool in the development of therapeutics utilizing regenerative and translational medicine. Although obvious differences exist between humans and rabbits, the rabbit is extensively used as an animal model for the study of tissue regeneration7, thus prompting us to choose it as the model for our study of SF-MSCs. One of the more daunting obstacles in this endeavor is that the isolation of SF-MSCs often results in varied success rates and low colony frequencies, as reported in previous research5. Therefore, numerous researchers have focused on the success rates and optimization of the isolation of MSCs from SF.
This studyeffectively used a MACS procedure for high sorting purity and viability of CD90+ MACSs from rabbit synovial fluid22. This MACS system utilizes magnetic microbeads conjugated to highly specific antibodies coupled to a particular cell surface antigen, CD90 in this case, and allows for the selection of the particular target cell type, namely CD90 expressing cells. Before the purification with CD90 microbeads, we usually culture the primary rbSF-MSCs for 14 days. During this period, many colonies are formed in the culture dishes. This protocol suggests selecting the colonies larger than 2 mm in diameter. When using the cloning cylinder for the colony selection, we carefully observe it under the microscope. The single colony is further propagated for purification.
During the process of separation and purification, the CD90 expressing cells that were magnetically labeled are attracted by the magnetic field of the separator in the column, whereas the unlabeled cells flow through. After the washing process, the column is removed from the magnetic field of the separator, and the target cells are eluted from the column. This specific MACS microbead approach allows the isolation of rbSF-MSCs that specifically expressed the stem cell surface markers CD44 and CD105, demonstrating that these isolated cells are mesenchymal stem cells rather than hematopoietic cells23.These purified rbSF-MSCs can be cultured in vitro over a long time without any significant change of morphological features and marker expression. Moreover, the rbSF-MSCs enriched by MACS exhibit a multipotent differentiation ability into multi-lineage cells, including into chondrogenic, adipogenic, and osteogenic cells.
The operation of MACS is an easy-to-perform protocol and can be done on the bench23. Additionally, the US Food and Drug Administration (FDA) has approved the MACS microbead-based technology, and thus it is easy to perform for clinical applications24. CD90 is a surface marker of mesenchymal stem cells, and researchers have shown that CD90 positive MSCs have a better chondrogenic differentiation ability25,26. The pluripotency of MSCs has been characterized based on morphology and the expression of specific markers for stem cells27.
This study does have several limitations. The first shortcoming of this protocol is related to the surface markers we examined. Based on a statement by the International Society for Cellular Therapy (ISCT), the minimal criteria for defining multipotent MSCs is positive for CD90, CD105, CD44, and CD73, and negative for CD11b, CD14, CD34 or CD45, and CD79a or HLA-DR28. With the goal of mitigating the effort and expense required to test the entire panel, researchers in this study carefully selected two of the negative markers and two of the positive markers recommended. Secondly, it takes a long time to form the colonies that will be selected for further study. In addition, hypertrophy is a major problem during chondrogenic induction of SF-MSCs in vitro. At the later stage, the hypertrophic chondrocytes always express type X collagen (COLX), matrix metalloproteinase 13 (MMP13), alkaline phosphatase (ALP), and runt-related transcription factor 2 (Runx2)29.Research suggests that the three-dimensional (3D) pellet culture, dynamic culture systems, and the coculture with chondrocytes are benefit for MSC stably chondrogenic differentiation30,31. In this study, a pellet culture system was used for chondrogenic induction of MSC to avoid hypertrophy.
In conclusion, we have established a simple method for the isolation and purification of MSCs from the articular cavity flushing fluid and characterized the MSCs obtained therein. This protocol has provided a platform for the exploration and investigation of articular synovial fluid-derived MSCs' potential utility in novel joint regeneration strategies.
The authors have nothing to disclose.
This study was financially supported by the following grants: the Natural Science Foundation of China (No. 81572198; No. 81772394); the Fund for High Level Medical Discipline Construction of Shenzhen University (No. 2016031638); the Medical Research Foundation of Guangdong Province, China (No. A2016314); and Shenzhen Science and Technology Projects (No. JCYJ20170306092215436; No. JCYJ20170412150609690; No. JCYJ20170413161800287; No. SGLH20161209105517753; No. JCYJ20160301111338144).
Reagents | |||
MesenGro | StemRD | MGro-500 1703 | Warm in 37 °C water bath before use |
MesenGro Supplement | StemRD | MGro-500 M1512 | Component of MSCs culture medium |
DMEM basic | Gibco Inc. | C11995500BT | MSCs differentiation medium |
Isotonic saline solution | Litai, China | 5217080305 | Cavity arthrocentesis procedure reagent |
Phosphate-Buffered Saline (PBS) | HyClone Inc. | SH30256.01B | PBS, free of Ca2+/Mg2+ |
Fetal Bovine Serum (FBS) | Gibco Inc. | 10099-141 | Component of MSCs culture medium |
Povidone iodine solution | Guangdong, China | 150605 | Sterilization agent |
75% ethanol | Lircon, china | 170917 | Sterilization agent |
0.25% Trypsin/EDTA | Gibco Inc. | 25200-056 | Cell dissociation reagent |
1% Penicillin-Streptomycin | Gibco Inc. | 15140-122 | Component of MSCs medium |
MACS Running Buffer | MiltenyiBiotec | 5160112089 | Containing phosphate-buffered saline (PBS), 0.5% bovine serum albumin(BSA), and 2 mMEDTA |
CD90 antibody conjugated MicroBeads | MiltenyiBiotec | 5160801456 | For magnetic activated cell sorting |
Sodium pyruvate | Sigma-Aldrich | P2256 | Component of MSCs chondrogenic differentiation |
Dexamethasone | Sigma-Aldrich | D1756 | Component of MSCs osteogenic differentiation |
ITS | BD | 354352 | 1%, Component of MSCs chondrogenic differentiation |
L-proline | Sigma-Aldrich | P5607 | 0.35 mM, Component of MSCs chondrogenic differentiation |
L-ascorbic acid-2-phosphate | Sigma-Aldrich | A8960 | 50 mM, Component of MSCs chondrogenic differentiation |
3-isobutyl-1-methylxanthine | Sigma-Aldrich | I5879 | 0.5 mM, Component of adipogenic differentiation |
Indomethacin | Sigma-Aldrich | I7378 | 100 mM, Component of adipogenic differentiation |
TGFβ1 | Peprotech | 100-21 | 10 ng/mL, Component of MSCs chondrogenic differentiation |
α-glycerophsphate | Sigma-Aldrich | G6751 | Component of MSCs osteogenic differentiation |
CD34 Polyclonal Antibody, FITC Conjugated | Bioss | bs-0646R-FITC | Hematopoietic stem cells marker |
Mouse antirabbit CD44 | Bio-Rad | MCA806GA | Thy-1 membrane glycoprotein (MSCs marker) |
CD45 (Monoclonal Antibody) | Bio-Rad | MCA808GA | Hematopoietic stem cells marker |
CD105 antibody | Genetex | GTX11415 | MSCs marker |
Isopropyl alcohol | Sigma-Aldrich | I9030 | Precipitates RNA extraction organic phases |
Trichloromethane | Wenge, China | 61553 | Extract total RNA |
Trizol | Invitrogen | 15596-018 | Isolate total RNA |
SYBR green master mix | Takara Bio, Japan | RR420A | PCR test |
cDNA synthesis kit | Takara Bio, Japan | RR047A | Reverse-transcribed to complementary DNA |
Alizarin Red | Sigma-Aldrich | A5533 | Staining of calcium compounds |
Toluidine Blue | Sigma-Aldrich | 89640 | Staining of cartilaginous tissue |
Oil Red O solution | Sigma-Aldrich | O1391L | Lipid vacuole staining |
Equipment | |||
MiniMACS Separator | MiltenyiBiotec | 130-042-102 | For magnetic activated cell sorting |
MultiStand | MiltenyiBiotec | 130-042-303 | For magnetic activated cell sorting |
MS Columns | MiltenyiBiotec | 130-042-201 | For magnetic activated cell sorting |
Cell Strainer | FALCON Inc. | 352340 | 40 μm nylon |
Hemocytometer | ISOLAB Inc. | 075.03.001 | Cell counting |
Falcon 100 mm dish | Corning | 353003 | Cell culture dish |
Microcentrifuge tube | Axygen | MCT-150-C | RNA Extraction and PCR |
Centrifuge Tubes | Sigma-Aldrich | 91050 | Gamma-sterilized |
High-speed centrifuge | Eppendorf | 5804R | Centrifuge cells |
Carbon dioxide cell incubator | Thermo scientific | 3111 | Cell culture |
Real-Time PCR Instrument | Life Tech | QuantStudio | Real-Time quantitative polymerase chain reaction |
Flow cytometer | BD Biosciences | 342975 | Cell analyzer |
Pipettor | Eppendorf | O25456F | Transfer the liquid |
Cloning cylinder | Sigma-Aldrich | C3983-50EA | Isolate and pick individual cell colonies |
Sterile hypodermic syringe | Double-Dove, China | 131010 | Arthrocentesis procedure |
Rabbit cage | Zhike, China | ZC-TGD | Restrain the rabbit |