Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Immunology and Infection

Kvantitativ PCR af T7 Bacteriophage fra Biopanning

doi: 10.3791/58165 Published: September 27, 2018

Summary

En reproducerbar, præcis og tid effektiv kvantitativ PCR (qPCR) metode til at optælle T7 bacteriophage er beskrevet her. Protokollen beskriver klart phage genomisk DNA forberedelse, PCR reaktion forberedelse, qPCR cykling betingelser og qPCR dataanalyse.

Abstract

Denne protokol beskriver brugen af kvantitativ PCR (qPCR) til at optælle T7 phages fra phage udvalg eksperimenter (dvs., "biopanning"). qPCR er et fluorescens-baseret tilgang til at kvantificere DNA, og her, det er tilpasset til at kvantificere phage genomer som en proxy for phage partikler. I denne protokol, er præparationsmetode facile phage DNA beskrevet ved hjælp af høj temperatur varme uden ekstra DNA oprensning. Metoden bør kun små mængder af varmebehandlet phages og små mængder af qPCR reaktion. qPCR er høj overførselshastighed og hurtigt, stand til at behandle og få data fra en 96-brønd plade af reaktioner i 2 – 4 h. i forhold til andre phage optælling tilgange, qPCR er mere tid-effektive. Her, bruges qPCR til at optælle T7 phages identificeret fra biopanning mod in vitro- cystisk fibrose-lignende Slim model. Metoden qPCR kan udvides til at kvantificere T7 phages fra andre eksperimenter, herunder andre typer af biopanning (fx., immobiliserede protein binding, in vivo phage screening) og andre kilder (f.eks. vandsystemer eller kropsvæsker). I Resumé, kan denne protokol ændres til at kvantificere alle DNA-indkapslede vira.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Bacteriophage (phage) display teknologi, udviklet af George Smith i 1985, er en kraftfuld, høj overførselshastighed tilgang til at identificere peptid eller protein ligander mod mål eller receptorer fra cellemembranen, sygdom antigener, cellulære organeller eller specifikke organer og væv i de sidste to årtier1,2. Her, tilfældige biblioteker af polypeptider eller enkelt kæde antistoffer vises på coat proteiner af phages (typisk M13 eller T7), og specifikke ligander kan identificeres fra panorering mod immobiliseret proteiner i in vitro eller in vivo biologiske systemer gennem en iterativ udvælgelsesproces. Ligander kan derefter kobles til billedbehandling eller terapeutiske agenter for diagnose og behandling af sygdomme3,4. Det er afgørende at præcist optælle phages under flere trin i biopanning: (1) til at kvantificere phages, der binder til underlaget og (2) kvantificere phages for at afgøre, om der er berigelse med hver runde af valg (phage berigelse angiver biopanned Phage affinitet for målet). Den nuværende guld standard for kvantificering, dobbelt-lag plak assay, præsenterer flere udfordringer; Det er kedelig, besværlig og potentielt unøjagtige for et stort antal prøver. Vores gruppe har derfor udviklet en følsom, reproducerbar, præcise og tid-effektive kvantitative polymerase kæde reaktion (qPCR) metode til at optælle M13 og T7 phage partikler fra biopanning5.

qPCR er en attraktiv og realistisk metode til nøjagtigt kvantificere T7 og M13 phages. Da hver enkelte phage partikel kan kun indeholde én kopi af genomisk DNA (dsDNA eller ssDNA), er en phage genom svarende til én phage partikel; af kvantificerer antallet af phage genomer, er det muligt at opgøre antallet af phages. Under qPCR, fluorescerende reporter farvestoffer binde phage genomisk DNA ikke-specifikt eller specifikt gennem sekvens-specifikke primere under PCR-amplifikation og fluorescens signal stiger med hver runde af forstærkning. Når fluorescens signal når den tærskel, som runde/cyklus af forstærkning er noteret som tærskel cyklus (Ct). De kendte koncentrationer af reference phage DNA plottes mod deres Ct værdier til at etablere en standardkurve. Du bruger standardkurven med Ct-værdier af DNA-prøver, kan koncentrationen af phages indskydes.

Mens mange strategier har været tidligere udviklet og flittigt brugt til at kvantificere phages fra biopanning, har hver af dem specifikke udfordringer. Den mest populære og konventionelle metode er dobbelt-lag plak assay. Her, vært bakterier er smittet med phages forberedt på serielle fortyndinger, er belagt på en solid agar-substrat, og er belagt med agar; phages er opregnet med antallet af plaques dannet (dvs. plak-dannende enheder eller pfu) på agar plade. Plaque assay er følsomme, men kedelig, tidskrævende og unøjagtige, især for mange prøver og med høje koncentrationer5. Derudover er enzymmaerket assays (ELISA) blevet tilpasset til at optælle M13 og T7 phage partikler6,7,8. Her, phages på forskellige fortyndinger er bundet og fanget på et solidt underlag (dvs. en mikrotiterplade), aftestede med phage-specifikke antistoffer, og påvises ved hjælp af journalister (fx enzym følsomme kromogent substrater, fluorophores) til Bestem antallet af phage partikler til stede. Udlæsninger (f.eks., fluorescens, absorbans) prøver kan bruges til at kvantificere ukendt koncentrationer mod phage standarder på kendte koncentrationer. Forskellige phage-baserede ringprøver er blevet udviklet, men de har potentielle begrænsninger. Den ene gruppe udviklet en papirbaseret sandwich ELISA med en kvantificering vifte, som strakte sig over syv ordrer størrelsesorden (102-109 pfu/mL); men denne metode kræver flere trin af antistof belægning og tog til en hel dag for assay8. Vores gruppe også udviklet en ELISA-metoden for at kvantificere M13 phage partikler, men havde en mindre følsomme registreringsområde af 106 til 1011 pfu/mL5. Switchable lanthanide fluorescens sonder er blevet udviklet til at optælle M13 og kvantificering data kunne opnås indenfor 20 min; denne analyse har imidlertid en snævre dynamikområde 109 1012 pfu/mL9. En gruppe bruges atomic force mikroskopi til at optælle M13 phage partikler i løsning, men det kræver avanceret elektronmikroskopi og kun arbejdede inden for et snævert interval af koncentrationer10. En anden undersøgelse bruges monodisperse emulsioner til at fælde fluorescerende M13 og T4 reporter phages og tælle phages af antallet af fluorescerende dråber; men denne tilgang også udstillet en smal kvantificering spænder fra 102 til 106 pfu/mL11. Mens droplet digital PCR har været anvendt til at kvantificere M13 phages, er denne fremgangsmåde ude af stand til at skelne mellem antallet af smitsomme og ikke-infektiøse phage partikler12.

Vores gruppe har for nylig udviklet qPCR metoder til at optælle T7 og M13 phages identificeret fra biopanning mod en blod - hjerne barrieren celle model ved hjælp af to forskellige fluorescerende reporter farvestoffer5. I forhold til ovennævnte kvantificering metoder, qPCR metoder vi udviklet var høj overførselshastighed og tid-effektive til at kvantificere mange prøver og stand til at skelne mellem smitsomme og ikke-smitsomme phages med DNase jeg forbehandling af den Phage prøver. Vigtigst, kan denne tilgang reproducerbar og nøjagtigt kvantificere M13 og T7 Bakteriofager fra biopanning prøver. Til at guide nybegyndere forskere inden for phage qPCR, beskrive her vi en detaljeret qPCR metode til at optælle T7 phage partikler fra en cystein-begrænset bibliotek (CX7C) panoreret mod en in vitro- cystisk fibrose (CF) Slim barriere. Fra dette arbejde, kan qPCR metode udvides til at kvantificere phage partikler fra andre typer af biopanning og fra andre kilder, herunder vand, jord og kropsvæsker.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. primer Design og analyse for T7 Phage genomisk DNA

  1. Design primere for forstærkning af T7 phage genomisk DNA.
    Bemærk: F (frem) og R (omvendt) primere (Se Tabel af materialer) forstærke T7 DNA-sekvens beliggende opstrøms af bibliotek variable region (figur 1).
  2. Vælg en passende primer analyzer til at vurdere parametre af primere, herunder smeltepunktet (Tm), procent GC indhold (GC %), primer dimerer, hårnål dannelse og PCR egnethed (figur 1).
  3. Bestil primer oligonukleotider (oligos), og ved ankomsten, resuspend den frysetørrede oligos i DNase- og RNase gratis ultra rent vand at gøre 100 µM stock koncentrationer i et 1,5 mL centrifugeglas, og opbevares ved-20 ° C i flere måneder.
  4. Gøre flere delprøver (ca. 50 µL i hver 1,5 mL tube) af 100 µM primer lager.
    Bemærk: Dette trin bruges til at forhindre hyppige fryse-tø cykler.

2. udarbejde standarder for kvantificering af T7 Phage genomisk DNA

  1. Seriefremstillede fortyndes 0,1 µg/µL (1,0 x 108 fg/µL) reference T7 phage DNA (købt, ved en kendt koncentration på 0,1 µg/µL, se materialer) 10-fold fra 1,0 x 106 til 1,0 x 100 fg/µL med ultra-rene H2O i 0,2 mL PCR rør. Forberede hver koncentration i en samlet maengde paa 20 µL (figur 2).
  2. Vortex PCR rør for at sikre grundig blanding på hvert trin af fortyndingen. Også ændre tips, når du tilføjer DNA-prøven til den følgende fortynding.
    Bemærk: Det anbefales at forberede nye opløsning af DNA standarder for en standardkurve for hver batch af qPCR eksperiment.
  3. Bruge ligningen 1 (nedenfor) til at konvertere til T7 phage reference DNA koncentrationer fra fg/µL til genom kopier (gc) /µL (figur 2).
  4. T7 phage DNA koncentration i gc/µL =
    Equation 1(1)
    Bemærk: bp: basepar; reference T7 genomisk DNA er 37314 bp.

3. forbehandling af Phage prøver før qPCR reaktion forberedelse

  1. (Mulighed 1) Med pipette overfoeres 20 µL af en T7 klon (phage) valgt fra biopanning mod in vitro- cystisk fibrose (CF)-ligesom Slim model til 1,5 mL centrifugeglas. Tilføje 1,25 enheder af DNase I (0,5 µL) til hver 20 µL prøve.
    Bemærk: T7 phage cystein begrænsede heptapeptid bibliotek (CX7C) var biopanned mod CF-lignende Slim belagt på 24-godt membran skær (Se Tabel af materialer) i 15 min. Yderligere oplysninger findes i afsnittet resultater. En T7 klon var valgt for qPCR prøveforberedelse fra eluatet.
    1. Valgmulighed 2: Afpipetteres 200 µL af T7 klon i en 1,5 mL rør, og tilføje 5 enheder af DNase jeg
      (2 µL) til hver prøve.
      Bemærk: Phage prøvemængden valgt på dette trin afhænger af, at den indsamlede mængde fra biopanning. Mens protokollen fokuserer på qPCR af biopanned phage, kit trin for biopanning er detaljeret i bruger protokollen af T7 phage (Se Tabel af materialer)13.
  2. Cap T7 phage Prøveglassene (trin 3.1) og dem der inkuberes ved 37 ° C i 10 min i en opvarmet tør bad (dvs. varme blok).
  3. Inkuber rør (fra trin 3.2) ved 100 ° C i 15 min i en opvarmet tør bad (figur 3A).
    Advarsel: Da fordampning og kondensering opstår under varme trin, skal du kontrollere, at 1,5 mL centrifugeglas er udjævnet helt.
  4. Spin de varmebehandlede phages fra trin 3.3 på 18,534 x g til 10 s. Mix phages ved at placere røret på en vortex-mixer indstillet på touch-aktivering tilstand for 10 s og spin på 18,534 x g i 10 s igen.
    Bemærk: Spin-mix-spin cyklus er at sørge for opvarmede phage prøver er godt blandet.
  5. Køle ned prøveglassene ved stuetemperatur (RT) ved at efterlade dem på eksperiment bænk eller opbevares ved 4 ° C i køleskab natten over.
    Bemærk: Eksperiment kan være midlertidigt på dette trin.

4. Forbered qPCR reaktioner

Bemærk: En PCR reaktion er for én prøve. Hver PCR reaktion indeholder 5 µL af qPCR master mix (Se materialer), 1 µL af 5 µM primer par mix, 2 µL af H2O og 2 µL af varmebehandlet T7 phage prøve. For flere PCR reaktioner, er alle reagenser undtagen phage prøve forblandet i én 1,5 mL tube. Mængden af hver reagens i premix afhænger af antallet af phage prøver for qPCR.

  1. Forberede qPCR premix til 10 biopanned phage prøver af ukendt koncentration og 7 eksempler på standard koncentrationer i tre eksemplarer. Som følge heraf er der 51 samlede prøver og derfor 51 qPCR reaktioner (dvs. én reaktion pr. prøve). 51 reaktioner, forberede en forblanding af 255 µL af qPCR master mix (51 x 5 µL), 51 µL af primere (51 x 1 µL) og 102 µL af H2O (51 x 2 µL).
    Bemærk: Det anbefales at forberede et par ekstra PCR reaktioner til at kompensere for den mængde tab under aliquoting PCR mix i hver brønd i 96-brønd qPCR plade.
  2. Alikvot 8 µL PCR premix til hvert hul i 96-brønd qPCR plade i alt 51 wells (dvs. 51 qPCR reaktioner). Der er ingen grund til at ændre tips under aliquoting.
  3. Tilsæt 2 µL af varmebehandlet T7 phage prøver (trin 3,4) eller T7 phage reference DNA (trin 2.1) til hver brønd (figur 3B); ændre tips, når du tilføjer forskellige DNA-prøver at nå at undgå krydskontaminering. Også, se bort fra de 2 µL DNA prøver under overfladen af qPCR premix (dvs. til 8 µL PCR premix).
  4. Forsegle qPCR plade med selvklæbende film.
    Bemærk: Dette trin er kritisk, uanset hvilken type af qPCR plade. Brug den anbefalede kit til at forsegle pladen helt; ellers, enhver ikke-forseglede region i pladen vil medføre tab af lydstyrke under PCR cykling.
  5. Wrap qPCR plade med alufolie at minimere fluorescens photobleaching og gå videre til at køre det på qPCR udstyr.

5. qPCR cykling betingelser

Bemærk: qPCR cykling betingelser blev sat på specifikke qPCR udstyr (Se Tabel af materialer).

  1. Køre 96-brønd qPCR plade på qPCR udstyr. Udstyr, Vælg indstillinger fra menu til at angive følgende eksperimentelle betingelser (figur 3 c).
  2. Opsætning af cykling betingelser som følger for en sample volumen af 10 µL: en cyklus ved 50 ° C i 2 min., en cyklus på 95 ° C i 2 min., efterfulgt af 40 cyklusser af (95 ° C i 15 s, 60 ° C i 1 min). Efter køre smelte kurve indstillinger: en cyklus på 95 ° C til 15 s, 60 ° C i 1 min., og 95 ° C 15.
  3. Gå videre til at analysere data, som beskrevet i trin 6.

6. analysere qPCR rå Data og konvertere fra qPCR Ct værdi til gc/µL til T7 Bakteriofager

  1. Analysere dataene, rå qPCR og evaluere datakvaliteten ved at analysere de karakteristiske parceller af de rå data (figur 4).
    Bemærk: Forstærkning plot, stand plot og smelte kurve plot er den vigtigste kendetegn grunde til at validere datakvaliteten af qPCR.
  2. Beregn de gennemsnitlige tærskelværdier cyklus (Ct) fra de tredobbelt prøver ved hver koncentration på standardkurven (trin 2.1).
    1. Plot gennemsnitlige Ct (Y) mod log (gc/µL) (X) for at få den lineære kurve Y = kX + b (k er hældningen af den lineære kurve, b er skæringspunktet).
    2. Beregne lineær udvidelseskoefficient14 R2 (R2 skal være > 0,99).
  3. Bruger standardkurven Y = kX + b til at beregne antallet af T7 phages i biopanning prøver (dvs. phages valgt mod CF-lignende slim) i gc/µL (figur 5).
    Bemærk: k er hældningen af standardkurven.
  4. Beregne forstærkning effektivitet ved følgende ligning
    Equation 2(2)
    Bemærk: k er hældningen af standardkurven genereres fra reference DNA qPCR. Den ideelle række forstærkning effektivitet er 90-110%.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Forskellige primer designværktøjer kan bruges til at designe qPCR primere. Typisk, primer design programmer har deres egne indbyggede algoritmer til at beregne og validere nøgleparametre primere, fx GC %, Tm, primer dimer eller hårnål dannelse, etc. generelt, de vigtigste kriterier er ens i forskellige primer designværktøjer og primere kan designes efter deres anvisninger. Primer BLAST kan bruges til at bekræfte den særlige karakter af primere. En primer parre dette mål opstrøms af den variable region T7 genomisk DNA er vist i figur 1. Hvis du vil bestemme de ukendte koncentrationer af phage prøver fra biopanning, en absolut blev kvantificering tilgang - standardkurven kvantificering - valgt til at optælle phage genomisk DNA kopier. Reference T7 phage DNA (Se materialer) på en kendt koncentration 0,1 µg/µL var seriefremstillede fortyndet fra 1,0 x 100 -1,0 x 106 fg / µL. ligning 1 blev brugt til at konvertere T7 phage DNA koncentrationer fra fg/µL til genom kopier (gc) / µL; reference T7 phage DNA koncentrationerne var 2,66 x 101 til 2,66 x 107 gc/µL (figur 2).

Efter forberede standardkurven fortyndinger af reference DNA, var én valgte CX7C T7 phage forberedt på qPCR (figur 3A). Kort, til at beskrive biopanning af den valgte phage: en begyndelseskoncentration 4.2 x 109 pfu T7 CX7C phage blev tilføjet på toppen af den apikale rum (donor) af en Transwell plade (Se Tabel af materialer) indeholdende 100 µL af CF-lignende slim og 600 µL af phosphat bufferet saltvand (PBS, se Tabel af materialer) i basolateral rum (modtager) og blev udruget i 15 min. ved stuetemperatur (25 ° C). Efter 15 min, blev der indsamlet eluatet i modtageren; fra eluatet, blev en CX7C T7 klon valgt til kvantificeres ved qPCR. qPCR reaktion forberedelse blev udført på isen med nødvendige reagenser (fx qPCR master mix, primere, H2O), som vist på figur 3B. QPCR cykling betingelser blev sat på en qPCR thermocycler at køre prøver (Se Tabel af materialer, figur 3 c).

Efter qPCR køre, forstærkning plot, smelte kurve plot og stand plot (figur 4) blev analyseret fra de rå data ved hjælp af software (Se Tabel af materialer). Forstærkning plot angiver succes eller fiasko af PCR-amplifikation af hver prøve. Stand plottet præsenterer forstærkning og henfald af fluorescens signal (reporter farvestof SYBR og baggrunden ROX farvestof) i hele forstærkning cyklusser. Smelt kurve plot bruges til at validere specificiteten af primere, da hver PCR produkt har en unik smeltepunktet (Tm).

Efter en evaluering af qPCR rådata kvalitet standardkurven blev genereret fra reference DNA: Ct værdier (Y) over log gc/µL (koncentration konvertering vist i figur 5); her, det var Y =-3.5188 X + 35.09 (R2= 0.999) (figur 5A og 5B). Forstærkning effektivitet blev beregnet til 92,4%. Standardkurven blev brugt til at interpolere ukendt koncentrationen af fortyndede T7 phage CX7C klon baseret på deres Ct-værdier. Alle referenceprøver og phage prøver blev kørt i tre eksemplarer, og deres gennemsnitlige Ct-værdier blev brugt til at beregne DNA koncentration i gc/µL (figur 5). Den indledende stamopløsning af T7 klon var seriefremstillede fortyndes for at validere stabilitet og repeterbarhed af qPCR til tælling af T7 phages5. På hver fortynding, blev prøver udarbejdet i tre eksemplarer. Dobbelt-lag plak analysen blev brugt som en referencemetode til at bestemme koncentrationen af T7 fortyndinger; metoder blev beskrevet tidligere5. I figur 6, de repræsentative resultater fra qPCR er vist i forhold til plaque assay på den testede række 101 -107 gc / µL. Titers eller antallet af phages fra qPCR kvantitering var højere end fra dobbelt-lag plak assay. Repeterbarhed af metoden qPCR repræsenteres af koefficienten for varians (CV) for koncentrationer fra 101 til 107 gc/µL. Resultaterne blev vist i tabel 1; CV % varierede fra 2,85 – 27,2%.

Figure 1
Figur 1: Primer design for T7-415 phage DNA vektor og nøgle parametre analyse af de designede primere. Oligo designværktøjer blev brugt til at designe flere par af primere for T7-415 phage DNA. Det ene sæt blev valgt efter validering af de vigtigste parametre for den primere, fx Tm, GC %, primer-dimer og hårnål dannelse. Venligst klik her for at se en større version af dette tal.

Figure 2
Figur 2: Standardkurven forberedelse og enhedskonvertering af T7 phage reference DNA. Seriel 10-fold fortyndinger blev foretaget fra 0,1 µg/µL T7 phage reference DNA til en standardkurve. Ligning 1 blev brugt til at konvertere DNA koncentrationer fra fg/µL til gc / µL. venligst klik her for at se en større version af dette tal.

Figure 3
Figur 3: Phage prøve behandling, qPCR reaktion forberedelse og qPCR køre. DNase jeg forbehandlet T7 phage prøver blev opvarmet ved 100° C i 15 min at frigive T7 DNA fra intakt phage partikler (A); qPCR blandingen var forberedt som beskrevet i protokollen. Alle forberedelser var udført på is (B); qPCR udstyr og kompatible software (C) blev brugt til at konfigurere de cykel betingelser, køre PCR-cykler, erhverve og analysere de rå data. Venligst klik her for at se en større version af dette tal.

Figure 4
Figur 4: karakteristiske parceller af qPCR rådata. Forstærkning plot, stand plot og smelte kurve plot er anskaffet fra en T7 phage CX7C klon fra biopanning mod in vitro- CF-lignende Slim barriere qPCR rådata. I den stand plot er passiv reference farvestof (ROX) et farvestof molekyle inkluderet i qPCR master mix, der ikke deltager i PCR-amplifikation og vil vise noget forstærkning signal i plottet. SYBR, som er SYBR grønne farvestof molekyle i qPCR master mix, vil give et fluorescens signal, der skal forstærke og forfald under qPCR cykling. Venligst klik her for at se en større version af dette tal.

Figure 5
Figur 5: analyse af rå data af qPCR at beregne gc/µL af T7 phage partikler. Tærskel cyklus (Ct) værdier på standardkurven T7 phage referencepunkt DNA (Y) var plottes logaritme transformation af kendte koncentrationer af reference DNA i gc/µL (X) at få standardkurven (A og B). Standardkurven blev brugt til at beregne X (log gc/µL) værdier af de ukendte koncentrationer af phage prøver baseret på deres Ct-værdier. (C) T7 phage koncentrationer i gc/µL kan beregnes. Også, beregning af qPCR forstærkning effektivitet er fastsat. Venligst klik her for at se en større version af dette tal.

Figure 6
Figur 6: Følsomhed og repeterbarhed resultaterne af qPCR optælle en T7 klon fra biopanning mod in vitro- CF-lignende Slim barriere. En T7 CX7C phage klon valgt fra biopanning eksperiment var seriefremstillede fortyndet i et koncentrationsområde (betegnet som E1-E7 til at repræsentere 101 -107) og i tre eksemplarer til qPCR og dobbelt-lag plak assay. Både qPCR og dobbelt-lag plak assay blev brugt til at kvantificere koncentrationen af T7 phage klon på hver fortynding. Data blev vist i middelværdi med standardafvigelse (SD) på hver skala for hver behandling. Venligst klik her for at se en større version af dette tal.

Repeterbarhed
Koncentration (gc/µL) CV data i %
10 1 27,2
10 2 7.65
10 3 2,85
10 4 15,7
10 5 15,6
10 6 5,03
10 7 4,71

Tabel 1: repeterbarhed af metoden qPCR for én T7 phage CX7C klon. Intra-variation blev testet på kvantificering skala fra 101 til 107 gc/µL til T7 klon DNA, variationskoefficienten (CV) blev beregnet som forholdet mellem standardafvigelsen på gennemsnittet at udtrykke repeterbarhed af qPCR metode. CVs blev beregnet i rækken af 2,85 – 27,2% på testet koncentrationer.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Vi udviklede qPCR metoder til at kvantificere phage genomisk DNA5, og her vi beskrevet og tilpasset en qPCR metode til at optælle T7 phages valgt mod CF-lignende Slim barriere. Minimumsoplysninger for offentliggørelse af kvantitative Real-Time PCR eksperimenter (MIQE) retningslinjer blev tilpasset til at udvikle og validere metoden qPCR opregning af T7 phages15. Den protokol, vi udviklede for at kvantificere phages fra biopanning eksperimenter er en tid-effektiv, pålidelig og økonomisk tilgang. Vores protokol for qPCR prøveforberedelse kun brugt høj temperatur behandling (100 ° C, 15 min) af phage løsning og kræver ikke phage DNA ekstraktion og oprensning skridt i forhold til konventionelle strategier11,17, 18. Også, du kan mere præcist optælle phage partikler, DNase blev føjet til phage løsning før høj temperatur behandling for at fjerne ikke-indkapslede phage DNA18,19,20. Ikke-indkapslede, resterende DNA i opløsningen phage kan medføre manglende indkapsling under phage forstærkning og/eller forringelse af phage partikler. Som et resultat for at nøjagtigt kvantificere antallet af intakt phage partikler ved hjælp af deres genomisk DNA, er DNase forbehandling afgørende for at forhindre, at artifactually høje værdier af phage genom kopier.

Der er mange overvejelser i forbindelse med udvikling og anvendelse af qPCR til nøjagtigt kvantificere phages. Variation af qPCR data kan forekomme overalt i protokollen og følgende skal anses for at opnå nøjagtige optælling. Det er vigtigt at sikre phage lysis med høj temperatur behandling og holde phage prøveglassene i forseglede betingelser for at forhindre efterfølgende udsving i stikprøven koncentration på grund af fordampning og kondensering af vand. En samlede volumen af PCR reaktion er små og kræver kalibreret pipets og pålidelige pipettering færdighed på hvert trin til forberedelse af prøven. Under qPCR cykling, pålidelig temperatur kontrollerende funktion er nødvendig for nøjagtig qPCR data og rutinemæssig kalibrering af den termiske cycler i qPCR instrument er nødvendig. Hvis du vil styre variationen, blev alternative trin beskrevet i protokollen. Hvis operatøren oplever problemer med lav volumen pipettering, kan samlede PCR reaktionen skaleres til 20 eller 25 µL. Udover de ovennævnte trin til fejlfinding kræver protokollen intern kontrol af standard DNA15,21,22,23. Som en absolut kvantificering metode bestemmer den lineær udvidelseskoefficient på standardkurven phage optælling datas detaljeringsgrad. Ved hjælp af en intern kontrol DNA i prøve løb kan minimere variationen fra forberedelse af prøver og qPCR udstyr.

I forhold til tidligere beskrevne phage kvantificering metoder, vores protokol giver mulighed for optælling af en bred vifte af phage koncentrationer og kan differentiere smitsomme og ikke-infektiøse phage partikler med og uden DNase behandling. Vores protokol er også attraktivt for kvantificering af et stort antal prøver, hvilket gør det mere omkostningseffektive, tid-effektive og high throughput sammenlignet med dobbelt lag plak assay og andre metoder.

I Resumé, kan denne protokol tilpasses til at optælle phage partikler i en lang række applikationer, herunder in vitro- og i vivo biopanning, phage bibliotek DNA forberedelse i næste generation sequencing og miljømæssige phage forurening.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne har ikke noget at oplyse.

Acknowledgments

Dette arbejde blev støttet af PhRMA Foundation forskning Starter Grant og National Heart, Lung og Blood Institute of National Institutes of Health tilskud under award nummer R01HL138251.

Materials

Name Company Catalog Number Comments
Materials and Reagents
Primers for T7 genomic DNA IDT F: CCTCTTGGGAGGAAGAGATTTG
R: TACGGGTCTCGTAGGACTTAAT
T7 Select packaging control DNA EMD Millipore 69679-1UG
MicroAmp optical 96-well reaction plate ThermoFisher Scientific N8010560
qPCR master mix--Power up SYBR Green master mix Applied biosystems A25742
MicroAmp optical adhesive film kit ThermoFisher Scientific 4313663
T7Select 415-1 Cloning Kit EMD Millipore 70015 User protocols : http://www.emdmillipore.com/US/en/product/T7Select-415-1-Cloning-Kit,EMD_BIO-70015#anchor_USP
DNase I solution ThermoFisher Scientific 90083
24-well transwell plate Corning 3472
UltraPure DNase/RNase-Free Distilled H2O Invitrogen 10977015
Phosphate Buffered Saline (1x) Corning 21040CV
Name Company Catalog Number Comments
Equipments
ViiA7 Real-Time PCR System with Fast 96-Well Block ThermoFisher Scientific 4453535
Heraeus Pico 21 Microcentrifuge ThermoFisher Scientific 75002415
Fisherbrand Digital Vortex Mixer Fisher Scientific 02-215-370
HERMO SCIENTIFIC Multi-Blok Heater ThermoFisher Scientific Model:2001
Sorvall Legend X1 Centrifuge ThermoFisher Scientific 75004220
M-20 Microplate Swinging Bucket Rotor ThermoFisher Scientific 75003624
Name Company Catalog Number Comments
Software
QuantStudio Real-time PCR software ThermoFisher Scientific v1.2
Real-time qPCR primer design IDT
OligoAnalyzer 3.1 IDT

DOWNLOAD MATERIALS LIST

References

  1. Smith, G. Filamentous fusion phage: novel expression vectors that display cloned antigens on the virion surface. Science. 228, (4705), 1315-1317 (1985).
  2. Smith, G. P., Petrenko, V. A. Phage Display. Chemical Reviews. 97, (96), 391-410 (1997).
  3. Sergeeva, A., Kolonin, M. G., Molldrem, J. J., Pasqualini, R., Arap, W. Display technologies: Application for the discovery of drug and gene delivery agents. Advanced Drug Delivery Reviews. 58, (15), 1622-1654 (2006).
  4. Dias-Neto, E., et al. Next-generation phage display: Integrating and comparing available molecular tools to enable costeffective high-throughput analysis. PLoS ONE. 4, (12), 1-11 (2009).
  5. Peng, X., Nguyen, A., Ghosh, D. Quantification of M13 and T7 bacteriophages by TaqMan and SYBR green qPCR. Journal of Virological Methods. 252, (June 2017), 100-107 (2017).
  6. Khan, M. S., Pande, T., Mvan de Ven, T. G. Qualitative and quantitative detection of T7 bacteriophages using paper based sandwich ELISA. Colloids and Surfaces B: Biointerfaces. 132, 264-270 (2015).
  7. Brasino, M., Lee, J. H., Cha, J. N. Creating highly amplified enzyme-linked immunosorbent assay signals from genetically engineered bacteriophage. Analytical Biochemistry. 470, 7-13 (2014).
  8. Yu, X., Burgoon, M., Shearer, A., Gilden, D. Characterization of phage peptide interaction with antibody using phage mediated immuno-PCR. J immunol Methods. 326, (1-2), 33-40 (2007).
  9. Lehmusvuori, A., Manninen, J., Huovinen, T., Soukka, T., Lamminmäki, U. Homogenous M13 bacteriophage quantification assay using switchable lanthanide fluorescence probes. BioTechniques. 53, (5), 301-303 (2012).
  10. Schlaman, H. R. M., et al. Analysis of interactions of signaling proteins with phage-displayed ligands by fluorescence correlation spectroscopy. Journal of Biomolecular Screening. 13, (8), 766-776 (2008).
  11. Tjhung, K. F., Burnham, S., Anany, H., Griffiths, M. W., Derda, R. Rapid enumeration of phage in monodisperse emulsions. Analytical Chemistry. 86, (12), 5642-5648 (2014).
  12. Reitinger, S., Petriv, O. I., Mehr, K., Hansen, C. L., Withers, S. G. Purification and quantitation of bacteriophage M13 using desalting spin columns and digital PCR. Journal of Virological Methods. 185, (1), 171-174 (2012).
  13. T7Select Biopanning Kit. Millipore Sigma. Available from: https://www.emdmillipore.com/US/en/product/T7Select-Biopanning-Kit,EMD_BIO-70018#anchor_USP (2018).
  14. Schneider, A., Hommel, G., Blettner, M. Linear Regression Analysis. Deutsches Ärzteblatt international. 107, (44), 776-782 (2010).
  15. Bustin, S. A., Benes, V., Garson, J. A., Hellemans, J., Huggert, J. The MIQE Guidelines: Minimun information for publication of quantitative real-time PCR experiments. Clinical Chemitry. 55, (4), 611-622 (2009).
  16. Lock, M., Alvira, M. R., Chen, S. -J., Wilson, J. M. Absolute Determination of Single-Stranded and Self-Complementary Adeno-Associated Viral Vector Genome Titers by Droplet Digital PCR. Human Gene Therapy Methods. 25, (2), 115-125 (2014).
  17. Fittipaldi, M., et al. Discrimination of infectious bacteriophage T4 virus by propidium monoazide real-time PCR. Journal of Virological Methods. 168, (1-2), 228-232 (2010).
  18. Lodder, W. J., et al. Reduction of bacteriophage MS2 by filtration and irradiation determined by culture and quantitative real-time RT-PCR. Journal of Water and Health. 11, (2), 256-266 (2013).
  19. Brown-Jaque, M., et al. Antibiotic resistance genes in phage particles isolated from human feces and induced from clinical bacterial isolates. International Journal of Antimicrobial Agents. (2017).
  20. Naveca, F. G., et al. Multiplexed reverse transcription real-time polymerase chain reaction for simultaneous detection of Mayaro, Oropouche, and oropouche-like viruses. Memorias do Instituto Oswaldo Cruz. 112, (7), 510-513 (2017).
  21. Jia, J., et al. Simultaneous detection and differentiation of human parvovirus B19 and human parvovirus 4 by an internally controlled multiplex quantitative real-time PCR. Molecular and Cellular Probes. 36, 50-57 (2017).
  22. Bliem, R., et al. A novel triplex quantitative pcr strategy for quantification of toxigenic and nontoxigenic Vibrio cholerae in aquatic environments. Applied and Environmental Microbiology. 81, (9), 3077-3085 (2015).
  23. Wan, Z., Goddard, N. L. Competition Between Conjugation and M13 Phage Infection in Escherichia coli in the Absence of Selection Pressure: A Kinetic Study. G3 Genes|Genomes|Genetics. 2, (10), 1137-1144 (2012).
Kvantitativ PCR af T7 Bacteriophage fra Biopanning
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Peng, X., Leal, J., Mohanty, R., Soto, M., Ghosh, D. Quantitative PCR of T7 Bacteriophage from Biopanning. J. Vis. Exp. (139), e58165, doi:10.3791/58165 (2018).More

Peng, X., Leal, J., Mohanty, R., Soto, M., Ghosh, D. Quantitative PCR of T7 Bacteriophage from Biopanning. J. Vis. Exp. (139), e58165, doi:10.3791/58165 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter