Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Immunology and Infection

Kwantitatieve PCR van T7 bacteriofaag van Biopanning

doi: 10.3791/58165 Published: September 27, 2018

Summary

Een reproduceerbare, accuraat en tijd efficiënt kwantitatieve PCR (qPCR) methode om op te sommen T7 bacteriofaag wordt hier beschreven. Het protocol geeft een duidelijke beschrijving van phage genomic DNA voorbereiding, PCR reactie voorbereiding, qPCR fietsen voorwaarden en qPCR data-analyse.

Abstract

Dit protocol beschrijft het gebruik van kwantitatieve PCR (qPCR) om op te sommen T7 bacteriofagen van phage selectie experimenten (dat wil zeggen, "biopanning"). qPCR is een fluorescentie gebaseerde aanpak te kwantificeren van DNA, en hier, het is aangepast aan het kwantificeren van phage genomen als een proxy voor phage deeltjes. In dit protocol wordt een facile phage DNA voorbereiding methode beschreven met behulp van hoge-temperatuur verwarming zonder extra DNA zuivering. De methode moet alleen kleine volumes van warmtebehandelde bacteriofagen en kleine volumes van de reactie van de qPCR. qPCR is hoge gegevensdoorvoer en snel, kunnen verwerken en het verkrijgen van gegevens van een 96-wells-plaat van reacties in 2-4 h. vergeleken tot andere faag opsomming benaderingen, qPCR is tijd-efficiënter. Hier, wordt qPCR gebruikt om op te sommen T7 bacteriofagen geïdentificeerd van biopanning tegen in vitro cystic fibrosis-achtige slijm model. De qPCR methode kan worden uitgebreid om te kwantificeren T7 bacteriofagen uit andere experimenten, met inbegrip van andere soorten biopanning (bv., faag screening geïmmobiliseerd binding aan eiwitten, in vivo ) en andere bronnen (bijvoorbeeld watersystemen of lichaamsvloeistoffen). Kortom, kan dit protocol worden aangepast voor het kwantificeren van virussen DNA ingekapseld.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Bacteriofaag (faag) display technologie, ontwikkeld door George Smith in 1985, is een krachtige, high-throughput benadering te identificeren van peptide of de proteïne liganden tegen doelstellingen of receptoren van het celmembraan, ziekte antigenen, cellulaire organellen of specifiek organen en weefsels in de afgelopen twee decennia1,2. Hier, willekeurige bibliotheken van polypeptiden of één keten antilichamen worden weergegeven op de vacht eiwitten van bacteriofagen (meestal M13 of T7), en specifieke liganden kunnen worden geïdentificeerd van pannen tegen geïmmobiliseerdet eiwitten in vitro of in vivo biologische systemen via een iteratieve selectietraject. Vervolgens kunnen liganden gepaard gaan met imaging of therapeutische agenten voor diagnose en behandeling van ziekten3,4. Het is van cruciaal belang om op te sommen nauwkeurig bacteriofagen tijdens meerdere stappen van biopanning: (1) te kwantificeren bacteriofagen die zich aan het substraat binden en (2) te kwantificeren bacteriofagen om te bepalen of er verrijking met elke ronde van de selectie (bacteriofaag verrijking geeft aan biopanned Phage affiniteit voor de doelgroep). De huidige gouden standaard voor kwantificering, dubbellaags plaque assay, presenteert meerdere uitdagingen; het is vervelend, omslachtige en potentieel onjuist is voor een groot aantal monsters. Daarom heeft onze fractie een gevoelige, reproduceerbaar, nauwkeurige en tijd-efficiënte kwantitatieve polymerase kettingreactie (qPCR) methode om te inventariseren M13 en T7 phage deeltjes van biopanning5ontwikkeld.

qPCR is een aantrekkelijke en haalbare methode om T7 en M13 bacteriofagen nauwkeurig te kwantificeren. Omdat elk deeltje van de individuele faag slechts één exemplaar van genomic DNA (dsDNA of ssDNA) bevatten kan, is een bacteriofaag genoom gelijk aan één phage deeltjes; door het kwantificeren van het aantal faag genomen, is het mogelijk te kwantificeren van het aantal bacteriofagen. Tijdens qPCR, fluorescerende verslaggever kleurstoffen binden genomic DNA van de bacteriofaag niet-specifiek of specifiek door middel van sequentie-specifieke primers tijdens PCR versterking, en de fluorescentie signaal verhoogt met elke ronde voor amplificatie. Wanneer het signaal van de fluorescentie bereikt de drempel, die ronde/cyclus van versterking is bekend als de drempel cyclus (Ct). De bekende concentraties van referentie phage DNA worden uitgezet tegen hun Ct-waarden om een standaard curve. Met behulp van de standaard curve met de Ct-waarden van DNA-monsters, kunnen de concentraties van bacteriofagen worden geïnterpoleerd.

Terwijl talrijke strategieën zijn eerder ontwikkeld en uitgebreid te kwantificeren bacteriofagen van biopanning gebruikt, heeft elk van hen specifieke uitdagingen. De meest populaire en conventionele methode is dubbellaags plaque assay. Hier, host bacteriën geïnfecteerd zijn met bacteriofagen voorbereid op een seriële verdunningen, op een solide agar substraat zijn verguld en zijn bedekt met agar; met het aantal plaques gevormd (dat wil zeggen, plaque vormende eenheden of pfu) op de agarplaat bacteriofagen geïnventariseerd. Plaque assay is gevoelig maar vervelend, tijdrovend en onnauwkeurig, vooral voor talloze voorbeelden en met hoge concentraties5. Enzyme-linked immunosorbent assays (ELISA) zijn bovendien aangepast om op te sommen M13 en T7 phage deeltjes6,7,8. Hier, bacteriofagen in verschillende verdunningen zijn gebonden en gevangen op een stevige ondergrond (dat wil zeggen, een microplate) gesondeerd met faag-specifieke antilichamen en opgespoord door middel van verslaggevers (bijvoorbeeld enzym gevoelige chromogenic substraten, fluorophores) te Bepaal het aantal phage deeltjes aanwezig. De uitlezingen (b.v., fluorescentie, absorptie) van monsters kunnen te kwantificeren van onbekende concentraties tegen faag normen bij bekende concentraties worden gebruikt. Verschillende faag gebaseerde ELISAs zijn ontwikkeld, maar ze hebben potentiële beperkingen. Een groep ontwikkelde een papieren sandwich-ELISA met een kwantificering bereik dat omvatte zeven ordes van grootte (102-109 pfu/mL); echter, deze methode vereist meerdere stappen van antilichaam coating, kwam een hele dag voor de test-8. Onze fractie ook ontwikkelde een ELISA-methode om te kwantificeren M13 phage deeltjes maar had een minder gevoelige registratiebereik van 106  1011 pfu/mL5. Schakelbare lanthanide fluorescentie sondes zijn ontwikkeld om te inventariseren M13 en kwantificering gegevens kunnen worden verkregen binnen 20 min; Deze bepaling heeft echter een smalle dynamisch bereik van 109 tot en met 1012 pfu/mL9. Één groep atomaire kracht microscopie gebruikt om op te sommen M13 phage deeltjes in oplossing, maar dit vereist geavanceerde elektronenmicroscopie en werkte slechts binnen een smalle bandbreedte van concentraties10. Een andere studie monodispers emulsies gebruikt om val fluorescerende M13 en T4 verslaggever bacteriofagen en bacteriofagen tellen het aantal fluorescerende druppels; echter, deze aanpak ook tentoongesteld een smalle kwantificering variëren van 102 tot en met 106 pfu/mL11. Terwijl de druppel die digitale PCR te kwantificeren M13 bacteriofagen is gebruikt, is deze aanpak kunnen onderscheid maken tussen het aantal infectieuze en niet-infectieuze phage deeltjes12.

Onze fractie heeft onlangs qPCR methoden voor het inventariseren van de T7 en M13 bacteriofagen geïdentificeerd van biopanning tegen een bloed - hersenbarrière cel model met twee verschillende fluorescente verslaggever kleurstoffen5ontwikkeld. In vergelijking met voornoemde kwantificering methoden, de methoden van de qPCR we ontwikkeld waren high-throughput en tijd-efficiënte te kwantificeren van talloze voorbeelden en bekwaam om te onderscheiden tussen infectieuze en niet-infectieuze bacteriofagen met DNase ik voorbehandeling van de Phage monsters. Nog belangrijker is, deze aanpak kan reproducibly en nauwkeurig te kwantificeren M13 en T7 bacteriofagen van biopanning monsters. Begeleiden van beginnende onderzoekers op het gebied van phage qPCR, beschrijven hier we een gedetailleerde qPCR methode om te inventariseren T7 phage deeltjes uit een bibliotheek van cysteïne-beperkt (CX7C) laten draaien tegen een in vitro -barrière van het cystic fibrosis (CF)-slijm. Van dit werk, kan qPCR methode worden uitgebreid om te kwantificeren van phage deeltjes van andere soorten biopanning en uit andere bronnen, met inbegrip van water, bodem en lichaamsvloeistoffen.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. primer ontwerp en analyse voor T7 Phage Genomic DNA

  1. Het ontwerpen van inleidingen voor versterking van T7 phage genomic DNA.
    Opmerking: F (in voorwaartse richting) en R (omgekeerde) inleidingen (Zie Tabel van materialen) versterken de T7 DNA-sequentie ligt stroomopwaarts van de bibliotheek variabele regio (Figuur 1).
  2. Kies een geschikte primer analyzer te evalueren van de parameters van de inleidingen, waaronder smelttemperatuur (Tm), percentage GC-inhoud (GC %), inleidingsdimeer, haarspeld vorming en PCR geschiktheid (Figuur 1).
  3. Bestel de primer oligonucleotides (oligos), en bij aankomst, resuspendeer de gelyofiliseerd oligos in DNase en RNase gratis ultra pure water 100 µM voorraad concentraties in een centrifugebuis 1,5 mL maken en opslaan bij-20 ° C voor enkele maanden.
  4. Verschillende hoeveelheden (ongeveer 50 µL in elke buis 1,5 mL) van de 100 µM primer voorraad maken.
    Opmerking: Deze stap wordt gebruikt om te voorkomen dat frequente bevriezen-ontdooien cycli.

2. voorbereiding van de normen voor kwantificering van T7 Phage Genomic DNA

  1. Serieel Verdun 0,1 µg/µL (1.0 x 108 fg/µL) referentie T7 phage DNA (gekocht; bij een bekende concentratie van 0,1 µg/µL, zie materialen) 10-fold van 1,0 x 106 tot en met 1.0 x 100 fg/µL met ultra zuivere H2O in 0,2 mL PCR buizen. Bereiden elke concentratie in een totaal volume van 20 µL (Figuur 2).
  2. Vortex PCR buizen zodat homogenisatie van het mengsel bij elke stap van verdunning. Ook veranderen tips bij het toevoegen van het DNA-monster met de volgende verdunning.
    Opmerking: Het wordt aanbevolen voor te bereiden op nieuwe oplossing van DNA normen een standaard curve voor elke batch van het qPCR-experiment.
  3. De vergelijking 1 (zie hieronder) gebruiken om te converteren voor T7 phage referentie DNA concentraties van fg/µL naar genoom kopieën (gc) /µL (Figuur 2).
  4. T7 phage DNA concentratie in gc/µL =
    Equation 1(1)
    Opmerking: bp: basenpaar; Referentie T7 genomic DNA is 37314 bp.

3. voorbehandeling van Phage monsters vóór qPCR reactie voorbereiding

  1. (Optie 1) Pipetteer 20 µL van een T7 kloon (faag) geselecteerd uit biopanning tegen in vitro cystic fibrosis (CF)-als slijm model in 1,5 mL centrifuge buizen. Toevoegen van 1,25 eenheden van DNase I (0,5 µL) bij elk monster 20 µL.
    Opmerking: T7 phage cysteïne beperkte heptapeptide bibliotheek (CX7C) werd biopanned tegen CF-achtige slijm bekleed op 24-well membraan inserts (Zie Tabel van materialen) gedurende 15 minuten. Verdere details vindt u in het gedeelte ' resultaten '. Een kloon van de T7 werd gekozen voor de bereiding van de monsters van de qPCR van het eluaat.
    1. Optie 2: Pipetteer 200 µL van de T7 klonen in een buizen 1,5 mL en voeg toe 5 eenheden van DNase ik
      (2 µL) aan elk monster.
      Opmerking: Het volume van phage monster geselecteerd bij deze stap is afhankelijk van het verzamelde volume van biopanning. Terwijl de focus van het protocol op de qPCR van biopanned bacteriofaag is, kit de stappen voor biopanning worden beschreven in het protocol van de gebruiker van de T7 phage (Zie Tabel van materialen)13.
  2. Cap de T7 phage monster buizen (stap 3.1) en hen Incubeer bij 37 ° C gedurende 10 minuten in een verwarmde droge bad (dat wil zeggen, warmte blok).
  3. Incubeer buizen (uit stap 3.2) bij 100 ° C gedurende 15 min. in een verwarmde droge bad (figuur 3A).
    Let op: Aangezien verdamping en condensatie tijdens de verwarming stap optreden, zorg ervoor dat de 1,5 mL centrifuge buizen volledig zijn afgetopt.
  4. Draai de warmtebehandelde bacteriofagen uit stap 3.3 bij 18,534 x g voor 10 s. Mix de bacteriofagen door het plaatsen van de buis op een vortex-mixer vastgesteldop touch-activering modus voor 10 s, en spin bij 18,534 x g gedurende 10 s weer.
    Opmerking: De spin-mix-spin-cyclus is om ervoor te zorgen dat de verwarmde faag monsters goed vermengd zijn.
  5. De buizen monster bij kamertemperatuur (RT) afkoelen door hen te verlaten op de experiment bankje of bewaren bij 4 ° C in een koelkast 's nachts.
    Opmerking: Experiment kan worden onderbroken bij deze stap.

4. bereid qPCR reacties

Opmerking: Een PCR reactie is voor één monster. Elke PCR reactie bevat 5 µL van qPCR meester Meng (Zie materiaal), 1 µL van 5 µM primer paar mix, 2 µL van H2O en 2 µL van warmtebehandelde T7 phage monster. Voor meerdere PCR reacties, zijn alle reagentia behalve faag monster vooraf gemengd in een tube van 1,5 mL. Het volume van elk reagens in de premix is afhankelijk van het aantal faag monsters voor qPCR.

  1. De qPCR premix voorbereiden op 10 biopanned faag monsters van de onbekende concentratie en 7 voorbeelden van standaard concentraties in drievoud. Dientengevolge, zijn er 51 alle monsters en daarom 51 qPCR Reacties (dat wil zeggen, een reactie per monster). 51 reacties, opstellen een premix van 255 µL van qPCR master mix (51 x 5 µL), 51 µL van inleidingen (51 x 1 µL) en 102 µL van H2O (51 x 2 µL).
    Opmerking: Het wordt aanbevolen om voor te bereiden van een paar extra PCR reacties om te compenseren voor het verlies van volume tijdens aliquoting de PCR-mix in elk putje van de qPCR van de 96-wells-plaat.
  2. Aliquot 8 µL van het PCR premix in elk putje van de plaat van de 96-Wells-qPCR voor een totaal van 51 wells (dat wil zeggen, 51 qPCR reacties). Er is geen behoefte om te veranderen van tips tijdens aliquoting.
  3. 2 µL van warmtebehandelde T7 phage monsters (stap 3.4) of T7 phage referentie DNA (stap 2.1) toevoegen aan elk putje (figuur 3B); tips bij het toevoegen van verschillende DNA-monsters naar de waterput ter voorkoming van kruisbesmetting wijzigen Ook afzien de 2 µL DNA-monsters onder het oppervlak van de qPCR premix (dat wil zeggen, in de 8 µL PCR premix).
  4. De qPCR plaat met kleeffilm zegel.
    Opmerking: Deze stap is van cruciaal belang, ongeacht het type van qPCR plaat. Gebruik de aanbevolen kit voor het afdichten van de plaat volledig; anders, iedere niet-verzegelde regio in de plaat volume verlies zal veroorzaken tijdens PCR fietsen.
  5. Wikkel de qPCR plaat met aluminiumfolie om te minimaliseren van de fluorescentie photobleaching en gaan draaien op de qPCR-apparatuur.

5. qPCR Cycling voorwaarden

Opmerking: qPCR fietsen voorwaarden werden opgericht op de specifieke qPCR-apparatuur (Zie Tabel van materialen).

  1. De qPCR van de 96-wells-plaat op de qPCR-apparatuur uitgevoerd. Op het apparaat door instellingen te selecteren in het menu de volgende proefomstandigheden (Figuur 3 c) instellen.
  2. Instellen als volgt voorwaarden een monstervolume van 10 µL fietsen: één cyclus bij 50 ° C gedurende 2 minuten, één cyclus bij 95 ° C gedurende 2 minuten, gevolgd door 40 cycli van (95 ° C gedurende 15 s, 60 ° C gedurende 1 min). Daarna lopen de smelt curve-instellingen: een cyclus van 95 ° C voor 15 s, 60 ° C gedurende 1 minuut, en 95 ° C 15 s.
  3. Ga verder met het analyseren van de gegevens, zoals beschreven in stap 6.

6. de qPCR Raw Data analyseren en omzetten van qPCR Ct waarde naar gc/µL voor T7 bacteriofagen

  1. De ruwe qPCR analyseren en evalueren van de kwaliteit van de gegevens door het analyseren van de karakteristieke percelen van de ruwe gegevens (Figuur 4).
    Opmerking: Versterking plot, multicomponent plot en smelt kromme plot zijn dat het voornaamste aspect percelen voor het valideren van de kwaliteit van de gegevens van qPCR.
  2. Bereken de gemiddelde drempelwaarden voor cyclus (Ct) van de drievoudige monsters bij elke concentratie van de standaard curve (stap 2.1).
    1. Uitzetten van de gemiddelde Ct (Y) tegen log (gc/µL) (X) om de lineaire curve Y = kX + b (k is de helling van de lineaire curve, b is het snijpunt).
    2. Berekenen van de coëfficiënt van de lineaire14 R2 (R2 moet > 0.99).
  3. Gebruik de standaard curve Y = kX + b voor de berekening van het aantal T7 bacteriofagen in de biopanning monsters (dat wil zeggen, bacteriofagen geselecteerd tegen CF-achtige slijm) in gc/µL (Figuur 5).
    Opmerking: k is de helling van de standaard curve.
  4. De efficiëntie van de versterking van de volgende vergelijking berekenen
    Equation 2(2)
    Opmerking: k is de helling van de standaard curve gegenereerd op basis van referentie DNA qPCR. Het ideale bereik van versterking efficiëntie is 90-110%.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Tools voor het ontwerpen van verschillende primer kunnen worden gebruikt om qPCR inleidingen ontwerpen. Typisch, primer ontwerp programma's hebben hun eigen ingebouwde algoritmen om te berekenen en valideren van de essentiële parameters van de inleidingen, bijvoorbeeld GC %, Tm, primer dimeer of haarspeld vorming, etc. in het algemeen, de belangrijkste criteria zijn vergelijkbaar in verschillende primer ontwerptoepassingen en inleidingen kunnen worden ontworpen hun instructies te volgen. Primer BLAST kan worden gebruikt ter bevestiging van de specificiteit van de inleidingen. Een primer koppel dat doelstellingen stroomopwaarts van de variabele regio van de T7 genomic DNA is afgebeeld in Figuur 1. Om te bepalen van de onbekende concentraties van phage monsters van biopanning, een absolute kwantificering aanpak - standaard curve kwantificering - gekozen bij het inventariseren van de bacteriofaag genomic DNA kopieën. Verwijst naar T7 phage DNA (Zie materiaal) met een bekende concentratie van 0,1 µg/µL was serieel verdund van 1.0 x 100 1.0 x 106 fg / µL. vergelijking 1 werd gebruikt om te converteren de T7 phage DNA concentraties van fg/µL genoom kopieën (gc) / µL; Referentie T7 phage DNA concentraties waren 2,66 x 101 tot 2,66 x 107 gc/µL (Figuur 2).

Na de voorbereiding van verdunningen van referentie DNA voor de kromme van het standaard, was één geselecteerde CX7C T7 phage voorbereid qPCR (figuur 3A). Kort om te beschrijven de biopanning van de geselecteerde bacteriofaag: een beginconcentratie van 4.2 x 109 pfu CX7C T7 phage is toegevoegd op de top van de apicale compartiment (donor) van een Transwell plaat (Zie Tabel van materialen) met 100 µL van CF-achtige slijm en 600 µL van fosfaat gebufferde zoutoplossing (PBS, Zie Tabel van materialen) in het basolaterale compartiment (ontvanger) en werd uitgebroed gedurende 15 minuten bij kamertemperatuur (25 ° C). Na 15 min, was het eluaat in de ontvanger verzameld; van het eluaat, werd één CX7C T7 kloon geselecteerd door qPCR worden gekwantificeerd. qPCR reactie voorbereiding werd uitgevoerd op ijs met nodige reagentia (bijvoorbeeld qPCR master mix, inleidingen, H2O), zoals aangegeven in figuur 3B. De qPCR fietsen voorwaarden werden op een qPCR thermocycler opgericht om te draaien de monsters (Zie Tabel van materialen, Figuur 3 c).

Na de qPCR uitvoeren, de amplificatie plot, smelt kromme plot en multicomponent plot (Figuur 4) werden geanalyseerd uit de ruwe gegevens met behulp van de software (Zie Tabel van materialen). De versterking plot geeft aan dat het succes of de mislukking van PCR versterking van elk monster. De multicomponent plot presenteert versterking en verval van fluorescentie signaal (verslaggever kleurstof SYBR en achtergrond ROX kleurstof) gedurende de versterking cycli. De plot van de kromme smelt wordt gebruikt voor het valideren van de specificiteit van de inleidingen, aangezien elke PCR product een unieke smelttemperatuur (Tm heeft).

Na evaluatie van de kwaliteit van de ruwe gegevens van de qPCR, was de standaard curve gegenereerd op basis van referentie DNA: Ct-waarden (Y) over log gc/µL (concentratie conversie afgebeeld in Figuur 5); het was hier, Y =-3.5188 X + 35.09 (R2= 0.999) (figuur 5A en 5B). De efficiëntie van de amplificatie werd 92,4% berekend. De standaard curve werd gebruikt voor het interpoleren van de onbekende concentratie van de verdunde T7 phage CX7C kloon op basis van hun Ct-waarden. Alle referentiemonsters en phage monsters werden uitgevoerd in drievoud, en hun gemiddelde Ct-waarden werden gebruikt voor het berekenen van de concentratie van het DNA in gc/µL (Figuur 5). De eerste stockoplossing van de T7 kloon was serieel verdund voor het valideren van de stabiliteit en herhaalbaarheid van qPCR de opsomming van de T7 bacteriofagen5. Bij elke verdunning, werden monsters voorbereid in drievoud. De dubbellaagse plaque assay werd gebruikt als een referentiemethode te bepalen van de concentraties van de T7 verdunningen; methoden werden beschreven eerder5. In Figuur 6, de representatieve resultaten van qPCR in vergelijking met plaque assay worden getoond bij het geteste bereik van 101 tot en met 107 gc / µL. Titers of aantal bacteriofagen van qPCR kwantificatie waren hoger dan van tweevoudig-stratum plaque assay. De herhaalbaarheid van de qPCR-methode wordt vertegenwoordigd door de coëfficiënt van de AVK (afwijking) voor concentraties van 101 tot en met 107 gc/µL. De resultaten zijn weergegeven in tabel 1; het AVK % varieerden van 2,85 – 27,2%.

Figure 1
Figuur 1: Primer ontwerp p.a. T7-415 phage DNA vector en de sleutel parameters van de ontworpen inleidingen. Oligo-ontwerpgereedschappen werden gebruikt voor het ontwerpen van meerdere paren van inleidingen voor T7-415 phage DNA. Één set werd geselecteerd na validatie van de essentiële parameters van de inleidingen, bijvoorbeeld Tm, GC %, primer-dimeer en haarspeld vorming. Klik hier voor een grotere versie van dit cijfer.

Figure 2
Figuur 2: voorbereiding van de standaard curve en eenheidconversie van T7 phage verwijst naar DNA. Seriële 10-fold verdunningen werden gemaakt van 0,1 µg/µL T7 phage referentie DNA voor de kromme van een standaard. Vergelijking 1 werd gebruikt om DNA concentraties van fg/µL omzetten in gc / µL. Klik hier voor een grotere versie van dit cijfer.

Figure 3
Figuur 3: Phage monster behandeling, qPCR reactie voorbereiding en qPCR uitvoeren. DNase ik voorbehandeld een T7 phage monsters werden verwarmd bij 100° C gedurende 15 minuten te laat de T7 DNA van intact phage deeltjes (A); het qPCR mengsel werd voorbereid zoals beschreven in het protocol. Alle voorbereidingen werden gedaan op ijs (B); qPCR apparatuur en compatibele software (C) werden gebruikt voor het instellen van de fietsen voorwaarden, het uitvoeren van de cycli van PCR, verwerven en analyseren van de ruwe gegevens. Klik hier voor een grotere versie van dit cijfer.

Figure 4
Figuur 4: Karakteristiek percelen van de ruwe gegevens qPCR. Versterking plot, multicomponent plot en smelt kromme plot overgenomen uit de ruwe gegevens van de qPCR van één T7 phage CX7C kloon van biopanning tegen in vitro CF-achtige slijm barrière. In het multicomponent perceel is de passieve referentie kleurstof (ROX) een molecule van de kleurstof opgenomen in de qPCR master mix die niet deelneemt aan de PCR versterking en geen versterking signaal zal tonen in de plot. SYBR, oftewel SYBR groene kleurstof molecuul in de master mix van qPCR, zorgt voor een fluorescentie-signaal dat moet versterken en verval tijdens qPCR fietsen. Klik hier voor een grotere versie van dit cijfer.

Figure 5
Figuur 5: analyse van de ruwe gegevens van de qPCR voor het berekenen van gc/µL van de T7 phage deeltjes. Drempel cyclus (Ct)-waarden van de standaard curve T7 phage referentiepunt DNA (Y) werden uitgezet tegen de logaritme transformatie van de bekende concentraties voor reference DNA in gc/µL (X) om de standaard curve (A en B). De standaard curve werd gebruikt voor het berekenen van de waarden van X (log gc/µL) van de onbekende concentraties van phage monsters op basis van hun Ct-waarden. (C) T7 phage concentraties in gc/µL kunnen worden berekend. Ook de berekening van de qPCR versterking efficiëntie is voorzien. Klik hier voor een grotere versie van dit cijfer.

Figure 6
Figuur 6: Resultaten van de gevoeligheid en herhaalbaarheid van qPCR bij het inventariseren van één T7 kloon van biopanning tegen in vitro CF-achtige slijm versperring. Één CX7C T7 phage kloon geselecteerd uit biopanning experiment was serieel verdund in een concentratiebereik (aangeduid als E1-E7 te vertegenwoordigen 101 tot en met 107) en in drievoud voor qPCR en dubbellaags plaque kwantitatieve analyse. Zowel de qPCR als de dubbellaagse plaque assay werden gebruikt om het kwantificeren van de concentratie van de T7 phage kloon bij elke verdunning. Gegevens werden getoond in gemiddelde waarde met de standaarddeviatie (SD) op elke schaal voor alle behandelde groepen. Klik hier voor een grotere versie van dit cijfer.

Herhaalbaarheid
Concentratie (gc/µL) CV-gegevens in %
10 1 27.2
10 2 7,65
10 3 2,85
10 4 15,7
10 5 15,6
10 6 5.03
10 7 4.71

Tabel 1: herhaalbaarheid van de qPCR-methode voor een T7 phage CX7C kloon. Tijdens variabiliteit werd getest op kwantificering schaal van 101 tot en met 107 gc/µL voor de T7 kloon DNA, de variatiecoëfficiënt (CV) werd berekend als de verhouding van de standaarddeviatie met de gemiddelde wil de herhaalbaarheid van de qPCR-methode. CVs werden in het bereik van 2,85 – 27,2% op voor de geteste concentraties berekend.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Wij qPCR methodes om te kwantificeren van phage genomic DNA5ontwikkeld, en hier wij beschreven en aangepast van een qPCR methode om te inventariseren T7 bacteriofagen geselecteerd tegen een versperring CF-achtige slijm. Minimuminformatie voor publicatie van kwantitatieve Real-Time PCR experimenten (MIQE) richtsnoeren werden aangepast om te ontwikkelen en valideren van de methode van de qPCR opsomming van de T7 bacteriofagen15. Het protocol dat wij ontwikkeld om te kwantificeren bacteriofagen uit biopanning experimenten is een tijd-efficiënte, betrouwbare en economische aanpak. Ons protocol voor de bereiding van de monsters van de qPCR alleen gebruikt hoge-temperatuur-behandeling (100 ° C, 15 min) van de bacteriofaag oplossing en did niet vergen phage DNA extractie en opzuivering stappen in vergelijking met conventionele strategieën11,17, 18. Ook, om te inventariseren hoe nauwkeuriger phage deeltjes, DNase toevoegde aan de oplossing van de bacteriofaag voorafgaand aan de hoge-temperatuur-behandeling voor het verwijderen van niet-ingekapseld phage DNA18,19,20. Non-ingekapseld, residuele DNA in de bacteriofaag oplossing kan leiden tot gebrek aan inkapseling tijdens faag versterking en/of degradatie van phage deeltjes. Dientengevolge, om nauwkeurig het aantal intact phage deeltjes gebruikend hun genomic DNA kwantificeren is DNase voorbehandeling van cruciaal belang om te voorkomen dat artifactually hoge waarden van phage genoom exemplaren.

Er zijn talloze overwegingen in de ontwikkeling en het gebruik van qPCR te bacteriofagen nauwkeurig te kwantificeren. Variatie van qPCR gegevens kan optreden in het gehele protocol en de volgende moet worden beschouwd als nauwkeurige opsomming bereiken. Het is belangrijk om te zorgen voor lysis van de bacteriofaag met behandeling van hoge-temperatuur en houden van phage monster buizen in verzegelde voorwaarden om te voorkomen dat latere schommelingen in de concentratie van het monster als gevolg van verdamping en condensatie van het water. Een totaal volume van PCR reactie is klein en vereist geijkte pipets en betrouwbare pipetting vaardigheid bij elke stap van de bereiding van de monsters. Tijdens qPCR fietsen, betrouwbare temperatuur controle functie noodzakelijk is om nauwkeurige qPCR gegevens en routine kalibratie van de thermische cycler in de qPCR instrument nodig is. Om variatie, werden alternatieve stappen beschreven in het protocol. Als de exploitant de moeilijkheid van het laag volume pipetteren ervaringen, kan de totale PCR reactie worden opgeschaald naar 20 of 25 µL. Naast de bovengenoemde stappen voor het oplossen van problemen vereist het protocol dat de interne controle van standaard DNA15,21,22,23. Als een absolute kwantificering methode bepaalt de lineaire coëfficiënt van standaard curve de nauwkeurigheid van de gegevens van de bacteriofaag opsomming. Met behulp van een interne controle DNA in het monster run kunt het minimaliseren van de variatie van de bereiding van de monsters en qPCR apparatuur.

Vergeleken met de eerder beschreven faag kwantificering methoden, ons protocol kunt opsomming van een breed scala van phage concentraties en infectieuze en niet-infectieuze phage deeltjes met en zonder DNase behandeling kan onderscheiden. Ons protocol is ook aantrekkelijk voor het kwantificeren van een groot aantal monsters, waardoor het meer kosteneffectieve, tijd-efficiënte en hoge doorvoer in vergelijking met dubbele laag plaque assay en andere methoden.

Kortom, kan dit protocol worden aangepast aan het opsommen van phage deeltjes in een verscheidenheid van toepassingen, met inbegrip van in vitro en in vivo biopanning, faag bibliotheek DNA voorbereiding in de volgende-generatie sequencing en milieu phage besmetting.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

De auteurs hebben niets te onthullen.

Acknowledgments

Dit werk werd gesteund door PhRMA Stichting onderzoeksbeurs Starter en de nationale hart-, Long- en bloed Instituut van het National Institutes of Health verlenen award onder nummer R01HL138251.

Materials

Name Company Catalog Number Comments
Materials and Reagents
Primers for T7 genomic DNA IDT F: CCTCTTGGGAGGAAGAGATTTG
R: TACGGGTCTCGTAGGACTTAAT
T7 Select packaging control DNA EMD Millipore 69679-1UG
MicroAmp optical 96-well reaction plate ThermoFisher Scientific N8010560
qPCR master mix--Power up SYBR Green master mix Applied biosystems A25742
MicroAmp optical adhesive film kit ThermoFisher Scientific 4313663
T7Select 415-1 Cloning Kit EMD Millipore 70015 User protocols : http://www.emdmillipore.com/US/en/product/T7Select-415-1-Cloning-Kit,EMD_BIO-70015#anchor_USP
DNase I solution ThermoFisher Scientific 90083
24-well transwell plate Corning 3472
UltraPure DNase/RNase-Free Distilled H2O Invitrogen 10977015
Phosphate Buffered Saline (1x) Corning 21040CV
Name Company Catalog Number Comments
Equipments
ViiA7 Real-Time PCR System with Fast 96-Well Block ThermoFisher Scientific 4453535
Heraeus Pico 21 Microcentrifuge ThermoFisher Scientific 75002415
Fisherbrand Digital Vortex Mixer Fisher Scientific 02-215-370
HERMO SCIENTIFIC Multi-Blok Heater ThermoFisher Scientific Model:2001
Sorvall Legend X1 Centrifuge ThermoFisher Scientific 75004220
M-20 Microplate Swinging Bucket Rotor ThermoFisher Scientific 75003624
Name Company Catalog Number Comments
Software
QuantStudio Real-time PCR software ThermoFisher Scientific v1.2
Real-time qPCR primer design IDT
OligoAnalyzer 3.1 IDT

DOWNLOAD MATERIALS LIST

References

  1. Smith, G. Filamentous fusion phage: novel expression vectors that display cloned antigens on the virion surface. Science. 228, (4705), 1315-1317 (1985).
  2. Smith, G. P., Petrenko, V. A. Phage Display. Chemical Reviews. 97, (96), 391-410 (1997).
  3. Sergeeva, A., Kolonin, M. G., Molldrem, J. J., Pasqualini, R., Arap, W. Display technologies: Application for the discovery of drug and gene delivery agents. Advanced Drug Delivery Reviews. 58, (15), 1622-1654 (2006).
  4. Dias-Neto, E., et al. Next-generation phage display: Integrating and comparing available molecular tools to enable costeffective high-throughput analysis. PLoS ONE. 4, (12), 1-11 (2009).
  5. Peng, X., Nguyen, A., Ghosh, D. Quantification of M13 and T7 bacteriophages by TaqMan and SYBR green qPCR. Journal of Virological Methods. 252, (June 2017), 100-107 (2017).
  6. Khan, M. S., Pande, T., Mvan de Ven, T. G. Qualitative and quantitative detection of T7 bacteriophages using paper based sandwich ELISA. Colloids and Surfaces B: Biointerfaces. 132, 264-270 (2015).
  7. Brasino, M., Lee, J. H., Cha, J. N. Creating highly amplified enzyme-linked immunosorbent assay signals from genetically engineered bacteriophage. Analytical Biochemistry. 470, 7-13 (2014).
  8. Yu, X., Burgoon, M., Shearer, A., Gilden, D. Characterization of phage peptide interaction with antibody using phage mediated immuno-PCR. J immunol Methods. 326, (1-2), 33-40 (2007).
  9. Lehmusvuori, A., Manninen, J., Huovinen, T., Soukka, T., Lamminmäki, U. Homogenous M13 bacteriophage quantification assay using switchable lanthanide fluorescence probes. BioTechniques. 53, (5), 301-303 (2012).
  10. Schlaman, H. R. M., et al. Analysis of interactions of signaling proteins with phage-displayed ligands by fluorescence correlation spectroscopy. Journal of Biomolecular Screening. 13, (8), 766-776 (2008).
  11. Tjhung, K. F., Burnham, S., Anany, H., Griffiths, M. W., Derda, R. Rapid enumeration of phage in monodisperse emulsions. Analytical Chemistry. 86, (12), 5642-5648 (2014).
  12. Reitinger, S., Petriv, O. I., Mehr, K., Hansen, C. L., Withers, S. G. Purification and quantitation of bacteriophage M13 using desalting spin columns and digital PCR. Journal of Virological Methods. 185, (1), 171-174 (2012).
  13. T7Select Biopanning Kit. Millipore Sigma. Available from: https://www.emdmillipore.com/US/en/product/T7Select-Biopanning-Kit,EMD_BIO-70018#anchor_USP (2018).
  14. Schneider, A., Hommel, G., Blettner, M. Linear Regression Analysis. Deutsches Ärzteblatt international. 107, (44), 776-782 (2010).
  15. Bustin, S. A., Benes, V., Garson, J. A., Hellemans, J., Huggert, J. The MIQE Guidelines: Minimun information for publication of quantitative real-time PCR experiments. Clinical Chemitry. 55, (4), 611-622 (2009).
  16. Lock, M., Alvira, M. R., Chen, S. -J., Wilson, J. M. Absolute Determination of Single-Stranded and Self-Complementary Adeno-Associated Viral Vector Genome Titers by Droplet Digital PCR. Human Gene Therapy Methods. 25, (2), 115-125 (2014).
  17. Fittipaldi, M., et al. Discrimination of infectious bacteriophage T4 virus by propidium monoazide real-time PCR. Journal of Virological Methods. 168, (1-2), 228-232 (2010).
  18. Lodder, W. J., et al. Reduction of bacteriophage MS2 by filtration and irradiation determined by culture and quantitative real-time RT-PCR. Journal of Water and Health. 11, (2), 256-266 (2013).
  19. Brown-Jaque, M., et al. Antibiotic resistance genes in phage particles isolated from human feces and induced from clinical bacterial isolates. International Journal of Antimicrobial Agents. (2017).
  20. Naveca, F. G., et al. Multiplexed reverse transcription real-time polymerase chain reaction for simultaneous detection of Mayaro, Oropouche, and oropouche-like viruses. Memorias do Instituto Oswaldo Cruz. 112, (7), 510-513 (2017).
  21. Jia, J., et al. Simultaneous detection and differentiation of human parvovirus B19 and human parvovirus 4 by an internally controlled multiplex quantitative real-time PCR. Molecular and Cellular Probes. 36, 50-57 (2017).
  22. Bliem, R., et al. A novel triplex quantitative pcr strategy for quantification of toxigenic and nontoxigenic Vibrio cholerae in aquatic environments. Applied and Environmental Microbiology. 81, (9), 3077-3085 (2015).
  23. Wan, Z., Goddard, N. L. Competition Between Conjugation and M13 Phage Infection in Escherichia coli in the Absence of Selection Pressure: A Kinetic Study. G3 Genes|Genomes|Genetics. 2, (10), 1137-1144 (2012).
Kwantitatieve PCR van T7 bacteriofaag van Biopanning
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Peng, X., Leal, J., Mohanty, R., Soto, M., Ghosh, D. Quantitative PCR of T7 Bacteriophage from Biopanning. J. Vis. Exp. (139), e58165, doi:10.3791/58165 (2018).More

Peng, X., Leal, J., Mohanty, R., Soto, M., Ghosh, D. Quantitative PCR of T7 Bacteriophage from Biopanning. J. Vis. Exp. (139), e58165, doi:10.3791/58165 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter