Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biochemistry

Идентификация Циклин зависимая киназа 1 сайты конкретных фосфорилирование киназы в Vitro пробирного

doi: 10.3791/57674 Published: May 3, 2018
* These authors contributed equally

Summary

Циклин зависимая киназа 1 (Cdk1) активируется в G2 фазе клеточного цикла и регулирует многие сотовых пути. Здесь мы представляем протокол assay киназы в пробирке с Cdk1, который позволяет идентифицировать Cdk1-конкретных фосфорилирование сайтов для создания клеточных мишеней этой важной киназы.

Abstract

Циклин зависимая киназа 1 (Cdk1) представляет собой главный контроллер для клеточного цикла в всех эукариот и фосфорилирует оценкам 8-13% протеома; Однако количество выявленных целей для Cdk1, особенно в клетках человека по-прежнему низка. Определение участков фосфорилирование Cdk1-конкретных важно, как они обеспечивают механистический понимание как Cdk1 управляет клеточного цикла. Регуляции клеточного цикла имеет решающее значение для верующих хромосома сегрегации, и дефекты в этот сложный процесс приведет к хромосомных аберраций и рака.

Здесь мы описываем в vitro киназы assay который используется для идентификации конкретных Cdk1 фосфорилирования сайтов. В этот assay, очищенный белок является фосфорилированных в пробирке , коммерчески доступных человека Cdk1/циклин B. успешный фосфорилирование подтверждается SDS-PAGE, и впоследствии фосфорилирование сайты идентифицируются по масс-спектрометрии. Мы также описывают протоколы очищения, которые дают очень чистые и однородные белковых препаратов для assay киназы и пробирного привязки для функциональной проверки выявленных фосфорилирования сайтов, которые исследует взаимодействие между Классическая ядерной локализации сигнал (cNLS) и его перевозки ядерных рецепторов karyopherin α. Для помощи с экспериментального дизайна, мы рассматриваем подходы для прогнозирования фосфорилирование Cdk1-конкретных сайтов от белковых последовательностей. Вместе эти протоколы представляют очень мощный подход, который дает фосфорилирование Cdk1-конкретных сайтов и позволяет механистический исследования в как Cdk1 управляет клеточного цикла. Поскольку этот метод опирается на очищенные белки, может применяться к любой модели организма и дает надежные результаты, особенно в сочетании с функциональных исследований клеток.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Киназы являются ферменты, которые регулируют многие клеточные процессы и передачи фосфатные группы от АТФ на субстраты. Этот фосфорилирование является обратимым, быстро, добавляет два отрицательными зарядами и хранит свободной энергии и является одним из наиболее распространенных Посттрансляционная изменений используется клетками. Cdk1, который также известен как гомолога белка 2 цикла деления клеток (cdc2) — это главный контроллер для клеточного цикла в всех эукариот1,2,3,4,5и фосфорилирует оценкам, 8-13% протеома6,7.

Хотя последние протеомических исследований выявили многие сайты фосфорилирование белков, в большинстве случаев, ответственных за эти изменения киназы неизвестна. Количество известных Cdk1 целевые показатели, особенно в клетках человека является низкий7. Определение участков фосфорилирование Cdk1-конкретных имеет важное значение, как он позволяет механистический исследования, которые устанавливают, как Cdk1 управляет клеточного цикла. Регуляции клеточного цикла важно для верных хромосома сегрегации и деление клеток, и множество клеточных процессов должны произойти для поддержки этой важной физиологические функции. Это включает в себя прекращение транскрипции и трансляции до начала митоза, а также драматические реорганизации в клеточной структуры и организации, например разборка ядерная оболочка, конденсация хромосом и митотического шпинделя собраний. Ошибки в этих процессах и дерегулирование вызывают рак, врожденные дефекты или митотическая клеточной смерти. Специфичные ингибиторы Cdk1 как RO-3306 были развитыми8, которые обеспечивают мощные инструменты для функциональных исследований, и некоторые из этих ингибиторов в настоящее время в клинических испытаниях для лечения рака (см.9 для обзора).

Здесь мы описываем в vitro киназы assay который позволяет идентифицировать фосфорилирование Cdk1-конкретных сайтов. В этот assay коммерчески доступных человека Cdk1/циклин B используется для фосфорилировать очищенный целевого белка в пробирке. Фосфорилирование субстрата увеличивает его массы и добавляет два негативных обвинения; Таким образом успешные фосфорилирование подтверждается сдвигу вверх группы гель белка на SDS-PAGE. Впоследствии фосфорилирование Cdk1-конкретные сайты идентифицируются по масс-спектрометрии анализа белка в vitro фосфорилированных. Для помощи с экспериментального дизайна, мы также обзор вычислительных средств и ссылки для прогнозирования фосфорилирование Cdk1-конкретных сайтов из последовательности белка. Кроме того мы также описывают протоколы очищения, которые дают очень чистые и однородные белковых препаратов подходит для assay киназы. Наконец выявленных фосфорилирование сайты должны быть проверены на функциональные исследования, и простой привязки пробирного описан здесь для этой цели. Комбинированные, это очень мощный подход, который дает фосфорилирование Cdk1-конкретных сайтов и позволяет механистический исследования в как Cdk1 управляет клеточного цикла7,10,11. Поскольку этот метод опирается на очищенных белков, он может применяться к любой модели организма и дает надежные результаты. Однако, рекомендуется функциональной верификации полученных фосфорилирование сайтов в пробирке , поскольку клетки имеют дополнительные механизмы регулирования в месте, например Посттрансляционная модификаций, взаимодействия партнеров или клеточной локализации, может сделать фосфорилирование сайты доступными или недоступными для признания Cdk1.

Cdk1 признает консенсус фосфорилирование сайт, который состоит из (Ser/Чет-Pro-X-Lys/Arg), где X — это остатки и серина или треонин сайт фосфорилирования. Особенно важное значение для признания является наличие пролина в положении + 1. Кроме того, основные остатков предпочтительны в позиции + 2 и + 3, большинство сайтов фосфорилирование Cdk1-конкретным, содержащий Lys или Arg на + 3 позиция6,12.

Активация Cdk1 жестко регулируется и приводит к возникновению митоз1,2,3,4,5. Деятельность циклин зависимых киназ в целом зависит от их ассоциации с собственный циклинов (циклин A, B, C, D и E в организме человека), которые выражаются в колебательных уровнях на протяжении клеточного цикла13. Выражение Cdk1 является постоянным по всей клеточного цикла и регулирование своей деятельности опирается на его связь с нормативной субблоков циклин A и циклин B5,13,14,15, как Ну как столб-поступательные изменения. Формирование комплекса Cdk1/циклин B требуется для киназы активации5,14,,1516,17,18. В G2 фазе циклин B переведен в цитозоле и импортированы в ядре, где он привязывается к Cdk15,14,,1516,17,18; Однако Cdk1/циклин B проводится инактивированных фосфорилирования в остатки Thr14 и Tyr15 на человека Cdk1-тормозящий киназы Myt1 (связанный мембранами перст-тирозин треонин конкретных и cdc2-тормозящий киназы) и Wee1, соответственно19, 20,21. В конце фазы G2 дефосфорилирование Thr14 и Tyr15 путем деления клеток цикла 25 фосфатазы (cdc25) активизирует деятельность киназы Cdk1/циклин B комплекса и инициирует начало митоз12,14, 18 , 20 , 22 , 23. фосфорилирование Thr161 также необходим для активации Cdk1/циклин B и опосредовано Cdk7, Cdk активации киназы (ЦАК)18. Деградации циклин b в анафазе инактивирует Cdk1, позволяя выход из митоз24,25. Активация Cdk1/циклин B поэтому является сложным процессом. Протокола, представленные здесь выполняется с коммерчески доступных Cdk1/циклин б. В ходе рекомбинантных выражение этого комплекса в клетках насекомых это активированные в vivo эндогенного киназы14,20 и остается активным в состоянии очищенных. Итоговый активная, рекомбинантного человеческого Cdk1/циклин B подходит для в vitro киназы анализов.

Здесь мы описываем протокол для идентификации конкретных Cdk1 фосфорилирования сайтов в человека центромер протеина F (CENP-F)10. CENP-F это Кинетохор белок, который проживает в ядре в течение большей части межфазовые изолирующие (G1 и S-фазы) и экспортируется в цитозоль в G2 фазе26,27,28 Cdk1-зависимых образом10, 11. ядерной локализации присуждается двудольных жизнь26. cNLSs распознаются α karyopherin фактор ядерного транспорта, который облегчает, вместе с karyopherin β и RanGDP, импорт жизнь грузов в ядро29. Ядерного экспорта в G2 фазе обеспечивается через путь неизвестным экспорта10. После того, как CENP-F находится в цитозоле, он нанят для того, чтобы ядерная оболочка и в свою очередь набирает30,комплекс Динеин двигательные белки31. Этот путь имеет важное значение для позиции соответствующих Центросома ядро на начальных стадиях митотического шпинделя Ассамблеи образом Динеин зависимых, который имеет важное значение для правильного времени митотическая входа и основных процессов в мозге развития30,,3132. Начиная с этапа G2, CENP-F является также смонтирован в Кинетохор где он имеет важную роль для верных хромосома сегрегации27,28,33,34,35 . Ключевым шагом регулирования этих путей является ядерным экспортом CENP-F в G2 фазе, которая зависит от Cdk110,11. Мы здесь описать протокол для идентификации Cdk1-конкретных сайтов фосфорилирования в жизнь CENP-F. Phosphomimetic перегласовок этих сайтов замедлить ядерного импорта CENP-f, предполагая, что Cdk1/циклин B непосредственно регулирует клеточной локализации CENP-F, фосфорилирование его жизнь10.

В целом этот assay в vitro киназы позволяет выявлять конкретные субстраты для киназы Cdk1. очищенные целевых белков, фосфорилированных в vitro коммерчески доступных Cdk1/циклин B комплекс и фосфорилирование сайты Впоследствии идентифицируются по масс-спектрометрии. Определение участков фосфорилирование Cdk1-конкретных поддерживает механистический исследования, которые показывают, как Cdk1 управляет клеточного цикла.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Прогнозирование фосфорилирование Cdk1-конкретных сайтов из последовательности белка

  1. Перед началом assay киназы, анализа последовательности белка для предсказал Cdk1-конкретных сайтов фосфорилирования и поиск литературы для экспериментально установленном фосфорилирование сайтов с неизвестным киназы специфичности. Используйте следующие инструменты базы данных и ссылки, которые кратко излагаются.
    1. Используйте для прогнозирования Cdk1-конкретных фосфорилирование сайтов в последовательности белка iGPS 3.0 программного обеспечения36,37 (http://gps.biocuckoo.org/online_full.php). Для комплексного прогнозирования, которая включает аннотации вторичной структуры и поверхности доступности, используйте ссылку здесь.
    2. В программном обеспечении введите последовательность белка в формате FASTA. Для киназы специфичности проверьте Серин/треонин киназу, ЧГГК, CDK, CDC2, CDK1и снимите все другие особенности. Выберите носитель как порог и нажмите кнопку Отправить .
    3. Сравните результирующие предсказал сайтов с сайта Cdk1, фосфорилирование консенсуса (Ser/Чет-Pro-X-Lys/Arg).
    4. Главное проверьте предсказал сайт для proline рядом с фосфорилированных остатков (некоторые Cdk1 субстратов фосфорилированных минимальной сайта (Ser/Чет-Pro)6,12). Кроме того проверьте основные остатков, которые предпочтительны в + 2 или + 3 позиции, с большинством сайтов фосфорилирование Cdk1-конкретным, содержащий Lys или Arg в положение + 36,12.
  2. Также проверьте, что сайт доступен для распознавания, как наличие полного консенсуса сайта не является достаточным для Cdk1 фосфорилирования.
    1. Проверка поверхности доступность и вторичная структура предсказание аннотации на выходе iGPS, которой говорится ли сайт предсказал, чтобы быть доступными; N - и C-Термини белков, во многих случаях гибким и доступным для фосфорилирования.
    2. Если рентген структура целевого белка, проверьте доступность предполагаемого фосфорилирование сайтов, проверяя их расположение в структуре.
  3. Поиск литературы для экспериментально установленном фосфорилирование сайтов с неизвестным киназы специфичности, с использованием базы данных UniProtKB/Swiss-Prot38 (http://www.uniprot.org).
    1. Введите имя белка в поле поиска и нажмите на кнопку Поиск . Выберите запись в правильной последовательности. Фосфорилирование сайты аннотацией и ссылки в разделе изменения аминокислоты .
    2. Поиск для протеомики исследования митотическая экстрактов клетки человека линии7,,3940, которые особенно полезны, потому что Cdk1 становится активным в G2 фазе клеточного цикла.
  4. Определите двудольных жизнь по NLSmapper (опционально).
    Примечание: Для белков, которые Трансфер между цитозоле и ядро, общий механизм для регулирования клеточной локализации является фосфорилирование двудольных жизнь в положении-1 основной мотив, Cdk1. Фосфорилирование отменяет ядерной локализации в G2 фазе10,41,42,-43.
    1. Для таких челночные белков идентифицировать жизнь в последовательности белка NLSmapper43 (http://nls-mapper.iab.keio.ac.jp/cgi-bin/NLS_Mapper_form.cgi). Вставьте последовательности белка как текст в поле последовательность, выберите счет отключения 5.0 и избрать для поиска NLS в весь регион. Нажмите на кнопку Предсказать NLS .
    2. Сравните результирующие предсказал жизнь против консенсуса последовательность двудольных жизнь, которая состоит из мелких мотив (Lys-Arg), компоновщик по крайней мере 10 остатков и основной мотив (Lys-Lys/Arg-X-Lys/Arg), где X — это любой остаток, который негативно не взимается .
    3. Проверьте, если прогнозируемый сайт фосфорилирование Cdk1 (*) расположен рядом с основным мотивом в-1 положение компоновщик: Ser/Thr*-Pro/X-X-Lys-Lys/Arg-X-Lys/Arg.
      Примечание: Фосфорилирование двудольных жизнь в положении-1, Cdk1 был создан как механизм регулирования для клеточной локализации для нескольких челночные белков10,,4142, 43.

2. выражение в Escherichia Coli рекомбинантных белков

  1. Используйте выражение плазмиды от 2.1.1-2.1.2 шаги для выражения рекомбинантных белков в E. coli.
    1. Чтобы создать человеческое выражение CENP-F (остатки 2987-3,065) построить, генерировать вставки путем усиления фрагментов ДНК полимеразной цепной реакции (ПЦР) из полнометражных конструкцию CENP-F (GenBank присоединение: U19769.1). Используйте следующие грунты: AGTCGGGGATCCCAGCAATCTAAACAAGATTCCCG и AGTCGGCTCGAGTCATTATTCTGCAGGGTGAATACCACTCATG.
      Примечание: Полнометражные человека плазмида CENP-F был щедро предоставляемые доктор X. Чжу, институты для биологических наук, Китайская академия наук, Шанхай, Китай.
      1. Клон insert в вектор pGEX6p1 с BamHI и XhoI места ограничения. Используйте этот плазмида выразить N-терминальный глутатион S-трансферазы (GST) синтез белков CENP-F (остатки 2987-3,065).
        Примечание: GST-тег может быть расщепляется покинуть PreScission протеазы (далее PS протеазы).
    2. Для человека построить выражение karyopherin α, генерировать вставки путем усиления фрагментов ДНК методом ПЦР из шаблона cDNA α2 полнометражные karyopherin (последовательность присоединение NM_002264.3; грунты: GCACTACATATGTCCACCAACGAGAATGCTAATA и TCACGCCTCGAGTTATCAAAAGTTAAAGGTCCCAGGAGCC).
      Примечание: Из-за схожести изоформ, эта конструкция α2 karyopherin именуется в последующем тексте karyopherin α.
      1. Клон вставки в pET28a-пре вектор с места ограничения NdeI и XhoI.
        Примечание: Это изменение pET28a вектор, в котором последовательности кодирования для сайта расщепления тромбина была заменена последовательность, которая кодирует для сайта расщепления протеазы Л.С. Используйте этот плазмида выразить синтез белка α karyopherin с N-терминальный его6-тег, где его6-тег можно расщепляется покинуть на PS протеазы.
  2. Выполните для создания точечные мутации целевого белка, сайт направленного мутагенеза с комплектом.
  3. Экспресс рекомбинантных белков в E. coli для последующей очистки.
    1. Сделать следующие акции: канамицин 50 мг/мл (1:1, 000 Стоковый раствор), хлорамфеникол 35 мг/мл в 70% этаноле (1:1, 000), 100 мг/мл ампициллин (1:1, 000) и 1 M изопропиловый β-D-1-тиогалактопиранозид (ИПТГ; 1:5, 000).
    2. Стерильными фильтр запасов и хранить при температуре от-20 ° C. Избегайте повторного замораживания оттаивания циклов для IPTG.
    3. Преобразование 1 мкл выражение плазмида в 50 мкл компетентных клеток pLysS штамма кишечной палочки Rosetta 2 (DE3), согласно инструкциям производителя.
    4. Пластина культуры на Бертани Лурия (LB) агар с хлорамфениколом (35 мкг/мл фунтов) и ампициллин (100 мкг/мл LB) для конструкции CENP-F, или хлорамфеникола и канамицин (50 мкг/мл культуры) для karyopherin α конструкции. Инкубировать пластины для 12-20 ч при 37 ° C.
    5. Выбрать один колонии и прививать 50 мл LB дополнена антибиотиков (см. шаг 2.3.4). Инкубировать preculture при встряхивании в 160-180 об/мин для 12-20 ч при 37 ° C.
    6. Подготовка 1 Л фунт средних в 2,800 мл озадаченного Fernbach колбу. Сделать два колбы для каждого preculture и автоклав их. Чтобы разрешить аэрации, не заполняйте колбы для более чем две трети объема колбы. Эрленмейер колбы могут использоваться также.
    7. Добавить антибиотики (шаг 2.3.4) и 10 мл раствора глюкозы 40% (w/v), стерильной фильтрации, на 1 Л охлаждением LB. добавить 20 мл preculture на 1 Л LB среды.
      Примечание: Поглощение на 600 Нм при 1:10, разведение preculture должна быть в пределах 0,15-0,2.
    8. Инкубировать колбы при встряхивании в 160-180 об/мин при температуре 37 ° C. Измерение оптической плотности на 600 Нм культуры бактерий регулярно. Если поглощение достигает 0,5-0,6, побудить выражение протеина путем добавления 0,2 мм ИПТГ (200 мкл акций 1 М на 1 Л среды LB).
      Примечание: Важно, что клетки наведены на правильной оптической плотности. Обычно это занимает 3-4 ч до достижения этой стадии.
    9. Инкубировать колбы при встряхивании за 3 ч при 37 ° C. Урожай клетки центрифугированием (15 мин, 4100 x g, 4 ° C, поворотно откидные ротора). Выбросите супернатант. Ресуспензируйте клетки окатышей в 20 мл GST-привязки буфера (CENP-F) или его6-привязки буфера (karyopherin α) на 1 Л культуры. Хранить клетки на-80 ° C.
      1. Подготовьте GST-привязки буфера (10 мм трис рН 8,0 при 25 ° C, 150 мм NaCl, 1 мм Дитиотреитол (DTT), ЭДТА 0,5 мм) и его6-привязка буфера (10 мм трис рН 8,0 при 25 ° C, 250 мм NaCl, 5 мм имидазола рН 8,0, 5 мм β-меркаптоэтанол (BME)) заранее.

3. Очистка Рекомбинантный белок глутатион аффинной хроматографии и фильтрации геля

  1. Сделать следующие акции: 1 M DTT (1:1, 000 акций, стерильные отфильтрованы с 0,2 мкм поры и дегазации); Фторид phenylmethylsulfonyl 250 мм (PMSF; 1:1,000 складе диметилсульфоксид). Хранить при температуре от-20 ° C. Избегайте повторного замораживания оттаивания циклов.
  2. Сделать следующие буферы и охладить их до 4 ° C.
    1. Подготовьте GST-привязки буфера с помощью 10 мм трис рН 8,0 при 25 ° C, 150 мм NaCl, 1 DTT, ЭДТА 0,5 мм.
    2. Подготовьте GST-Элюирующий буфер с помощью 10 мм уменьшена глутатиона (0,15 г/50 мл) растворяют в буфере 50 мм трис рН 8,0 при 25 ° C, 150 мм NaCl, 1 DTT. Убедитесь, что pH окончательного буфера 8.0 и использовать в тот же день, когда он был сделан.
    3. Подготовьте гель фильтрации буфера с помощью 20 мм трис pH 7.5 при 25 ° C, 60 мм NaCl, 2 DTT. Стерильными фильтр буфер с фильтром бутылку Топ (размер пор 0.2 мкм). Дега буфера под вакуумом (-6 psi) для 15 минут помешивая.
    4. Добавьте все выше буферов DTT в день использования.
  3. Оттепель клетки от раздела 2, которые содержат CENP-F конструкции. Отрегулируйте громкость до 40 мл с буфером GST-привязки. Добавить 1 мм DTT, 0,25 мм PMSF, 0.5 мм ЭДТА (0,5 М раствор, рН 8,0), 7 мг benzamidine гидрохлорид (1 мм) и 40 мг нота ре/l-метионина.
    Примечание: Чтобы уменьшить протеолитических деградации, выполните все шаги при температуре 4 ° C, предпочтительно в холодной комнате, если не указано иное. Держите клетки, лизатов и очищенный протеин фракций на льду во все времена и добавить ингибиторов протеазы. Для предотвращения окисления остатков цистеина и метионина, добавьте восстановителях, таких как DTT и метионина в день эксперимента. Чтобы уменьшить протеолитических деградации, работайте через шаги быстро.
  4. Lyse клетки в sonicator как следует. Заполнить стакан стеклянный с lysate и погружать в ванну воду со льдом. Sonicate культура (1 мин 40 s, на 100 W (50%) / амплитуда выходного, с 10 s импульсов и 10 s отдыха циклов). Добавьте 250 мкм PMSF после sonication. Осмотрите lysate клетки, который должен выглядеть более прозрачным и больше не быть вязкой.
  5. Четкие lysate центрифугированием в 12 000-40 000 x g, 25 мин, 4 ° C. Использование раунд дно пробирок и фиксированный угол ротора.
  6. Выполняют уравновешивания , добавив 2 мл глутатион агарозы 1:1 шлама к столбцу одноразовые хроматографии. Результирующий столбец будет иметь объем 1 мл. Промойте колонку с 25 мл ультрачистая вода и 25 мл буфера GST-привязки.
  7. Выполняйте привязку . Работая в холодной комнате или холодной, сцеживаться lysate от гранул. Фильтр lysate (размер пор 0.2 мкм) и вылейте на столбце подключен. Кепи столбце и проинкубируйте его во время нежно nutating за 30 мин при 4 ° C.
  8. Мыть столбце, положить его на стойку, пусть смолы урегулировать и собирать через поток. Промойте колонку дважды с 25 мл буфера GST-привязки.
  9. Элюировать протеолитического расщепления.
    1. Подключите этот столбец. Добавьте 400 мкл буфера GST-привязки и 250 мкл PS протеазы (2 мг/мл складе с активностью 1000 U/мг, либо очищенный в лаборатории или приобрели; см. Таблицу материалы).
    2. Cap столбце и слегка взболтать Ресуспензируйте смолы в буфере. Инкубировать столбцы для 16-20 ч при 4 ° C. Затем добавьте 4 мл буфера GST-привязки элюировать proteolytically рассеченного CENP-F фрагмент из столбца.
  10. Глутатион элюции
    1. Подключите колонки, добавить 4 мл GST-Элюирующий буфер (4 столбца томов) и проинкубируйте втечение 10 мин элюировать привязанного GST-тег. Соберите элюата. Восстановите столбцы до повторного использования как описано заводом-изготовителем.
  11. Анализируйте PS протеазы элюции дроби и фракция элюции глутатиона, SDS-PAGE на 16% акриламида гели. Провести электрофорез на 25 V/см 45 мин пятно гелей Кумасси голубой. Фракция протеазы PS будет содержать фрагмента очищенный CENP-F, в то время как глутатион фракция будет содержать рассеченного GST-тег. Осмотрите гель для оценки эффективности протеолитического расщепления.
  12. Концентрат PS протеазы элюата до 0,5 мл с помощью центробежного фильтра единиц с молекулярной массой 3 кДа отсечки (см. Таблицу материалы). Добавьте элюата в верхнем отсеке фильтра и центрифуги с шагом в 10-15 мин на 4100 x g, 4 ° C (ротор) сосредоточиться образца. Смешайте закупорить после каждого приращения.
  13. Подключите подходящий гель колонке фильтрации (см. Таблицу материалов для приобретения информации) к системе жидкостной хроматографии (ПСОК) быстро белок и сбалансировать с объемом 1 колонка гель фильтрации буфера.
  14. Центрифуга для концентрированных CENP-F фрагмент в microcentrifuge (20 мин, 21 700 x g, 4 ° C). Inject образца на столбце а элюировать объемом 1 колонка гель фильтрации буфера. Сбор фракций 0,6 мл.
    Примечание: В буфер фильтрации геля оптимизирована для совместимости с последующим киназы assay. Тест, если целевой белок является стабильным в этом буфере. Если это не стабильная, попробуйте добавить больше хлорида натрия.
  15. Анализируйте пик фракций, SDS-PAGE (шаг 3.11). Бильярд пик фракций, которые содержат чисто CENP-F фрагментов. Концентрат очищенный фрагменты CENP-F до 3,3 мг/мл (шаг 3.12). Анализируйте очищенный фрагменты CENP-F, SDS-PAGE (шаг 3.11).
  16. Определение концентрации белка
    1. Разбавьте 1: 100 образцов в ультрачистая вода и поместите его в кварцевых микро кювета. Запись спектров в диапазоне длин волн 220-300 Нм в спектрофотометре.
      Примечание: C концентрация белка (мг/мл) является производным от следующего уравнения:
      Equation
  17. Сделать 50 мкл аликвоты очищенный протеин в 0,5 мл пробирок и флэш замораживание в жидком азоте. Хранить аликвоты-80 ° c.

4. Очистка рекомбинантных белков хромотографией сродства Ni НТА

  1. Сделать следующие буферы и охладите до 4 ° C.
    1. Подготовка его6-привязки буфера с помощью 10 мм трис рН 8,0 при 25 ° C, 250 мм NaCl, 5 мм имидазола рН 8,0, 5 мм БМЭ. Добавьте BME все буферы в день использования.
    2. Подготовка его6-мыть буфера так же, как его6-привязки буфера, но с использованием 20 мм имидазола.
    3. Подготовка его6-Элюирующий буфер таким же образом как буфер привязки, но с использованием 150 мм имидазола.
  2. Оттепель клетки от раздела 2, которые содержат karyopherin α построить и настроить громкость до 40 мл с его6 -привязки буфера. Добавьте 5 мм BME, 0,250 мм PMSF, 7 мг benzamidine гидрохлорид (1 мм) и 40 мг нота ре/l-метионина.
    1. Действуйте, как описано в шагах 3.4-3.8 с следующие варианты: использовать его6-привязки буфера вместо GST-привязки буфер для всех шагов. Вместо того чтобы агарозы глутатион, используйте 4 мл сродства никеля гель (см. Таблицу материалы), чтобы столбец, который будет иметь столбец объемом 2 мл.
      Примечание: Никель сродство столбцы несовместимы с DTT и ЭДТА. Вместо геля сродства никеля, Ni2 +- Нитрилотриуксусная кислота (НТА) агарозы может использоваться, если концентрация имидазола в Элюирующий буфер увеличен до 250 мм (см. Таблицу материалы).
  3. Мыть столбцы с 8 мл его6-мыть буфера.
  4. Elute karyopherin α с 12 мл его6-Элюирующий буфер и анализировать элюата путем SDS-PAGE (шаг 3.11).
  5. Добавить 250 мкл PS протеазы (шаг 3.9) к элюата и проинкубируйте 16-20 ч при 4 ° C. В то же время, dialyze элюата дважды против 1 Л его6-привязки буфер для 2-20 h, с помощью диализа мембраны с 6-8 кДа молекулярной массой отсечки.
  6. Регенерировать столбце геля сродства никеля как описано заводом-изготовителем. Сбалансировать столбец с 25 мл его6-привязки буфера. Добавьте в столбец dialyzed белка и выполнить Шаг привязки , как описано в шаге 3.7.
  7. Собирать через поток, который содержит очищенный karyopherin α (с его6-тег расщепляется выкл) и элюировать оставшиеся белок с еще 4 мл его6-привязки буфера. Бассейн этих фракций. Затем элюировать столбцы с 12 мл его6-Элюирующий буфер. Эта фракция содержит примеси.
  8. Анализ uncleaved и рассеченного karyopherin α от шагов 4.4-4.5 и две элюции дроби от этого шага, SDS-PAGE (шаг 3.11) для оценки эффективности его6-тег расщепления и чистоты.
  9. Концентрат karyopherin α 8 мг/мл и флэш замораживание в жидком азоте (шаги 3.15 3.17).

5. в Vitro киназы проба с Cdk1/циклин B

  1. В vitro пробирного киназы
    Примечание: По прибытии киназы, сделать небольшой аликвоты, флэш заморозить их в жидком азоте и хранить их в-80 ° C. Использовать в течение 6 месяцев. В то время, как молекулярная масса 34 кДа для Cdk1 и 48 кДа для циклин B, очевидной молекулярная масса циклин B на SDS-PAGE находится около 60 кДа.
    1. Подготовка 10 x PK буфера (поставляется с киназы) с помощью 0.5 М трис-HCl, 0,1 М MgCl2, 1 мм ЭДТА, 20 мм DTT, 0,1% 35 Бридж, pH 7.5 при 25 ° C.
    2. Подготовка 10 x СПС фондовой: Сделайте раствор 4 мм АТФ в 1 x PK буфер и проверить окончательные рН акций. Хранить в небольших аликвоты при-20 ° C и избежать циклов замораживания оттаивания.
    3. Смесь 40 мкл CENP-F фрагмент (в концентрации 3,3 мг/мл, или 400 мкм), 6 мкл 10 x буфер PK, 3 мкл ультрачистая вода, 6 мкл АТФ 10 x фондовых и 5 мкл человека Cdk1/циклин B (1 мкг, 100 ед) в 0,5 мл микропробирок.
      Примечание: CENP-F фрагмент имеет Молярная масса 8.6 кДа и четыре конкретных Cdk1 фосфорилирования сайтов. За новый субстрат регулировка концентрации киназы в assay соответствии Молярная концентрация белка и количество мест фосфорилирования. Деятельность фонда человеческого рекомбинантного Cdk1/циклин B 20 000 ед/мл и удельная активность 1,000,000 U / мг. 1 U определяется как количество Cdk1/циклин B, необходимые для ускорения передачи 1 пмоль фосфата Cdk1 пептидный субстрат PKTPKKAKKL-NH2 (50 мкм) в 1 мин при 30 ° C (см. Таблицу материалы).
    4. Подготовить управления реакции без Cdk1/циклин B. инкубировать реакции на водяной бане 1-16 ч на 30 ° C.
  2. Анализировать 2,5 µL пробы реакции киназы и 2,5 мкл контроля SDS-PAGE (шаг 3.11), используя гель с 16% акриламида. Чтобы увеличить разрешение, продлить время работы.
  3. Добавление равным объемом 6 M Гуанидин гидрохлорид решения оставшихся пробирного реакции киназы (и управления). Окончательный Гуанидин гидрохлорид концентрация будет 3 м. анализировать эти образцы по масс-спектрометрии (раздел 6) для определения мест фосфорилирования или отправить образцы центр масс-спектрометрии для анализа и затем выполнять функции проверки ( Раздел 7).
    Примечание: Для анализа последующих масс-спектрометрии, это очень важно, что фосфорилирование эффективность отдельных сайтов выше, как можно скорее, предпочтительно 100%, иначе не могут быть сопоставлены фосфорилирование сайтов. Значительно повысить эффективность фосфорилирование, добавить большее количество Cdk1/циклин B и увеличить время инкубации до 16 ч. Концентрация СПС также может быть удвоен.
  4. Для устранения неполадок, выполните в vitro assay киназы CENP-f (остатки 2987-3,065) как позитивный элемент управления. Использование свежих серий Cdk1/циклин B с высоким деятельности.

6. Идентификация фосфорилирование Cdk1-конкретных сайтов по масс-спектрометрии

  1. Денатурировать и опреснения образцы протеина, выполняют обратную фазу жидкостной хроматографии microbore со столбцом PLRP300.
  2. Чтобы получить количество мест фосфорилирования в фрагменте CENP-F, анализировать нетронутыми в vitro фосфорилированных CENP-F 84-mer электроспрей ионная ловушка ионизационная масс-спектрометрия (ESI-ITMS)44,45.
  3. Чтобы оценить phosphoamino кислоты место CENP-f, подготовить сборники трипсина в vitro фосфорилированных образцы протеина CENP-F. Опреснения трипсина дайджесты с обессоливания накапайте советы.
  4. Анализ tryptic сборники CENP-F путем ионизации электроспрей Фурье преобразование ионного циклотронного резонанса масс-спектрометрия (уни-FTICR МС). Выполните анализ на Уни-FTICR масс-спектрометр с накоплением время 169 МКС.
    Примечание: Точность массы определяется уни-FTICR MS находится в пределах 0,005 Аму. Чтобы определить отношение каждого фосфорилированных видов соответствующей сумме общего белка, определите высот пик массовых спектров.

7. Функциональная проверка: Тестирование эффекты Phosphomimetic перегласовок на белок белковых взаимодействий хромотографией аналитической размер исключения

Примечание: для функциональной верификации выявленных конкретных Cdk1 фосфорилирования сайтов, phosphomimetic мутантов CENP-F фрагментов были созданы путем замены выявленных фосфорилирование сайты с aspartates. Отрицательный заряд аспартат имитирует эффекты фосфорилирования. S3048D мутант фрагмента CENP-F (остатки 2987-3,065) был создан.

  1. Для проверки функциональности Сравните привязки одичал типа и phosphomimetic CENP-F фрагменты karyopherin α. Использование аналитических гель фильтрации как assay привязки. Для фильтрации аналитическим гель очистить CENP-F фрагменты хромотографией сродства глутатиона (шаги 3.1-3.12) и пропустить шаг фильтрации геля.
  2. Концентрат белка до 5-6 мг/мл. Флэш замораживание аликвоты белка в жидком азоте (шаги 3.15 3.17).
  3. Фрагменты Mix очищенный CENP-F (0,1 мг, одичал тип или S3048D вариант) и очищенный karyopherin α (0,7 мг) в соотношении 1:1 моляра. Отрегулируйте громкость образца до 200 мкл с буфером фильтрации геля. Инкубировать образца на 30 минут на льду, фильтр образец (0,2 мкм поры) и снимите образца центрифугированием (25 мин, 21 700 x g, 4 ° C)
  4. Отдельный образец хромотографией размер исключения (шаги 3.13-3.14). Используйте буфер фильтрации геля, состоящий из 20 мм HEPES, pH 7.5, 150 мм NaCl и 2 мм DTT. Выполните эксперименты фильтрации аналитическим гель при одинаковых условиях для всех образцов.
  5. Калибровка столбце фильтрация аналитических гель с молекулярной массой стандартами известных молярной массы, как описано заводом-изготовителем.
  6. Анализировать элюции дроби на 16% SDS-PAGE (шаг 3.11).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Недавно мы использовали в vitro киназы assay (рис. 1) для выявления конкретных Cdk1 фосфорилирования сайтов в фрагмент CENP-F, который содержится в жизнь10. Этот сигнал наделяет ядерной локализации в течение большей части межфазных CENP-f. В фазе G2 CENP-F экспортируется из ядра в цитозоль образом зависящих от Cdk1. Чтобы получить механистических идей на как Cdk1 регулирует клеточной локализации CENP-F, мы проанализировали последовательность CENP-F предсказать Cdk1-конкретных фосфорилирование сайты, используя iGPS сервера36,37. В жизнь CENP-F, три Cdk1-конкретных фосфорилирование сайтов были предсказаны в остатки 3,042, 3045 и 3048 (Таблица 1). Другой сайт фосфорилирование Cdk1 конкретных также было предсказано для остатков 3007 (Таблица 1)10. Таким образом мы предположили, что Cdk1 регулирует локализация CENP-F прямо фосфорилирование его жизнь.

Чтобы проверить, является ли жизнь CENP-F субстрата для Cdk1, мы провели в vitro киназы пробирного с очищенной фрагмент человеческой CENP-F (остатки 2987-3,065) и человека Cdk1/циклин B. в vitro фосфорилированных CENP-F была проанализирована на 16% SDS-PAGE, Вместе с отрицательного контроля, что не хватало киназы Cdk1 (рисунок 2A)10. Для в vitro фосфорилированных CENP-F, очистить вверх сдвиг наблюдается в группе на геле, по сравнению с отрицательного контроля. Это типичный фосфорилированных белков, как каждой Фосфатная группа добавляет два отрицательными зарядами и дополнительных масс. Эти результаты показывают, что CENP-F фосфорилированных Cdk1/циклин B10.

Чтобы определить количество сайтов, фосфорилирование CENP-F и количественно оценить эффективность фосфорилирования этих сайтов, нетронутыми в vitro фосфорилированных CENP-F фрагмент (84-mer) был проанализирован масс-спектрометрия (ESI-ITMS)10. Наблюдаемые ESI-ионная ловушка массового спектра (рис. 2B) свидетельствует о том, что нетронутыми фрагмент CENP-F фосфорилированных на четыре места (Таблица 1)10.

Расположение участков фосфорилированных аминокислоты в последовательности CENP-F оценивалась путем изучения tryptic дайджесты трипсином уни-FTICR г-жа расщепляет белки цепи после lysines и arginines, и трипсина дайджест фрагмента CENP-F привели в нескольких пептиды, включая один, содержащий остатки 3,031-3 052. Массовые спектры этот пептид CENP-F согласуются с фосфорилирования в остатки T3042, T3045 и S3048, которые расположены в пределах10жизнь (Таблица 1). Массовые спектры другого tryptic пептид (остатки 2995-3,016) согласуются с фосфорилирования в S3007 (Таблица 1)10. Все четыре конкретных Cdk1 фосфорилирования сайты также были предсказаны из последовательности. Cdk1-специфических субстратов часто содержат пролина рядом с остатков, что фосфорилированных6, как заметил на остатки, T3042, T3045 и S3007. Следует отметить, что S3048 является несколько необычным сайт фосфорилирование Cdk1-конкретным, поскольку фенилаланин расположен рядом с серина. В заключение, результаты предполагают, что CENP-F специально фосфорилированных на остатки 3,007, 3,042, 3045 и 3048, киназы Cdk1. Три из этих остатков расположены в жизнь CENP-F (Таблица 1), указав, что Cdk1 может регулировать CENP-F клеточной локализации путем фосфорилирования жизнь в G2 фазе, когда Cdk1 становится активной10.

Чтобы убедиться, что эти сайты фосфорилирование Cdk1-конкретных имеют физиологическую функцию, мы создали phosphomimetic вариант S3048D10. Phosphomimetic перегласовок имитирующие эффекты фосфорилирование, отрицательно заряженных остатков. Далее мы очищены phosphomimetic версии CENP-F фрагмента, содержащего жизнь. Жизнь CENP-F признается α karyopherin рецептор ядерный транспорт, который связывает с высоким сродством и не требуется для импорта ядерных CENP-ф Чтобы проверить ли мутация phosphomimetic ослабляет взаимодействие между жизнь CENP-F с его перевозки ядерных рецепторов karyopherin α, мы выполнили привязку пробирного (рис. 3)10. В этих экспериментах фрагмент очищенный CENP-F (одичал тип или S3048D вариант) была смешана с очищенной человека karyopherin α, и смесь была отделена хромотографией аналитической размер исключения. Кроме того белки также были проанализированы отдельно. SDS-PAGE анализ элюции фракций показал, что фрагмент одичал тип CENP-F с жизнь сильно взаимодействует с karyopherin α, так как оба белки совместно элюировать (рис. 3)10. Однако лишь незначительное количество фрагмента CENP-F S3048D связывается с karyopherin α, и эти белки элюировать отдельно (Рисунок 3)10. Эти результаты позволяют предположить, что фосфорилирование остатков 3048 жизнь CENP-F будет иметь сильное влияние на взаимодействие с α karyopherin фактор ядерного транспорта. Следует отметить, что темпы ядерного импорта сильно зависит от схожести ядерной локализации сигнала к ядерной транспорта фактор46, и таким образом, ожидается, что эти мутации замедлить ядерного импорта10.

Figure 1
Рисунок 1: Схематическое представление Cdk1 в vitro киназы assay. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 2
Рисунок 2: CENP-F фосфорилированных Cdk1/циклин б. (A) для определения Cdk1 конкретных фосфорилирование сайтов, assay киназы в vitro была выполнена с очищенной CENP-F (остатки 2987-3,065). SDS-PAGE анализ отрицательный контроль без Cdk1/циклин B показано в левой полосе (-Cdk1), рядом в vitro фосфорилированных CENP-F в правильный Лейн (+ Cdk1). Молекулярный вес стандартов указаны. Обратите внимание вверх сдвиг фосфорилированных CENP-F на SDS-PAGE, которая согласуется с успешным фосфорилирования. Cdk1 и циклин B отображаются как слабый полосы на 34 кДа и 60 кДа. (B) ESI-ионная ловушка масс-спектрометрия нетронутыми фосфорилированных CENP-F от (A) была использована для определения фосфатной нагрузки нетронутыми фосфорилированных CENP-F (84-mer). Показано соответствующее массовых спектр. Интенсивность строится по сравнению с соотношением массы и заряда (m/z). Спектр показывает + 10 + 14 заряда государствам нетронутыми фрагмента CENP-F после фосфорилирования. Они указывают видов населения с 0, 1, 2, 3 и 4 фосфатные эфиры. Чтобы подсчитать соотношение каждого вида, к сумме общего белка, пик высот были определены и сравнении (Таблица 1). Этот рисунок был изменен с10 и воспроизводится с разрешения Тейлор и Фрэнсис издателем. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 3
Рисунок 3: функциональная проверка: phosphomimetic перегласовок CENP-F сильно уменьшить взаимодействие с ядерной транспорта рецептора karyopherin α. (FA) Очищенный фрагменты CENP-F (остатки 2987-3,065) (0,1 мг) и очищенного karyopherin α (0,7 мг) и были смешаны в молярное соотношение 1:1 и проанализированы хромотографией размер исключения. CENP-F фрагментов karyopherin α были также проанализированы и индивидуально. Приводится анализ SDS-PAGE пик фракций. Элюирующий тома указаны в нижней (с шагом 0,6 мл). На левой стороне указаны позиции полосы маркер молекулярного веса и их массы в кДа. Звездочка помечает следы остаточной GST (глутатион S-трансферазы). (A) Karyopherin α. (B) элюции профили. Поглощения в 280 Нм заговор против элюции тома. Элюирующий профиль для karyopherin α (красный) накладывается с профилями элюции смесей α karyopherin с CENP-F фрагментов (одичал тип: зеленый; phosphomimetic S3048D мутанта: синий). Обратите внимание, что Добавление фрагмента одичал тип CENP-F сдвигает элюции объем karyopherin α пик выше массы, которая согласуется с привязкой фрагмента одичал тип CENP-F. Этот сдвиг не наблюдается при добавлении фрагмента CENP-F с phosphomimetic мутации S3048D, предполагая, что мутация phosphomimetic значительно уменьшается взаимодействие CENP-F с karyopherin α. (C) CENP-F одичал тип фрагмента (wt) и karyopherin α. (D) CENP-F wt фрагмент. (E) CENP-F S3048D фрагмент и karyopherin α. (F) CENP-F S3048D фрагмент. Эта цифра была создана с использованием данных из10. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Таблица 1а. Последовательность CENP-F фрагмента (остатки 2987-3065) с предсказал Cdk1-конкретные сайты фосфорилирование отмечен крупный размер шрифта. Tryptic фрагменты выделены жирным шрифтом и подчеркнул.
GPLGSQQSKQDSRGSPLLGPVVPGPSPIPSVTEKRLSSGQNKAS
GKRQR-SSGIWENGGGPT-PAT-PES-FSKKSKKAVMSGIHPAE
Таблица 1В. Масс-спектрометрия анализ нетронутыми CENP-F
84 mer после фосфорилирования в пробирке с Cdk1/циклин B
# фосфорилирования сайтов (P) обнаружен Фосфатной нагрузки, выражается в % общего белка
CENP-F 2987-3065 0P 6%
1 P 37%
2P 40%
3P 15%
4P 3%
Таблица 1C. Масс-спектрометрия анализ tryptic пептидов после фосфорилирования в пробирке с Cdk1/циклин B CENP-f
# фосфорилирования сайтов Фосфатной нагрузки
Tryptic phosphopeptide, 0P 57%
остатки 2995-3016 1 P 43%
Tryptic phosphopeptide, 0P 7%
остатки 3031-3052 1 P 64%
2P 29%
3P 1%

Таблица 1: Массовое спектрометрирование анализ фрагмента CENP-F после фосфорилирования в пробирке с Cdk1/циклин б. Эта таблица была создана с использованием данных из10.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Наши в vitro киназы пробирного является очень мощный метод идентификации молекулярных целей для киназы Cdk1, который представляет собой главный контроллер клеточного цикла и регулирует многие важные клеточные процессы. Этот метод определяет, если очищенный белок является субстратом для Cdk1 и позволяет идентифицировать конкретных фосфорилирование сайтов. Это облегчает механистический исследования для регулирования клеточных процессов, фосфорилирование через Cdk1.

Наиболее важным фактором для успешной идентификации фосфорилирование сайтов по масс-спектрометрии является эффективность фосфорилирование киназы assay. Фосфорилирование эффективность отдельных сайтов предпочтительно должно быть как можно, выше 100%. Это может быть достигнуто путем увеличения количества Cdk1/циклин B и увеличивая время инкубации до 16 ч. При расчете количества Cdk1/циклин B требуется, Молярная концентрация белка и количество фосфорилирования сайты должны рассматриваться. Это особенно важно, если несколько сайтов фосфорилирование присутствуют в целевом белка. Следует также отметить, что деятельность коммерческих Cdk1/циклин B может меняться от партии к партии, и что киназа может потерять деятельности быстро. Если в vitro фосфорилирование неудачн, рекомендуется проверить действие киназы. Как позитивный элемент управления для устранения неполадок может использоваться в vitro фосфорилирование CENP-F (остатки 2987-3,065). Как элемент негативные реакции без Cdk1/циклин B добавления следует выполнены и проанализированы. Еще один полезный отрицательный контроль является использование киназы мертвый мутантов Cdk1, который каталитически неактивны, из-за простой Точечная мутация (D146N)47,48,49. Кроме того для проверки определенных фосфорилирования сайтов, phosphonegative версии целевого белка могут создаваться, где фосфорилирование сайтов заменяются alanines. Если верны выявленные фосфорилирование сайты, соответствующие мутант phosphonegative не может быть фосфорилированных в пробирке.

Простой инструмент для выявления успешных фосфорилирование целевого белка является простой пробирного сдвиг гель SDS-PAGE, описанных здесь. Фосфорилированный белки обычно мигрируют медленнее на SDS-PAGE, чем их unphosphorylated коллеги, благодаря добавил размер и отрицательными зарядами. Обратите внимание, что для крупных белков, оптимизация SDS-PAGE анализа требуется для повышения резолюции достаточно для того, чтобы визуализировать сдвига гелем. Полезным инструментом для конкретных разделение белков, фосфорилированных фосфат привязки тег (ПУЗ тег) SDS-PAGE. Фосфорилированный белки в виде геля, приготовленные ПУЗ тегов акриламида визуализируются как медленнее миграции групп, по сравнению с соответствующим dephosphorylated белки50,51.

Для получения массового спектры высокого качества, очень важно, что белок для assay киназы в пробирке является чистым и однородным. Наш протокол очистки достигает этого путем объединения нескольких шагов высокоселективных хроматографии и предотвращения деградации белка и окисления путем добавления ингибиторы протеазы и восстановители. Протокол очистки могут быть изменены для элюировать белок глутатион (т.е., с нетронутым GST-тегов); Однако следует считать, что GST-тег добавляет еще один 25 кДа, и крупных белков являются сложными цели для масс-спектрометрии. Кроме того, наши очистки протокол для его6-тег синтез белков может также использоваться.

Этот протокол также могут быть изменены для выявления фосфорилирование сайты, которые являются специфическими для других киназы. Единственным требованием является, что очищенный киназы доступны, активных и достаточно стабильной. Пробирного условия должны быть скорректированы для каждого киназы для достижения максимальной активности. Параметры для оптимизации включают количество киназы, буфер реакции (рН, концентрации соли), время инкубации, реакции температуры и концентрации ATP. Успешно используются в vitro киназы анализов для выявления сайтов фосфорилирование киназы, включая Plks (поло как киназы)52,,5354, и MAPK/ERK киназ (Митоген активированный протеин киназы / внеклеточных сигналов регулируемой киназы)55,56.

В то время как сила этого метода заключается в выявлении конкретных фосфорилирование сайты в очищенный протеин, следует отметить, что фосфорилирование сайт, который является целевым объектом для Cdk1 в пробирке может не обязательно быть фосфорилированных в естественных условиях. В vivo, дополнительные механизмы регулирования находятся в месте, которое может недоступными фосфорилирование сайт для признания Cdk1. Например дополнительные взаимодействия партнеров может быть настоящее в естественных условиях, которые могут либо скрыть фосфорилирование сайт или сделать его доступным через структурные изменения. Кроме того субстрат необходимо colocalize с Cdk1/циклин B в ядре в G2 фазе для того, чтобы быть фосфорилированных. Кроме того столб-поступательные изменения или другие регуляторные процессы могут повлиять на конформацию целевого белка в vivo, который может сделать сайт фосфорилирование недоступными. Эти ограничения могут быть преодолены путем разработки соответствующих экспериментов в клетки или Животные модели, которые проверяют, что выявленные фосфорилирование сайты имеют физиологическую функцию. Здесь мы используем простой привязки пробирного для проверки функциональности, поскольку уменьшает фосфорилирование взаимодействия CENP-F с karyopherin α. функциональные проверки также должна быть выполнена в контексте клеток или животной модели. Таким образом мы также transfected флуоресцентные синтез белков CENP-F-фрагментов, которые содержали жизнь в НеЬа клетки10. Phosphomimetic перегласовок в жизнь CENP-F уменьшилось ядерной локализации, который подтвердил физиологические функции этих мест фосфорилирования10.

Некоторые инструменты доступны для проверки функциональности сайтов фосфорилирования в клетки животных моделей. Phosphomimetic мутации, которые имитируют эффекты фосфорилирование с отрицательными зарядами, широко используются для этой цели. Для них фосфорилирование сайта (сериновые или треонин) заменяется аспартат или глутамата. Преимуществом является, что только Точечная мутация целевого белка требуется. Следует отметить, что, хотя phosphomimetic перегласовок были успешно используется во многих случаях для проверки функциональности, они особенно работают в тех случаях, когда заряд изменения преобладающей донором для регулирования, а не структурных изменений. Phosphomimetic мутации не имитировать эффекты фосфорилирования во многих других случаях (например, 11). Однако, другие подходы доступны для функциональной верификации фосфорилирования сайтов, включая использование phosphonegative мутации: эти мутации предотвратить фосфорилирование, заменив фосфорилирование сайтов аланина. Другим полезным подходом для функциональной верификации в сотовой связи является выражением киназы мертвый мутантов Cdk1, который обезврежена легко представить Точечная мутация (D146N)47,48,49. В частности несколько малых молекул ингибиторов Cdk1 коммерчески доступны такие как Flavopiridol и RO-3306, который может использоваться для функциональных исследований в клетки или животных моделей,78,11. Эти ингибиторы хорошо изученных, а некоторые находятся в клинических испытаниях для лечения рака (для обзора см.9).

Хотя в протеомических исследований было выявлено большое количество сайтов фосфорилирование белков, киназы специфика является в большинстве случаев неизвестного, и пробирного киназы в пробирке является одним из немногих методов, доступных для идентификации субстратов Cdk1. Использовались также другие подходы. Cdk1 целевые показатели были определены с помощью инженерных фермента Cdk1. Он имеет больше карманных привязки субстрата и принимает более громоздкие версии СПС как субстрат6. Этот громоздкий субстрат нельзя привязать к одичал тип киназы. Добавление radiolabeled громоздкие АТФ в ячейку экстракт, содержащий измененный фермента Cdk1 поэтому приводит к конкретной маркировки прямой субстратов Cdk1. 200 Cdk1 цели были определены в многообещающий дрожжей с помощью этого метода; Однако она не может применяться к mammalian клеток, который является важным ограничением. В другом исследовании Cdk1 субстратов были определены в клетках человека культуры ткани, выполняя анализ количественных phosphoproteomics, с помощью двух малых молекул ингибиторов Cdk1, Flavopiridol и RO-3306. 1215 phosphopeptides на 551 белки были значительно снижены после добавления ингибитора Cdk17. Этот метод может экранировать всю протеома для потенциальных Cdk1 целей, но в результате целей необходимо проверить, например, путем киназы в vitro пробирного.

В будущем в пробирке киназы assay скорее всего будет сочетаться с экранов высокой пропускной способности для Cdk1 поверхностей, которые находятся в настоящее время в стадии разработки. Из-за большого числа Cdk1 субстратов в протеом многие человеческие Cdk1 субстратов по-прежнему определяться и в пробирке киназы assay будет важным инструментом для выявления, карта и проверить эти сайты.

Assay киназы в пробирке является мощным инструментом для определить цели для киназы Cdk1 и выявления конкретных фосфорилирования сайтов. Определение этих мест фосфорилирования позволяет механистический исследования для регулирования клеточных процессов, Cdk1.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Авторы не имеют ничего сообщать.

Acknowledgments

Мы благодарим д-р Дэвид Кинг, Говард Хьюз медицинский институт, Университет Калифорнии в Беркли для анализа масс-спектрометрии и полезные замечания. Мы благодарим д-р Ксуилиан Чжу, Шанхай, институты для биологических наук, Китайской академии наук, Шанхай, Китай для предоставления конструкцию полнометражные CENP-F. Наконец мы благодарим д-р Сьюзен Отрава, Брайан Калахен и д-р Кристоф Grewer в университете Бингемтон для доступа к оборудованию. Это исследование финансировалось Фондом исследований государственного университета Нью-Йорка и Кафедра химии университета в Нью-Йорк в Бингамтоне.

Materials

Name Company Catalog Number Comments
2800 mL baffled Fernbach flask Corning 44232XL
ampicillin Gold Biotechnology A-301-25
ATP Fisher Scientfiic BP413-25
benzamidine hydrochloride Millipore Sigma B6506-25
bottletop filter Corning 431161
Cdk1/cyclin B recombinant, human 20,000 U/mL New England Biolabs P6020
Cdk1/cyclin B (alternate source) EMD Millipore 14-450
Cdk1/cyclin B (alternate source) Invitrogen PV3292
Cdk1/cyclin B + 10x PK buffer New England Biolabs P6020
CENP-F (residues 2987 – 3065) pGEX6P1 plasmid Available upon request.
centrifuge: Heraeus Multifuge X3R, cooled, with TX-1000 swing-out rotor Thermo Scientific 10033-778
centrifugal filter units: Amicon Ultra-15 centrifugal filter units, 3 kDa cutoff, Ultracel-PL membranes EMD Millipore UFC900324
chlorampenicol Gold Biotechnology C-105-100
D/L methionine Agros Organics / Fisher 125650010
desalting pipet tips: Zip tips Millipore Sigma ZTC18S008
disposable chromatography columns, Econo-Pac 1.5 x 12 cm Biorad 7321010
dithiothreitol Gold Biotechnology DTT50
E. coli Rosetta 2(DE3)pLysS strain EMD Millipore 71403
electrospray ionization Fourier transform ion Bruker Amazon Apex III
cyclotron resonance mass spectrometer
electrospray ionization ion trap mass spectrometer Bruker Amazon custom
fixed angle rotor: Fiberlite F15-8x-50cy Thermo Scientific 97040-276
FPLC system: Äkta Pure FPLC GE Healthcare 29032697
Gel filtration column: Superdex 200 Increase 10/300 GL GE Healthcare 28990944
glutathione agarose Pierce 16101
glutathione, reduced Millipore Sigma G4251-50g
incubation shaker: multitron shaker Infors I10102
isopropyl β-D-1-thiogalactopyranoside Gold Biotechnology I2481C50
kanamycin Gold Biotechnology K-120-25
karyopherin α pet-28a pres plasmid Available upon request.
Luria Bertani medium Fisher Scientfiic BP1426-2
microcentrifuge 5418R, refrigerated Eppendorf 5401000013
microtubes (0.5 mL) Eppendorf 30121023
microtubes (1.5 mL) Eppendorf 30120086
Nickel affinity gel: His-Select Nickel affinity gel Millipore Sigma P6611-100ml
pGEX-6P-1 plasmid Millipore Sigma GE28-9546-48
phenylmethylsulfonyl fluoride Gold Biotechnology P470-10
PS protease: PreScission protease GE Healthcare 27084301
Phos-tag acrylamide Wako Pure Chem. Ind. 304-93521
reduced gluthathione Millipore Sigma G4251-50g
roundbottom centrifuge tubes (Oakridge tubes) Fisher Scientfiic 055291D
site-directed mutagenesis kit: QuikChange Lightning Agilent 210518
Site-Directed Mutagenesis Kit
sonifier: Branson S-250D sonifier Branson 15 338 125
Spectra/Por 1RC dialysis membrane (6-8 kDa cutoff) Spectrum Labs 08 670B
swing out rotor TX-1000 Thermo Scientific 10033-778

DOWNLOAD MATERIALS LIST

References

  1. Nurse, P. Cyclin dependent kinases and cell cycle control (Nobel Lecture). ChemBioChem. 3, (7), 596-603 (2002).
  2. Lee, M. G., Nurse, P. Complementation used to clone a human homologue of the fission yeast cell cycle control gene cdc2. Nature. 327, 31 (1987).
  3. Lohka, M. J., Hayes, M. K., Maller, J. L. Purification of maturation-promoting factor, an intracellular regulator of early mitotic events. Proc Natl Acad of Sci U S A. 85, (9), 3009-3013 (1988).
  4. Gautier, J., Norbury, C., Lohka, M., Nurse, P., Maller, J. Purified maturation-promoting factor contains the product of a Xenopus homolog of the fission yeast cell cycle control gene. Cell. 54, (3), 433-439 (1988).
  5. Gautier, J., Minshull, J., Lohka, M., Glotzer, M., Hunt, T., Maller, J. L. Cyclin is a component of maturation-promoting factor from Xenopus. Cell. 60, (3), 487-494 (1990).
  6. Ubersax, J. A., Woodbury, E. L., Quang, P. N., Paraz, M., Blethrow, J. D., Shah, K., Shokat, K. M., Morgan, D. O. Targets of the cyclin-dependent kinase Cdk1. Nature. 425, (6960), 859-864 (2003).
  7. Petrone, A., Adamo, M. E., Cheng, C., Kettenbach, A. N. Identification of Candidate Cyclin-dependent kinase 1 (Cdk1) Substrates in Mitosis by Quantitative Phosphoproteomics. Mol Cell Proteomics. 15, (7), 2448-2461 (2016).
  8. Vassilev, L. T., Tovar, C., Chen, S., Knezevic, D., Zhao, X., Sun, H., Heimbrook, D. C., Chen, L. Selective small-molecule inhibitor reveals critical mitotic functions of human CDK1. Proc Natl Acad of Sci U S A. 103, (28), 10660-10665 (2006).
  9. Balakrishnan, A., Vyas, A., Deshpande, K., Vyas, D. Pharmacological cyclin dependent kinase inhibitors: Implications for colorectal cancer. World J Gastroenterol. 22, (7), 2159-2164 (2016).
  10. Loftus, K. M., Coutavas, E., Cui, H., King, D., Ceravolo, A., Pereiras, D., Solmaz, S. Mechanism for G2 phase-specific nuclear export of the kinetochore protein CENP-F. Cell Cycle. 16, (15), 1414-1429 (2017).
  11. Baffet, A. D., Hu, D. J., Vallee, R. B. Cdk1 activates pre-mitotic nuclear envelope dynein recruitment and apical nuclear migration in neural stem cells. Dev Cell. 33, (6), 703-716 (2015).
  12. Songyang, Z., Blechner, S., Hoagland, N., Hoekstra, M. F., Piwnica-Worms, H., Cantley, L. C. Use of an oriented peptide library to determine the optimal substrates of protein kinases. Curr Biol. 4, (11), 973-982 (1994).
  13. Malumbres, M. Cyclin-dependent kinases. Genome Biol. 15, (6), 122 (2014).
  14. Peeper, D. S., Parker, L. L., Ewen, M. E., Toebes, M., Hall, F. L., Xu, M., Zantema, A., van der Eb, A. J., Piwnica-Worms, H. A- and B-type cyclins differentially modulate substrate specificity of cyclin-cdk complexes. EMBO J. 12, (5), 1947-1954 (1993).
  15. Trembley, J., Ebbert, J., Kren, B., Steer, C. Differential regulation of cyclin B1 RNA and protein expression during hepatocyte growth in vivo. Cell Growth Differ. 7, (7), 903-916 (1996).
  16. Pines, J., Hunter, T. The differential localization of human cyclins A and B is due to a cytoplasmic retention signal in cyclin B. EMBO J. 13, (16), 3772-3781 (1994).
  17. Morgan, D. O. Principles of CDK regulation. Nature. 374, 131 (1995).
  18. Larochelle, S., Merrick, K. A., Terret, M. -E., Wohlbold, L., Barboza, N. M., Zhang, C., Shokat, K. M., Jallepalli, P. V., Fisher, R. P. Requirements for Cdk7 in the assembly of Cdk1/cyclin B and activation of Cdk2 revealed by chemical genetics in human cells. Mol cell. 25, (6), 839-850 (2007).
  19. Parker, L. L., Sylvestre, P. J., Byrnes, M. J., Liu, F., Piwnica-Worms, H. Identification of a 95-kDa WEE1-like tyrosine kinase in HeLa cells. Proc Natl Acad of Sci U S A. 92, (21), 9638-9642 (1995).
  20. Atherton-Fessler, S., Parker, L. L., Geahlen, R. L., Piwnica-Worms, H. Mechanisms of p34cdc2 regulation. Mol Cell Biol. 13, (3), 1675-1685 (1993).
  21. Liu, F., Stanton, J. J., Wu, Z., Piwnica-Worms, H. The human Myt1 kinase preferentially phosphorylates Cdc2 on threonine 14 and localizes to the endoplasmic reticulum and Golgi complex. Mol Cell Biol. 17, (2), 571-583 (1997).
  22. McGowan, C. H., Russell, P. Human Wee1 kinase inhibits cell division by phosphorylating p34cdc2 exclusively on Tyr15. EMBO J. 12, (1), 75-85 (1993).
  23. Strausfeld, U., Labbé, J. C., Fesquet, D., Cavadore, J. C., Picard, A., Sadhu, K., Russell, P., Dorée, M. Dephosphorylation and activation of a p34cdc2/cyclin B complex in vitro by human CDC25 protein. Nature. 351, 242 (1991).
  24. Leuken, R., Clijsters, L., Wolthuis, R. To cell cycle, swing the APC/C. Biochim Biophys Acta. 1786, (1), 49-59 (2008).
  25. Acquaviva, C., Pines, J. The anaphase-promoting complex/cyclosome: APC/C. J Cell Sci. 119, (12), 2401-2404 (2006).
  26. Zhu, X., Chang, K. -H., He, D., Mancini, M. A., Brinkley, W. R., Lee, W. -H. The C-terminus of mitosin is essential for its nuclear localization, centromere/kinetochore targeting, and dimerization. J Biol Chem. 270, (33), 19545-19550 (1995).
  27. Liao, H., Winkfein, R. J., Mack, G., Rattner, J. B., Yen, T. J. CENP-F is a protein of the nuclear matrix that assembles onto kinetochores at late G2 and is rapidly degraded after mitosis. J Cell Biol. 130, (3), 507-518 (1995).
  28. Rattner, J. B., Rao, A., Fritzler, M. J., Valencia, D. W., Yen, T. J. CENP-F is a ca 400 kDa kinetochore protein that exhibits a cell-cycle dependent localization. Cell Motil Cytoskeleton. 26, (3), 214-226 (1993).
  29. Christie, M., Chang, C. -W., Rona, G., Smith, K. M., Stewart, A. G., Takeda, A. A. S., Fontes, M. R. M., Stewart, M., Vertessy, B. G., Forwood, J. K., Kobe, B. Structural biology and regulation of protein import into the nucleus. J Mol Biol. 428, (10A), 2060-2090 (2016).
  30. Zuccolo, M., Alves, A., Galy, V., Bolhy, S., Formstecher, E., Racine, V., Sibarita, J. B., Fukagawa, T., Shiekhattar, R., Yen, T., Doye, V. The human Nup107/160 nuclear pore subcomplex contributes to proper kinetochore functions. EMBO J. 26, 1853-1864 (2007).
  31. Bolhy, S., Bouhlel, I., Dultz, E., Nayak, T., Zuccolo, M., Gatti, X., Vallee, R., Ellenberg, J., Doye, V. A Nup133-dependent NPC-anchored network tethers centrosomes to the nuclear envelope in prophase. J Cell Biol. 192, (5), 855-871 (2011).
  32. Hu, D. J., Baffet, A. D., Nayak, T., Akhmanova, A., Doye, V., Vallee, R. B. Dynein recruitment to nuclear pores activates apical nuclear migration and mitotic entry in brain progenitor cells. Cell. 154, (6), 1300-1313 (2013).
  33. Vergnolle, M. S., Taylor, S. S. Cenp-F links kinetochores to Ndel1/Nde1/Lis1/Dynein microtubule motor complexes. Curr Biol. 17, (13), 1173-1179 (2007).
  34. Yang, Z. Y., Guo, J., Li, N., Qian, M., Wang, S. N., Zhu, X. L. Mitosin/CENP-F is a conserved kinetochore protein subjected to cytoplasmic dynein-mediated poleward transport. Cell Res. 13, (4), 275-283 (2003).
  35. Yang, Z., Guo, J., Chen, Q., Ding, C., Du, J., Zhu, X. Silencing mitosin induces misaligned chromosomes, premature chromosome decondensation before anaphase onset, and mitotic cell death. Mol Cell Biol. 25, (10), 4062-4074 (2005).
  36. Xue, Y., Ren, J., Gao, X., Jin, C., Wen, L., Yao, X. GPS 2.0, a tool to predict kinase-specific phosphorylation sites in hierarchy. Mol Cell Proteomics. 7, (9), 1598-1608 (2008).
  37. Song, C., Ye, M., Liu, Z., Cheng, H., Jiang, X., Han, G., Songyang, Z., Tan, Y., Wang, H., Ren, J., Xue, Y., Zou, H. Systematic analysis of protein phosphorylation networks from phosphoproteomic data. Mol Cell Proteomics. 11, (10), 1070-1083 (2012).
  38. UniProt-Consortium. UniProt: the universal protein knowledgebase. Nucleic Acids Res. 45, (D1), D158-D169 (2017).
  39. Olsen, J. V., Vermeulen, M., Santamaria, A., Kumar, C., Miller, M. L., Jensen, L. J., Gnad, F., Cox, J., Jensen, T. S., Nigg, E. A., Brunak, S., Mann, M. Quantitative phosphoproteomics reveals widespread full phosphorylation site occupancy during mitosis. Science Signal. 3, (104), ra3 (2010).
  40. Dephoure, N., Zhou, C., Villén, J., Beausoleil, S. A., Bakalarski, C. E., Elledge, S. J., Gygi, S. P. A quantitative atlas of mitotic phosphorylation. Proc Natl Acad of Sci U S A. 105, (31), 10762-10767 (2008).
  41. Rona, G., Marfori, M., Borsos, M., Scheer, I., Takacs, E., Toth, J., Babos, F., Magyar, A., Erdei, A., Bozoky, Z., Buday, L., Kobe, B., Vertessy, B. G. Phosphorylation adjacent to the nuclear localization signal of human dUTPase abolishes nuclear import: structural and mechanistic insights. Acta Cryst D. 69, (12), 2495-2505 (2013).
  42. Harreman, M. T., Kline, T. M., Milford, H. G., Harben, M. B., Hodel, A. E., Corbett, A. H. Regulation of nuclear import by phosphorylation adjacent to nuclear localization signals. J Biol Chem. 279, (20), 20613-20621 (2004).
  43. Kosugi, S., Hasebe, M., Tomita, M., Yanagawa, H. Systematic identification of cell cycle-dependent yeast nucleocytoplasmic shuttling proteins by prediction of composite motifs. Proc Natl Acad Sci U S A. 106, (25), 10171-10176 (2009).
  44. McLachlin, D. T., Chait, B. T. Analysis of phosphorylated proteins and peptides by mass spectrometry. Curr Opin Chem Biol. 5, (5), 591-602 (2001).
  45. Van Berkel, G. J., Glish, G. L., McLuckey, S. A. Electrospray ionization combined with ion trap mass spectrometry. Anal Chem. 62, (13), 1284-1295 (1990).
  46. Hodel, A. E., Harreman, M. T., Pulliam, K. F., Harben, M. E., Holmes, J. S., Hodel, M. R., Berland, K. M., Corbett, A. H. Nuclear localization signal receptor affinity correlates with in vivo localization in Saccharomyces cerevisiae. J Biol Chem. 281, (33), 23545-23556 (2006).
  47. Hong, K. U., Kim, H. -J., Kim, H. -S., Seong, Y. -S., Hong, K. -M., Bae, C. -D., Park, J. Cdk1-Cyclin B1-mediated Phosphorylation of Tumor-associated Microtubule-associated Protein/Cytoskeleton-associated Protein 2 in Mitosis. J Biol Chem. 284, (24), 16501-16512 (2009).
  48. Meraldi, P., Lukas, J., Fry, A. M., Bartek, J., Nigg, E. A. Centrosome duplication in mammalian somatic cells requires E2F and Cdk2–Cyclin A. Nature Cell Biol. 1, 88 (1999).
  49. Heuvel, S., Harlow, E. Distinct roles for cyclin-dependent kinases in cell cycle control. Science. 262, (5142), 2050-2054 (1993).
  50. Kinoshita, E., Kinoshita-Kikuta, E., Takiyama, K., Koike, T. Phosphate-binding Tag, a New Tool to Visualize Phosphorylated Proteins. Mol Cell Proteomics. 5, (4), 749-757 (2006).
  51. Takeda, H., Kawasaki, A., Takahashi, M., Yamada, A., Koike, T. Matrix-assisted laser desorption/ionization time-of-flight mass spectrometry of phosphorylated compounds using a novel phosphate capture molecule. Rapid Commun Mass Spectrom. 17, (18), 2075-2081 (2003).
  52. Linder, M. I., Köhler, M., Boersema, P., Weberruss, M., Wandke, C., Marino, J., Ashiono, C., Picotti, P., Antonin, W., Kutay, U. Mitotic Disassembly of Nuclear Pore Complexes Involves CDK1- and PLK1-Mediated Phosphorylation of Key Interconnecting Nucleoporins. Dev Cell. 43, (2), (2017).
  53. Arai, T., Haze, K., Iimura-Morita, Y., Machida, T., Iida, M., Tanaka, K., Komatani, H. Identification of β-catenin as a novel substrate of polo-like kinase 1. Cell Cycle. 7, (22), 3556-3563 (2008).
  54. Hansen, D. V., Tung, J. J., Jackson, P. K. CaMKII and Polo-like kinase 1 sequentially phosphorylate the cytostatic factor Emi2/XErp1 to trigger its destruction and meiotic exit. Proc Natl Acad of Sci U S A. 103, (3), 608-613 (2006).
  55. Zhang, Y., Dong, Z., Nomura, M., Zhong, S., Chen, N., Bode, A. M., Dong, Z. Signal Transduction Pathways Involved in Phosphorylation and Activation of p70S6K Following Exposure to UVA Irradiation. J Biol Chem. 276, (24), 20913-20923 (2001).
  56. Richard, D. E., Berra, E., Gothié, E., Roux, D., Pouysségur, J. p42/p44 Mitogen-activated Protein Kinases Phosphorylate Hypoxia-inducible Factor 1α (HIF-1α) and Enhance the Transcriptional Activity of HIF-1. J Biol Chem. 274, (46), 32631-32637 (1999).
Идентификация Циклин зависимая киназа 1 сайты конкретных фосфорилирование киназы <em>в Vitro</em> пробирного
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Cui, H., Loftus, K. M., Noell, C. R., Solmaz, S. R. Identification of Cyclin-dependent Kinase 1 Specific Phosphorylation Sites by an In Vitro Kinase Assay. J. Vis. Exp. (135), e57674, doi:10.3791/57674 (2018).More

Cui, H., Loftus, K. M., Noell, C. R., Solmaz, S. R. Identification of Cyclin-dependent Kinase 1 Specific Phosphorylation Sites by an In Vitro Kinase Assay. J. Vis. Exp. (135), e57674, doi:10.3791/57674 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter