Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Biochemistry

Ein Oligonukleotid-basierte Tandem RNA Isolierung Vorgehensweise eukaryotischen mRNA-Protein-komplexe

doi: 10.3791/58223 Published: August 18, 2018
* These authors contributed equally

Summary

Ein Tandem RNA Isolierung (Reise) für die Verwertung von endogen gebildeten mRNA-Protein-komplexe Vorgehensweise wird. Speziell, RNA-Protein-komplexe sind vernetzt in VivoPolyadenylated RNAs sind isoliert aus Extrakten mit oligo(dT) Perlen und besonderen mRNAs werden mit modifizierten RNA antisense Oligonukleotide erfasst. Proteine gebunden, mRNAs werden vom Immunoblot Analyse erkannt.

Abstract

RNA-bindende Proteine (RBPs) spielen eine wichtige Rolle bei der Posttranskriptionale Kontrolle der Genexpression. Biochemische Charakterisierung der mRNA-Protein-komplexe ist daher für das Verständnis der mRNA-Verordnung abgeleitet von interagierenden Proteine oder nicht-kodierende RNAs. Hier beschreiben wir ein Tandem RNA Isolierung Verfahren (Reise), das die Reinigung von endogen gebildeten mRNA-Protein-komplexe aus Zellextrakten ermöglicht. Das zweistufige Protokoll beinhaltet die Isolierung von Polyadenylated, die mRNAs mit antisense oligo(dT) Perlen und spätere eine mRNA des Interesses mit 3' biotinylierte 2'-O-methyliert antisense RNA-Oligonukleotide, die dann mit isoliert werden können, zu erfassen Streptavidin-Perlen. Reise war wieder in Vivo querverbunden mRNA-Ribonucleoprotein (mRNP) komplexe aus Hefe, Nematoden und menschlichen Zellen für weitere RNA und Protein-Analyse verwendet. Reise ist ein vielseitiger Ansatz, der angepasst werden kann für alle Arten von Polyadenylated RNAs in Organismen, die dynamische Neuordnung der mRNPs auferlegten intrazelluläre oder ökologische Hinweise zu studieren.

Introduction

Posttranskriptionelle Genregulation wird angetrieben durch die Wechselwirkungen zwischen RNA-bindende Proteine (RBPs), nicht-kodierende RNAs (NcRNAs) und mRNAs, die direkte Verarbeitung, Lokalisierung, Übersetzung und Zerfall von jedem Protokoll innerhalb von Zellen1 , 2. Ermittlung des RBPs und NcRNA Interaktion mit bestimmten mRNAs, Einrichtung, das sogenannte Ribonucleoprotein komplexe/Partikel (RNPs), ist daher Schlüssel zum Verständnis des Schicksals der mRNAs und gen-Expressions. Komplementäre Ansätze werden durchgeführt für Biochemische Charakterisierung von RNP-komplexe3,4: während der "Protein-centric" Ansatz auf die Reinigung von bestimmten RBPs basiert, der "RNA-centric" Ansatz beinhaltet die Isolation von Teilpopulationen oder einzelnen RNAs und anschließende Analyse der interagierenden Proteine oder RNA. Vor kurzem, eine RNA-orientierten Ansatz zur Identifizierung von Interaktion mit Polyadenylated RBP-Repertoire (poly(A)) RNAs5 zunehmend populär geworden durch den Einbau eines ultravioletten (UV) Licht Vernetzung Schritt, um Protein-RNA zu stabilisieren Interaktionen vor die Isolierung der mRNAs, die drastisch den Katalog der RBPs in menschlichen Zellen6,7,8,9,10,11 erweitert, Caenorhabditis elegans 12, Saccharomyces Cerevisiae12,13,14, und andere Organismen15,16,17,18, 19,20. Die Zuordnung von Proteinen und/oder NcRNAs montiert auf bestimmte Protokolle ist jedoch nach wie vor eine große Herausforderung. Zu diesem Zweck werden derzeit zwei Hauptansätze verwendet: auf der einen Seite RNA Aptamer Tags sind verschmolzen, die RNA von Interesse um Affinitätsreinigung zu ermöglichen. Dabei binden die RNA aptameren mit hoher Affinität, aminoglykosid-Antibiotika, einschließlich Tobramycin und Streptomycin21,22,23,24, oder Proteine, wie z.B. das Hüllprotein aus der R17/MS2 Bakteriophagen oder bakterielle Streptavidin S125,26,27,28,29. Obwohl dieser Ansatz gezeigt wurde, relativ robust und vielseitig sein, es erfordert Klonen Design der RNA untersucht und daher nicht verwendet werden, um natürliche mRNAs zu erfassen. Auf der anderen Seite antisense Oligonukleotide (ASOs) dienten schon früh für die Erholung und Charakterisierung von stark ausgedrückt, native RNPs30,31 und viralen RNAs32. In jüngerer Zeit, ASOs wurden eingesetzt, um lange nicht kodierende RNAs33,34,35 zu erfassen und in Vitro gebildet mRNPs36. Ein großer limitierender Faktor mit allen RNA zentrierten Ansätzen ist die Kopienzahl der RNA von Interesse, so dass die Erholung der niedrigen ausgedrückt mRNAs problematischer. Diese Einschränkung kann durch die Reaktion upscaling überwunden werden; Dies kann jedoch möglicherweise führen zur Steigerung der Hintergrund.

Hier beschreiben wir unsere neu entwickelte ASO-basierten Tandem RNA Isolierung Verfahren (Reise) zu isolieren, native mRNA-Protein-komplexe mit hoher Selektivität37 (Abbildung 1). Das Protokoll beinhaltet zwei sequentielle ASO-basierte Reinigungsschritte, nämlich die Isolation von poly(A) mRNAs mit handelsüblichen oligo(dT) Perlen, gefolgt von der Erfassung der spezifischen mRNAs mit speziell gestalteten kurze biotinylierte 2'-Methoxy gekoppelt RNA ASOs. Dieses zweistufige Verfahren hilft beseitigen kontaminierende Proteine und Möglichkeiten zur Anpassung und Optimierung. In diesem Fall Reise wurde auf ausgewählte mRNAs aus Hefe, Nematoden, angewendet und menschliche Zellen in Vivo bestätigen gebildet mRNA-Protein-komplexe.

Protocol

1. Design Antisense Oligonukleotide (ASOs)

  1. Analysieren Sie die Sekundärstruktur der mRNA oder ein Fragment davon mit verfügbaren Online-Werkzeuge38. Geben Sie deshalb die Nukleotidsequenz (nt) in das leere Feld. Wählen Sie im Feld Basisoptionen Minimum freie Energie (MFE) und Partitionsfunktion und vermeiden isolierte Basenpaare. Wählen Sie im Ausgabe-Optionen interaktive RNA Sekundärstruktur Plot und klicken Sie abschließend auf die Schaltfläche " fortfahren ". Ein neues Fenster öffnet sich, die die Sekundärstruktur der mRNA von Interesse zeigt.
  2. Wählen Sie mindestens drei verschiedene 21-24 Nts lange Sequenzen innerhalb der mRNA von Interesse, bevorzugt in Regionen fehlen nachweisbare Sekundärstrukturen (zB., in unstrukturierten Schleifen) und in 3' unübersetzt Regionen (UTR).
    Hinweis: Es wurde beobachtet, dass am besten ASOs glühen auf Sequenzen in den 3' unübersetzt Regionen (UTR) durchgeführt. Eine Möglichkeit ist, dass Ribosomen gebunden, die kodierende Sequenz (CDS) gelegentlich behindern können das Glühen von ASOs. ASOs glühen, 5' wo wurden nicht getestet.
    1. Wählen Sie die Regionen mit einer Guanidin/Cytosin Verhältnis in der Nähe von 50 % und fehlen Nukleotid Tandem wiederholt um mögliche Bildung von Haarnadeln oder selbst Glühen zu vermeiden.
  3. Manuell geändert Design 2'-Methoxy RNA-Oligonukleotide mit einer Biotin Glyko-an die 3', vollständig komplementär zu den ausgewählten Regionen (Schritt 1.2) innerhalb der gewünschten Zielgruppe mRNA.
    Hinweis: 2'-Methoxy-Modifikationen machen den RNA-resistent gegen zelluläre RNases und erhöht den Duplex Schmelztemperatur, ermöglicht eine stringente waschen. Das Biotin Glyko-ist erforderlich für die Aufnahme von ASOs mit Streptavidin.
    1. Passen Sie die Schmelztemperatur der RNA-Hybriden auf ~ 60-65 ° C und stellen Sie sicher, dass es eine hohe sprachliche Abfolge Komplexität hat (> 60 %) mit geeigneten online-Tools39bestimmt.
    2. Verwenden Sie die grundlegende lokale Ausrichtung Suchwerkzeug40 Suche nach potenziellen ASO Kreuz-Hybridisierung mit anderen mRNAs in das Transkriptom. Wählen Sie Nukleotid-Explosion, einfügen Sie die Sequenzen in das leere Feld und den Organismus von Interesse. Halten Sie die verbleibenden Parameter als Standard, und klicken Sie auf Explosion.
      Hinweis: Auch teilweise kontinuierliche Ausrichtung von 8-10 Nts kann zu Kreuz-Hybridisierung und Erholung von dieser mRNA führen.

2. Handy-Kultur, UV-Bestrahlung und Zelle Lysis

Hinweis: Im folgenden wird das Vorgehen ist für angehende Hefe S. Cerevisiae, Nematoden C. Elegansund menschlichen embryonalen Nierenzellen (HEK293). Dennoch kann es auf andere Organismen als auch angepasst werden, obwohl es noch nicht explizit getestet wurde.

  1. S. cerevisiae
    1. Hefezellen wachsen (zB., Stamm BY4743 Ableitung; MATa/α his3Δ1/his3Δ1 leu2Δ0/leu2Δ0 LYS2/lys2Δ0 met15Δ0/MET15 ura3Δ0/ura3Δ0 PFK2:TAP / PFK2) in 500 mL YPD Medien (1 % Hefeextrakt, 2 % Pepton, 2 % D-Glucose) bei 30 ° C mit konstanter schütteln bei 220 u/min.
    2. Sammeln sich die Zellen an Mid Log-Phase (Extinktion bei 600 nm (OD)600 ~ 0,6) durch Filtration mit 0,45 µm-Nylon-Filter oder durch Zentrifugation bei 3.000 × g für 2 min bei Raumtemperatur (RT). Verwerfen Sie die Flow-through oder der Überstand bzw..
    3. Waschen Sie die Zellen dreimal mit 25 mL von Phosphat-gepuffert-Kochsalzlösung (PBS) mit dem 0,45 µm-Nylon-Filter oder durch Zentrifugation bei 3.000 × g für 2 min bei RT sammeln Sie und verwerfen Sie den überstand. Sammeln Sie die Zellen so schnell wie möglich da der auferlegte Stress auf RNA-Protein-Interaktionen auswirken könnte.
    4. Aufschwemmen Sie die Zellen in 25 mL PBS und Gießen Sie dann die Suspension in einem 15 cm Petrischale. Legen Sie das Gericht auf Eis, entfernen Sie den Deckel und setzen Sie die Zellen dreimal mit 400 mJ cm-2 von 254 nm UV-Licht in einer UV-Vernetzer mit Pausen von 2 min auf Eis zwischen jeder bestrahlungszyklus mit schonendes mischen.
    5. Übertragen Sie die Zellen auf ein 50 mL-Tube und sammeln Sie die Zellen durch Zentrifugation bei 3.000 × g für 3 min bei 4 ° C. Verwerfen Sie den überstand und halten Sie das Pellet.
      Hinweis: Zellen können Snap in flüssigem Stickstoff eingefroren und bei-80 ° c gelagert werden.
    6. Aufschwemmen der Zellen in 4 mL gekühlten Lyse Puffer A (LB-A; 100 mM Tris-HCl, pH 7.5, 500 mM LICI, 10 mM EDTA, 1 % Triton x-100, 5 mM DVB-t, 20 U ml-1 DNase I, 100 U ml-1 RNasin, komplett EDTA-freie Protease-Inhibitor Cocktail).
    7. Übertragen Sie die Zellen in zwei 2 mL-Tuben. Max hinzufügen. ⅔ Datenmengen gekühlt Glasperlen und stören die Zellen in einem Gewebe Lyser bei 30 Hz für 10 min bei 4 ° C.
    8. Stanzen Sie ein Loch in den Boden des Röhrchens mit einer heißen Nadel und übertragen die lysate zu einem frischen 1,5 mL Schlauch durch Zentrifugation bei 600 × g für 30 s.
    9. Lysate von drei sequenziellen Centrifugations bei 4 ° C bei 3.000 × g für 3 min, dann 5.000 × g und 10.000 × g für 5 min klar.
      Hinweis: Extrakte können Snap in flüssigem Stickstoff eingefroren und bei-80 ° c gelagert
  2. C. elegans
    1. Kultur-Bristol-N2 worms bei 20 ° C auf Nematoden Wachstum Medium (NGM) Platten (0,3 % NaCl, 1,7 % Agar, 0,25 % Pepton, 1 mM CaCl2, 5 µg/mL Cholesterin, 1 mM MgSO4, 25 mM KPO4 Puffer, pH 6.0) ausgesät mit OP50 Escherichia-coli -Stamm 41 .
    2. Jede Platte fügen Sie 5 mL M9 Puffer41 (0,3 % KH2PO4, 0,6 % Na2HPO4, 0,5 % NaCl, 1 mM MgSO4 hinzu), schütteln Sie die Platte, um die Würmer aufschwemmen und übertragen Sie die Würmer auf eine 15 mL-Tube. 2 µL der Suspension in einer Folie und zählen Sie die Würmer in der Suspension mit einem Mikroskop. Wenden Sie dann den Faktor zur Berechnung der Anzahl der Würmer pro Platte.
    3. Sammeln ~ 120.000 Würmer durch Zentrifugation bei Raumtemperatur (400 × g, 2 min, RT) und den überstand verwerfen.
    4. Waschen Sie die Würmer dreimal. Daher 10 mL M9 Puffer, mischen durch Umkehrung und sammeln Sie die Würmer durch Zentrifugation bei 400 × g für 2 min bei RT
    5. Die Würmer 15 mL M9 Puffer hinzu, und legen Sie auf einem rotatorischen Rad für 15 min bei RT
    6. Übertragen Sie die Würmer auf NGM Platten (~ 4.000 Würmer pro Teller) und UV-Licht aussetzen (254 nm) bei 300 mJ cm-2 in einer UV-Vernetzer.
    7. Fügen Sie 5 mL M9 Puffer direkt auf die Platte und schütteln Sie die Platte, um die Würmer im Puffer aufzuwirbeln. Übertragen Sie die Suspension mit einer Pipette auf eine 15 mL-Tube und sammeln Sie die Würmer durch Zentrifugation bei 400 × g für 2 min bei RT
    8. Aufschwemmen der Würmer in 2 mL Lyse Puffer B (LB-B; 100 mM Tris-HCl, pH 8.0, 150 mM NaCl, 1 mM EDTA, 0,75 % IGEPAL, 1 mM DVB-t, 20 U mL-1 DNase I, 100 U mL-1 RNasin, komplett EDTA-freie Protease-Inhibitor Cocktail).
    9. Schleifen Sie die Würmer in einem Mörser mit flüssigem Stickstoff gefüllt. Sammeln Sie das Pulver in ein 50 mL-Tube und Tauwetter bei RT
      Hinweis: Flüssigstickstoff muss nach Sicherheitsverfahren (z. B. Rauch Kapuze und Sicherheit Handschuhe) behandelt werden
    10. Löschen der lysate einschließlich der Fettschicht durch Zentrifugation bei 14.000 × g für 10 min und übergeben Sie anschließend das geklärte lysate durch einen 0,45-μm-Filter mit einer Spritze.
  3. Menschlichen kultivierten Zellen
    Hinweis: Die folgende Beschreibung basiert auf Transiente Transfektion von HEK293 Zellen mit pGL3-CDKN1B-3'UTR Reporter Plasmid, das die 3′UTR von CDKN1B/27 flussabwärts von Firefly Luciferase-gen42ausdrückt.
    1. Kultur HEK293 Zellen in Dulbeccos geändert Eagle Medium (DMEM) mit Glukose 25 mM und 1 mM Natrium Pyruvat, ergänzt mit 100 U mL-1 Penicillin, 100 µg mL-1 Streptomycin und 10 % fetalen bovine Serum (FBS) und Inkubation bei 37 ° C in einem Feuchte Kammer (Inkubator) mit 5 % CO2.
    2. Samen ~ 3 × 106 HEK293 Zellen in einer Gewebekultur standard 10 cm Gericht am Vortag die Transfektion. Zählen Sie die Zellen mit einem Hemocytometer.
    3. Mix 2 µg des Reporter-Gens (zB., pGL3-p27-3'UTR) mit 20 µL Transfection Reagens und transfizieren Zellen bei 70 % Konfluenz (~ 7 × 106 Zellen).
    4. Platzieren Sie die Zellen in einem Inkubator bei 37 ° C für weitere 48 h vor der Ernte.
    5. Entfernen Sie das Medium mit einer serologischen Pipette und waschen Sie schnell die Zellen zweimal mit 10 mL PBS bei 37 ° c vorgewärmt Entfernen Sie PBS mit einer serologischen Pipette.
    6. Die Schüssel 6 mL PBS hinzu, auf Eis legen und dann setzen die Zellen mit UV-Licht (254 nm) bei 100 mJ cm-2 in einer UV-Vernetzer.
      Hinweis: Die Platte ist auf dem Eis während der UV-Licht Exposition aufzubewahren.
    7. Kratzen Sie die Zellen (in insgesamt 10 ~7 Zellen) in PBS und Übertragung auf eine 15 mL-Tube.
    8. Spin-down der Zellen bei 250 × g für 10 min bei 4 ° C und entfernen Sie dann den Überstand mit einer Pipette.
      Hinweis: Die Zelle-Pellet kann Snap in flüssigem Stickstoff eingefroren und bis zur Verwendung bei-80 ° C gelagert.
    9. Aufschwemmen der Zellen in 2 mL vorgekühlt Lyse Puffer (LB-A) durch pipettieren rauf und runter für 5 - 6 Mal, wobei das Rohr auf dem Eis.
    10. Übertragen der lysate mit einer Pipette auf eine 5 mL-Tube auf Eis gelegt.
    11. Vorbehaltlich der lysate auf drei Runden der Zellulite bestehend aus 20 s platzt bei 10 µm Amplitude mit 30 s von Perioden auf Eis abkühlen.
      Hinweis: Beschallung wird empfohlen, Lyse der Zellen und die DNA-Fragmente abgeschlossen hat.
    12. Übertragen der lysate auf 2 mL-Tuben und Zentrifuge bei 15.000 × g für 10 min bei 4 ° C. Den überstand (= Extrakt) zu sammeln und die Übertragung zu einem neuen Schlauch. Eine analytische Probe (5-10 %) für weitere Proteine und RNA Analyse zu entfernen.
      Hinweis: Dieser Schritt ist entscheidend für alle restlichen Zelle Ablagerungen zu entfernen und kann wiederholt werden.

(3) erster Schritt: Poly RNA Isolierung

  1. Equilibrate 1 mg oligo(dT)25-magnetische Beads in 500 µL des jeweiligen Lyse Puffers gekoppelt.
  2. Kombinieren Sie 5 mg, 10 mg oder 4 mg (Protein) von S. Cerevisiae, C. Elegans oder HEK293 Extrakte, jeweils mit 1 mg oligo(dT)25 -magnetische Beads gekoppelt. Mischen Sie die Proben kräftig 10 min bei 25 ° C in einem Mixer.
    Hinweis: Proteinkonzentrationen von Extrakten können mit Bradford-Test mit Rinderserumalbumin (BSA) als Referenzstandard bestimmt werden. Kräftig schütteln der Proben verhindert Sedimentation von Perlen. Um die Besonderheit der mRNA isoliert zu bewerten, kann ein kontrollexperiment parallel durchgeführt werden, indem man einen Überschuss (20 µg) von Polyadenylic Säuren (pA).
  3. Legen Sie die Rohre auf einem Magnetstativ für 10 s und Entfernen der Überstand. Halten Sie den überstand auf Eis für weitere Runden der Erholung (Schritt 3,7).
  4. Fügen Sie waschen 500 µL Puffer A (10 mM Tris-HCl, pH 7.5, 600 mM LICI, 1 mM EDTA, 0,1 % Triton x-100), die Perlen und Wirbel für 5 s.
    Hinweis: LICI-Konzentration in der Wasch-Puffer kann variieren. 600 mM LICI wird empfohlen, aber niedrigere Konzentrationen wurden ebenfalls getestet (500 mM für C. Elegans, 300 mM für HEK293).
  5. Sammeln Sie die Perlen mit einem Magneten zu und dann waschen Sie die Perlen zweimal mit 500 µL Waschpuffer B (WB, 10 mM Tris-HCl, pH 7.5, 600 mM LICI, 1 mM EDTA).
  6. Eluieren Sie die RNA in 30 µL 10 mM Tris-HCl, pH 7,5 bei 80 ° C für 2 min mit kontinuierlichen schütteln (1.000 u/min) in einem Mixer. Sofort das Rohr in die Magnetstativ und sammeln das Eluat nach 10 s. speichern die Perlen für weitere Runden der Reinigung.
    Hinweis: Sammeln Sie so schnell wie möglich zu verhindern, dass potenzielle Neubindung von mRNAs, die Perlen bei niedrigeren Temperaturen das Eluat.
  7. Der Überstand an Schritt 3.3 gesammelt die Perlen aus vorherigen Schritt hinzu, und wiederholen Sie die Aufnahme, Waschen und Elution von mRNAs zweimal (Schritte 3,3-3,6). Die Eluate aus wiederholte Runden werden dann kombiniert und können bei-80 ° c gelagert werden

4. Zweiter Schritt: Erfassung der spezifischen mRNAs mit 3' Biotinylierte 2'-Methoxy-modifizierte Antisense-RNA-Oligonukleotide

Hinweis: Um die Eignung von ASOs zu testen, kann das folgende Verfahren mit insgesamt RNAs aus Zellen isoliert durchgeführt werden.

  1. Equilibrate 30 µL Streptavidin-gekoppelten magnetischen Kügelchen in 1 mL der Bindung und Puffer (B & W Puffer, 10 mM Tris-HCl, pH 7.5, 150 mM NaCl, 0,5 mM EDTA, pH 8,0) waschen, enthält 0,1 mg mL-1Escherichia coli Transfer-RNA (tRNA) auf ein Rotator für 1 h bei RT.
    1. Waschen Sie die Perlen dreimal mit 750 µL von B & W Puffer.
    2. Aufschwemmen der Perlen in 30 µL von B & W Puffer und halten Sie auf dem Eis bis zur Verwendung.
  2. ~ 35 µg des Gesamt-Protein aus der vorherigen poly(A) Isolation zu verdünnen (siehe 3) in 100 µL der B & W Puffer in einem 1,5 mL-Tube.
    Hinweis: Um die Besonderheit von ASOs mit Gesamt-RNS zu testen, fügen Sie 600 ng von gereinigten Gesamt-RNS zu 100 µL Puffer B & W.
  3. Fügen Sie 200 Pmol der jeweiligen ASO und bei 70 ° C für 5 min inkubieren.
    Hinweis: Die erhöhte Temperatur löst Sekundärstrukturen in der RNA das Glühen der ASO zu erleichtern.
  4. Entfernen Sie die gesamte Wärme-Block aus dem Gerät und legen Sie sie bei RT für 10 min langsam abkühlen lassen.
  5. Die Probe 30 µL äquilibriert Streptavidin-gekoppelten magnetischen Beads aus Schritt 4.1 hinzufügen.
  6. Inkubieren Sie die Mischung für 30 min bei 25 ° C mit konstanter schütteln bei 950 u/min in einem Mixer.
    Hinweis: Es empfiehlt sich, die Schläuche alle 10 min flick um Sedimentation von Perlen zu verhindern.
  7. Setzen Sie die Rohre auf die magnetische Halterung, entfernen Sie den überstand zu und waschen Sie die Perlen dreimal mit 750 µL vorgewärmten B & W Puffer bei 55 ° C.
    Hinweis: Die optimale Waschtemperatur leicht abweichen/zwischen verschiedenen ASOs variieren. Es wird empfohlen, diese Bedingung mit unvernetzten total RNA vor Durchführung des Experiments mit zellextrakte anpassen.
  8. Eluieren Sie die RNA in 20 µL 10 mM Tris-HCl, pH 7,5 bei 90 ° C für 10 min mit konstanter schütteln bei 950 u/min in einem Mischer. Legen Sie die Rohre in die Magnetstativ und sammeln Sie sofort das Eluat.
    Hinweis: Für Protein-Analyse, die Perlen 20 µL 1 × Laemmli-Puffer hinzu und brüten bei 95 ° C für 5 min. Proteine durch Immunoblot Analyse nach standard Laborprotokolle überwacht werden.

Representative Results

Wir entwickelten eine ASO-basierte RNA Isolierung Strategie, Reise, um bestimmte mRNAs mit ihrer gebundenen Proteine aus drei verschiedenen Organismen37erfassen bezeichnet. RNA-Protein-komplexe waren im Wesentlichen, vernetzt in Vivo durch UV-Bestrahlung von Zellen bei 254 nm und poly(A) RNAs mit handelsüblichen Oligo (dT) gekoppelt-magnetische Beads wiederhergestellt wurden, dann die mRNA von Interesse war isoliert mit 3' biotinylierte 2-0'-Methoxy geändert antisense RNA-Oligonukleotide (Abbildung 1). Deshalb mehrere 21-24 Nts geändert ASOs mit voll-Komplementarität sollen Regionen in ausgewählten mRNAs aus Hefe, C. Elegans und Mensch, und getestet ihre Eignung um die mRNA von Interesse wiederherzustellen (eine Liste von Primern und ASOs erhält in Tabelle 1). die Effizienz und die Spezifität der einzelnen ASOs wurden zuerst mit unvernetzten total RNA isoliert aus dem jeweiligen Organismus ausgewertet. In diesen Experimenten waren RNA ASOs mit Streptavidin-konjugiert paramagnetischen Beads gekoppelt und inkubiert mit unvernetzten total RNA aus den entsprechenden Organismus vorbereitet. Nach der Veröffentlichung der erfassten mRNAs aus Perlen, zielt auf das Vorhandensein von mRNA sowie unabhängige Kontrolle mRNAs wurde durch reverse Transkription (RT) überwacht-Polymerase-Kettenreaktion (PCR)37. Wir haben festgestellt, dass zwei Variablen, der Salzgehalt und Temperatur waschen Puffer, spielte wichtige Rollen in der Effizienz der Erfassung von PFK2 mRNA aus Hefe, die getestet wurde mit drei verschiedenen ASOs (Abbildung 2A). Die Salzkonzentration (NaCl) bis 25 mM Tieferlegung reduziert die Erholung des Negativs kontrollieren mRNA (PFK1), nicht nachweisbaren Konzentrationen mit alle ASOs, aber es reduziert auch die Wiederherstellung der gewünschten Ziel-mRNA PFK2 (10-15 % der Eingabe). Im Gegensatz dazu, eine Erhöhung der Salzkonzentration zu physiologischen Ebenen (150 mM NaCl) erhöht die Erholung der PFK2 mRNAs bis zu 75 % mit der ASO PFK2-2, Überschreitung des Steuerelements PFK1 mRNA von mindestens 5-fold (Abbildung 2A). Der weitere Hinweis zeigte die verschiedenen ASOs große Variation der mRNA Ziel erfassen Wirksamkeiten bei physiologischen Salz-Konzentrationen unter Betonung der Notwendigkeit für die empirische Validierung von ASOs. Die Abhängigkeit der mRNA Erholung auf die Temperatur des Puffers waschen zeigt für C. Elegans Cep-1 und Hefe RPS20 mRNAs, mit jeweiligen ASOs (Tabelle 1). Wir beobachteten, dass die optimale Waschtemperatur zwischen 50 ° C und 55 ° C, wie offensichtlich vom niedrigen Hintergrund mit unabhängigen mRNAs und die effiziente Verwertung von mRNAs Ziel (Abbildung 2 b). Wir möchten an dieser Stelle die Möglichkeit der Kreuz-Hybridisierung von ASOs mit anderen mRNAs zu betonen. Z. B. DNM1 ASO ist vollständig komplementär zu einer Sequenz innerhalb der DNM1 Sequenz-Codierung, aber es glüht auch teilweise mit ACT1 mRNA. DNM1 ASOs erholte sich beide mRNAs unabhängig von der Waschtemperatur zeigt starke Neigung für die Kreuz-Hybridisierung (Abbildung 2). Schließlich haben wir die oben beschriebenen Tests und Optimierungen drei ASOs auswählen, die für die Erholung der jeweiligen Ziel mRNAs von geeignet waren total RNA isoliert von S. Cerevisiae, C. Elegans und menschlichen Zellen (Abb. 2D ).

Nach der Vorauswahl des geeigneten ASOs in-vitro- führten wir Reise mit Zelle Extrakten aus UV-vernetzte Organismen/Zellen (Abbildung 1) gewonnen. Speziell, wir testeten die Rückgewinnung von drei verschiedenen mRNAs von drei verschiedenen Organismen: PFK2 mRNA von der Hefe S. Cerevisiae, KEP-1 aus der Fadenwurm C. Elegans und ein Reporter mRNA (pGL3-CDKN1B-3'UTR) mit der 3' UTR Sequenz des menschlichen CDKN1B/p27 mRNA verschmolzen zu einem Luciferase (Luc) Reporter für transiente Expression in humanen HEK293 Zellen. Um die Spezifität der RNA Isolierung zu steuern, überwachen wir die Rückgewinnung von mehreren unabhängigen mRNAs, und wir führten Wettbewerb Experimente durch den Zusatz eines Überschusses von pA, zellextrakte, die konkurriert mit der Bindung des zellulären mRNAs, oligo(dT)25 Perlen in einem ersten Schritt Reinigung Schritt. Wie zuvor gesehen mit unvernetzten total RNA-Proben (Abbildung 2), RT-PCR bestätigt die Anreicherung der jeweiligen mRNAs Ziel mRNA während der Reise, während mehrere nichtverwandten Kontrolle mRNAs nicht angereichert wurden (Abb. 3A). Darüber hinaus wurden weder mRNAs auf Perlen ohne ASOs, zeigt geeignete blockierende Verfahren, die unspezifische Bindung vermeiden erkannt. Auf dieser Linie können nichts zu tun haben/Rührei ASOs auch als Kontrolle verwendet werden, obwohl das Potenzial für die Kreuz-Hybridisierung mit bestimmter mRNAs und die abgeleitete Erfassung der gebundenen Proteine muss dann in Betracht gezogen werden. Da Proteine in das endgültige Eluat kaum auf Silber-gebeizt Polyacrylamid-Gele (Daten nicht gezeigt) sichtbar gemacht werden konnte, wurde die Anwesenheit von bisher bekannten mRNA interagierenden Proteine weiter von Immunoblot Analyse bewertet. Dazu gehören Pfk2p aus S. Cerevisiae, die selektiv PFK2 mRNA ein Ribosom unabhängiger Weise12bindet; C. Elegans GLD-1, eine kanonische RBP, die 3' UTR Sequenzen von Cep-1 bindet, mRNA für translational Regelung43; und HuR, ein RBP, die Stabilität der mRNA und Übersetzung von p27/CDKN1B mRNA44regelt. Wie erwartet, wurden alle diese Proteine in der Reise-Eluate des jeweiligen mRNAs mit Western-Blot Analyse (Abb. 3 b) gekennzeichnet.

Figure 1
Abbildung 1: Schematische Darstellung der TRIP. Proteine sind vernetzt, RNA in Vivo durch UV-Bestrahlung. Im ersten Schritt (grüne Lichtkasten) werden poly(A) RNS-Protein-komplexe mit oligo(dT)25 Perlen strenge waschen Bedingungen, ungebundene Proteine zu entfernen wiederhergestellt. Im zweiten Schritt (Rosa Feld) die Ziel-mRNP ist mit biotinylierte antisense RNA-Oligonukleotide und Streptavidin Perlen herausgezogenen. Die gereinigten mRNPs werden dann durch RT-PCR und Immunoblot-Massenspektrometrie (MS) zur Identifizierung RNAs und Proteine interagieren mit der mRNA von Interesse, bzw. analysiert. Die Figur wurde aus früheren Publikation37 mit Erlaubnis geändert. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 2
Abbildung 2: Isolierung von ausgewählten mRNAs von Gesamt-RNS unvernetzten Zellen/Organismen verwenden geändert Antisense RNA Erfassung Sonden. (A) Auswirkungen der Salzkonzentration auf der Aufnahme Effizienz der Hefe PFK2 mRNA mit ASOs. Gesamt-RNS von Hefezellen wurde kombiniert mit der angegebenen ASOs und gewaschen mit Puffer mit der angegebenen Salz (NaCl)-Konzentration bei 55 ° C. Grün, blaue und orange Linien repräsentieren PFK2 mRNA Erholung mit verschiedenen ASOs als bestimmt durch RT-PCR37: PFK2-1 und PFK2 -2 Tempern in der 3' UTR, PFK2-4 in die CDS. PFK1 ist eine Negative mRNA zu kontrollieren. PCR war mit 32 Verstärkung Zyklen durchgeführt und als zuvor beschriebenen37quantifiziert. (B) Anteil der C. Eleganscep-1 und Hefe RPS20 ASO gebunden mRNAs an unterschiedlichen Waschtemperaturen in schwarzen und roten Linien bzw. vertreten. C. Eleganspgk-1 und Hefe ACT1 sind nicht-Zielorganismen (Kontrolle) mRNAs. 30 und 32 PCR-Zyklen galten für die Erkennung von Hefe und C. Elegans mRNAs. (C) schematische Darstellung der Hybridisierung von DNM1 ASO (rot) mit Sequenzen in der DNM1 mRNA sowie potenzielle Kreuz-Hybridisierung mit ACT1 mRNA wird auf der linken Seite angezeigt. Ein Agarosegel zeigt Produkte von RT-PCR-Reaktionen (30 Zyklen) für den Nachweis von Hefe DNM1 und ACT1 mRNAs aus Perlen eluiert wird auf der rechten Seite angezeigt. Eingang, total RNA; SN, überstand nach Inkubation mit ASOs; E, Eluate aus Perlen bei gewaschen angegebenen Temperaturen vorherige Elution (40 ° C, 50 ° C und 60 ° C). Ein kontrollexperiment (Ctrl) wurde parallel durchgeführt, ohne Zugabe von ASO. (D) Agarose-gel mit RT-PCR-Produkte für den Nachweis von mRNAs (rechts) von Gesamt-RNS der Hefe S. Cerevisiae, C. Elegansund menschlichen HEK293 Zellen (H. sapiens) erfasst. Eingang, total RNA; SN, überstand; E, Eluate aus Perlen. PCR wurde von 30 Verstärkung Zyklen für Hefe mRNAs, 32 Zyklen für C. Elegans mRNAs, und 28 und 30 Zyklen für menschliche Tubulin und p27 mRNAs, beziehungsweise. Die Figur wurde aus früheren Publikation37 mit Erlaubnis geändert. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 3
Abbildung 3. Erfassung von bestimmten mRNA-Protein-komplexe aus Extrakten von UV querverbunden Zellen mit Reise abgeleitet. (A) Agarose Gele für den Nachweis von mRNAs (rechts) mit RT-PCR bei der Aufnahme mit oligo(dT) und angegebenen ASOs von S. Cerevisiae, C. Elegans und menschlichen (H. sapiens) Zelle Extrakten. Eingang, total RNA aus querverbunden Zellen/Organismen; STRG, Steuerung ohne ASO. Poly, Wettbewerb mit Poly. RT-PCR wurde wie beschrieben37 mit 35 Verstärkung Zyklen für LUC, 32 Zyklen für p27, und 29 Zyklen für Tubulin. (B) Immunoblot Analyse der mRNA-gebundene Proteine mit angegebenen Antikörper (rechts). Geladene Fraktionen sind wie folgt: 0,1 %, 2,5 % und 1 % für die Hefe, Nematoden und menschlichen Eingänge; 10 %, 10 % und 5 % für die Hefe, Nematoden und menschlichen oligo(dT) Bahnen; und 66 % für alle ASOs Bahnen. Molekulargewicht (MW) sind in Kilodaltons (kDa) angegeben. Abbildung mit Erlaubnis37neu aufgelegt. Bitte klicken Sie hier für eine größere Version dieser Figur.

Primer-name Sequenz Ziel Größe
Pfk2_Fwd GTGTTAAGGGTTCACATGTCG PFK2 S. cerevisiae 133 bp
Pfk2_Rev CTTCCAACCAAATGGTCAGC PFK2 S. cerevisiae 133 bp
Pfk1_Fwd GGTGATTCTCCAGGTATGAATG PFK1 S. cerevisiae 97 bp
Pfk1_Rev CTTCGTAACCTTCGTAAACAGC PFK1 S. cerevisiae 97 bp
Act1_Fwd GTCTGGATTGGTGGTTCTATC ACT1 S. cerevisiae 85 bp
Act1_Rev GGACCACTTTCGTCGTATTC ACT1 S. cerevisiae 85 bp
Dnm1_Fwd CTGTGTTCGATGCATCAGAC DNM1 S. cerevisiae 156 bp
Dnm1_Rev CGCACTCCAATTCTTCTCTC DNM1 S. cerevisiae 156 bp
Rps20_Fwd CGCTGAACAACACAACTTGG RPS20 S. cerevisiae 228 bp
Rps20_Rev GGAAGCAACAACAACTTCGAC RPS20 S. cerevisiae 228 bp
Cep1_Fwd CGATGAAGAGAAGTCGCTGT CEP-1 C. elegans 110 bp
Cep1_Rev ATCTGGGAACTTTTGCTTCG CEP-1 C. elegans 110 bp
Pgk1_Fwd GCGATATTTATGTCAATGATGCTTTC PGK-1 C. elegans 74 bp
Pgk1_Rev TGAGTGCTCGACTCCAACCA PGK-1 C. elegans 74 bp
Mpk1_Fwd TGCTCAGTAATCGGCCATTG MPK-1 C. elegans 74 bp
Mpk1_Rev TCCAACAACTGCCAAAATCAAA MPK-1 C. elegans 74 bp
p27_Fwd TTTAAAAATACATATCGCTGACTTCATGG P27 H. sapiens 212 bp
p27_Rev CAAAGTTTATGTGCTACATAAAAGGTAAAAA P27 H. sapiens 212 bp
Luc_Fwd AATGGCTCATATCGCTCCTGGAT Luciferase p. pγralis 117 bp
Luc_Rev TGGACGATGGCCTTGATCTTGTCT Luciferase p. pγralis 117 bp
Β-TUBULIN_Fwd CTGAACCACCTTGTCTCAGC Β-TUBULIN H. sapiens 136 bp
Β-TUBULIN_Rev AGCCAGGCATAAAGAAATGG Β-TUBULIN H. sapiens 136 bp
PFK2-1 ASO AAUAGAAAGUGUAAUAAAAGGUCAU 3' UTR PFK2 S. Cerevisiae -
PFK2-2 ASO GUUUCAUGGGGUAGUACUUGU 3' UTR PFK2 S. Cerevisiae -
PFK2-4 ASO CUUGAAGAGGAGCGUUCAUA ORF PFK2 S. cerevisiae -
DNM1 ASO UCGGUCAGUGGAGGUUCAGCGUUU ORF DNM1 S. cerevisiae -
RPS20 ASO GUCGGUAAUAGCCUUCUCAUUCUUG ORF RPS20 S. cerevisiae -
CEP-1 ASO GUGAGAAAUGCGGUGCUUUGAAA 3' UTR Cep-1 C. elegans -
P27 ASO UCAUACCCCGCUCCACGUCAGUU 3' UTR p27 H. sapiens -

Tabelle 1. Oligonukleotid-Sequenzen. Liste der PCR Primer und ASOs in dieser Arbeit, Primer Sequenz, gen Ziel und erwartete Fragmentgröße nach Verstärkung verwendet.

Discussion

Reise erlaubt die Analyse von Proteinen, die an bestimmten mRNAs in Vivo mit biochemischen Mitteln gebunden. Während wir die Methode verwendet haben, um das Zusammenspiel von bestimmten RBPs mit mRNA Ziele aus verschiedenen Organismen/Zellen zu überprüfen, könnte Reise auch auf andere Arten von poly(A) RNAs, wie z. B. zytoplasmatischen lange NcRNAs studieren anwendbar. Darüber hinaus könnte die systematische Analyse der gebundenen Proteine und/oder RNAs mit MS oder RNA Sequenzierung durch ein Up-scaling des Verfahrens erreicht werden. In diesem Zusammenhang zufolge unsere vorläufigen Daten 1 L von Hefekulturen und mindestens 100 Millionen menschlicher HEK293 Zellen ausreichend Ausgangsmaterial, um zuverlässige MS Daten für gut ausgedrückt mRNAs (unveröffentlichte Ergebnisse) bieten könnte.

Die beschriebene Reise-Protokoll beinhaltet die Bestrahlung von Zellen mit UV-Licht bei 254 nm Crosslink RNS-Protein-Interaktionen. Dies ermöglicht die Umsetzung der strengen waschen Bedingungen während der Reinigung. Dennoch, obwohl nicht explizit getestet, wir möchten beachten, dass Vernetzung optional ist und aktive RNPs auch mit physiologischen Puffer wiederhergestellt werden können. Allerdings sollte in diesem Fall die mögliche Neuordnung von Proteinen und RNAs auf der Ziel-RNA in Lysates berücksichtigt werden. Umgekehrt, wenn UV- oder andere Vernetzung Verfahren angewendet (z.B.Formaldehyd) sind, sollte die Integrität der RNA bewertet werden, da RNA-Abbau zu verminderten Erholung der mRNPs führen kann. Darüber hinaus UV-Vernetzung ist eher ineffizient (~ 5 %) und schon gar nicht für Proteine interagieren mit doppelsträngige RNA, die Neigung zum Nachweis bestimmter Klassen von RBPs12einführen könnte. Schließlich kann UV-Bestrahlung auch Protein-Protein und Protein-DNA Querverbindungen induzieren, die für Daten Auslegung45,46berücksichtigt werden sollten. Daher könnte alternative Vernetzung Verfahren, z. B. mit Formaldehyd, auch für größere Protein-Assemblys auf mRNAs erfassen von besonderem Interesse sein.

Ein wesentliches Merkmal der Reise ist die zweistufige ASO-basierte Reinigungsprozedur zu bestimmten RNAs, wodurch Selektivität und verringern die Wahrscheinlichkeit Co reinigen Verunreinigungen zu erholen. Beispielsweise betrifft ein Anliegen direkt hinzufügen biotinylierte ASOs zellextrakte, die zu CO Reinigung von Biotin-bindende Proteine führen könnten. Dies wird umgangen, in Reise durch die Implementierung einer ersten Runde der Reinigung von poly(A) RNAs mit kovalent gekoppelten oligo-(dT)25 magnetischen Beads, ermöglicht eine stringente Reinigung Bedingungen wie für RNS-Protein Interaktom Fang getan. Darüber hinaus poly(A) RNA Auswahl sehr reichlich NcRNAs wie ribosomalen RNAs und tRNAs, entfernt und daher reduziert die Komplexität der Probe und potentielle Quellen für Kreuz-Hybridisierung und Verschmutzung. Im zweiten Schritt bestimmten mRNAs mit biotinylierte zurückgewonnen und ASOs, die mit den Regionen auf der mRNA-Ziele Tempern geändert. Alternativ könnte modifizierte ASOs auch direkt kovalent magnetische Beads über ein Amin-Linker beizufügen Verringerung der Neigung zu Biotin-bindende Proteine zu erfassen. Allerdings erholte sich nach unserer Erfahrung die Inkubation von poly(A) RNA Bruchteil mit ASOs vor der Zugabe von Streptavidin Perlen mRNPs effizienter als direkte Zugabe von ASO-gekoppelten Perlen. Gegebenenfalls sind kostenlose Oligos kinetisch mit besseren Zugang zu Sequenzen in strukturierten RNA verglichen mit immobilisierten Oligos begünstigt. Daher die kovalente Kopplung von ASOs, Perlen vor die Inkubation mit der Probe für die Wiederherstellung der RNA Ziel abträglich sein könnte und empirisch überprüft werden.

Ein Nachteil mit ASO basierten Methoden ist ineffizient Rückgewinnung von einigen Ziel mRNAs. Wir empfehlen daher die Bewertung von mehreren ASOs das Tempern in verschiedenen Regionen der Abschrift. Insbesondere empfehlen wir das Design von 2-3 ASOs, die mit Sequenzen in der 3' UTR Tempern oder die CDS der mRNA von Interesse. Jedes ASO eine unterschiedliche Effizienz für die Wiederherstellung des jeweiligen Ziels mRNA aufweisen kann und sollte empirisch getestet (Abb. 2A, B, Daten nicht gezeigt). Am Ende fanden wir, dass ASOs glühen, die 3' wo bessere Leistungen im Vergleich zu den CDs glühen. Dies könnte durch erhöhte Zugänglichkeit der Bindungsstellen im wo wegen des Fehlens des Übersetzens Ribosomen, während Ribosomen effiziente Hybridisierung in CDS behindern können. Wir haben auch erlebt, die Kombination von mehreren ASOs könnte zu erhöhten Kontamination von reichlich Nichtziel-mRNAs und Pulldown-Effizienz reduziert. In jedem Fall die Selektivität der gewählten Oligos Wettbewerb Experimente gesteuert werden (zB., Zugabe von konkurrierenden Oligos).

Eine weitere Sorge bezieht sich auf mögliche Kreuz-Hybridisierung mit unabhängigen RNAs, wie wir, dass auch teilweise die Hybridisierung mit anderen mRNAs beobachten kann zur Wiederherstellung eines dieser mRNA (Abbildung 2) führen. Um die Eignung des gestalteten ASOs zu bewerten, empfehlen wir daher, Durchführung von ersten in-vitro- Tests mit insgesamt RNAs Salzkonzentrationen und Waschtemperatur von Puffern zu optimieren. In unsere Hände waschen von Streptavidin-gekoppelten magnetischen Beads in Puffern mit 150 mM NaCl bei 55 ° C am besten durchgeführt, aber wir empfehlen unabhängige Tests der Bedingungen für jedes gestaltete ASO. Bemerkenswert fanden wir, dass alle ASOs ausgewählt aus in-vitro- Experimenten (Bild 2D) geeignet für die Erfassung der jeweiligen mRNA Ziel von querverbunden zellextrakte (Abbildung 3), weiter untermauern die Gültigkeit des waren in Vitro testen. Neben geeigneten ASOs für mRNA-Capture, könnten zusätzliche Faktoren Auswirkungen auf Selektivität. Daher können umfassende blockierende Verfahren mit BSA/tRNA oder Spezifikationen Typ Perle unspezifische Bindung an Perlen verhindern. Um unspezifische Absorption von Proteinen weiter zu verringern, empfehlen wir auch den Einsatz von Lo-Bind Rohren, besonders beim Arbeiten mit geringen Mengen an Proben.

Im Allgemeinen kann Reise vorher festgelegten Ansätze zum Erfassen von RNAs mit ASOs ergänzen. Zum Beispiel wurde die nicht-kodierende RNA Xist isoliert mit gebundenen Proteine aus nuklearen Extrakten aus 200 Millionen UV querverbunden Zellen abgeleitet werden, indem mit einem Array von lang (90-Mer) biotinylierte DNA Oligonukleotide, die die gesamte Transkript abgedeckt 34,35. Jedoch der gewählten Fliesen Ansatz könnte problematisch im Hinblick auf das große Potenzial für Kreuz-Hybridisierung mit unabhängigen RNAs werden, und es kann nicht verwendet werden, um bestimmte Abschrift, z.B.wählen., alternativ gespleißt Formen. Vor kurzem, speziell die verschlossene Nukleinsäure (LNA) oder DNA ASO Mixmers waren kovalent an einem magnetischen Harz zur in Vitro Transkript oder stark exprimierten ribosomalen RNAs Wiederherstellung zellfreie Extrakte befestigt; jedoch war es nicht für die Verwertung von in Vivo gebildet mRNA-Protein-komplexe36getestet. Im Hinblick auf die zunehmende Anerkennung der posttranskriptionelle gen Kontrolle durch RBPs und NcRNA glauben wir, dass die Reise ist eine nützliche Methode, die Zusammensetzung und Dynamik der RNP-komplexe in den Zellen nach Umwelt- und intrazelluläre Signale und seine Auswirkungen zu untersuchen in Gesundheit und Krankheit.

Disclosures

Die Autoren haben nichts preisgeben.

Acknowledgments

Wir sind dankbar, Dr. Jonathan Hall und Mauro Zimmermann (ETH Zürich) für die Synthese von PFK2 und KEP-1 ASOs, Dr. Maikel Wouters für die Gestaltung von ASOs p27/CDKN1B und Dr. Rafal Ciosk (Friedrich Miescher Institut für biomedizinische Forschung Basel) für Anti-GLD-1 Antikörper. Diese Arbeit wurde unterstützt durch die Biotechnologie und biologische Wissenschaften Research Council (BB/K009303/1) und eine Royal Society Wolfson Research Merit Award (WM170036), A.P.G.

Materials

Name Company Catalog Number Comments
MaxQ 5000 Large Incubated and Refrigerated Orbital Shaker Thermo Fisher Scientific SHKE5000-8CE Floor shaker to grow yeast cells
BBD 6220 Thermo Fisher Scientific CO2 incubator to grow human cells
Sonicator Soniprep150 MSE MSS150.CX4.5 Sonicator/cell disruptor. Used to shear DNA in human cell lysates
Stratalinker 1800 Stratagene Stratalinker to expose cells to UV light at 254 nm
Tissue Lyser Qiagen RETSCH MM200 Device to mechanically disrupt yeast cells
Refrigerated Centrifuge Eppendorf 5810R Centrifuge to spin down cells, lysates
Shaking incubator, Thriller Peqlab Thermoshaker for 1.5 mL tubes
Glass beads 0.5mm Stratech Scientific Limited 11079105 Lysis of yeast cells
Nylon Filter, 0.41 μm Millipore NY4104700 Collection of yeast cells
Millex-HA Filter, 0.45 µm EMD Millipore SLHA02510 Filter to clear nematode lysate
Eppendorf LoBind microcentrifuge tubes Protein 1.5 mL Sigma-Aldrich 22431081 Minimise protein loss
2 mL microfuge tube Ambion AM12425 Yeast extract preparation and other applications
5 mL tube Thermo Fisher Scientific 129A Collection of HEK293 cell lysate
15 mL tube Sarstedt 62.547.254 Collection C. elegans
50 mL plastic tube Sarstedt 62.554.502 Collection yeast cells
DMEM, high glucose, pyruvate Thermo Fisher Scientific 41966 Media for culturing HEK293 cells
Penicillin-Streptomycin Sigma-Aldrich P4333 Used to supplement cell culture media to control bacterial contamination
Fetal Bovine Serum (FBS) Sigma-Aldrich F7524 Used to supplement cell culture media
Lipofectamine 2000 Thermo Fisher Scientific 11668027 Transfection reagent
RQ1 RNase-Free DNase Promega M6101 DNAse I to degrade DNA from cell lysate
RNasin Plus RNase Inhibitor Promega N2611 RNase inhibitor to avoid RNA degradation
cOmplete, Mini, EDTA-free Protease Inhibitor Cocktail Roche 11836170001 Protease inhibitor cocktail to avoid protein degradation
Dynabeads Oligo (dT)25 Thermo Fisher Scientific 61011 Magnetic beads required for the first step of mRNA-protein complex purification
Dynabeads M-280 Streptavidin Thermo Fisher Scientific 11205D Magnetic beads required for the second step of mRNA-protein complex purification
E. coli tRNA Sigma-Aldrich 10109550001 transfer RNA from E. coli used for blocking streptavidin beads and avoid unsepecific interactions
Quick Start Bradford 1x Dye Reagent BioRad 5000205 To determine protein concentration within lysates, using BSA as reference
Bovine Serum Albumin Sigma A7906-100G Used to perform the standard curve that will be used as reference for protein concentration determination
mouse anti-Act1 MP Biomedicals 869100 Antibody for detection of yeast actin in Western blot (1:2,500)
mouse anti-Act1 Sigma A1978 Antibody for detection of human actin in Western blot (1:2,000)
mouse anti-HuR Santa Cruz sc-5261 Antibody for detection of HuR in Western blot (1:500)
mouse anti–CYC-1 Invitrogen 456100 Antibody for detection of Cyc-1 in Western blot (1:1,000)
peroxidase anti-peroxidase soluble complex Sigma P1291 Detection of Pfk2:TAP in Western blot (1:5,000)
HRP-conjugated sheep anti-mouse IgG Amersham NXA931 HRP-coupled secondary antibody

DOWNLOAD MATERIALS LIST

References

  1. Mitchell, S. F., Parker, R. Principles and properties of eukaryotic mRNPs. Molecular Cell. 54, (4), 547-558 (2014).
  2. Iadevaia, V., Gerber, A. P. Combinatorial Control of mRNA Fates by RNA-Binding Proteins and Non-Coding RNAs. Biomolecules. 5, (4), 2207-2222 (2015).
  3. McHugh, C. A., Russell, P., Guttman, M. Methods for comprehensive experimental identification of RNA-protein interactions. Genome Biology. 15, (1), 203 (2014).
  4. Matia-González, A. M., Gerber, A. P. Ch. 14. Fungal RNA Biology. Sesma, A., von der Haar, T. Springer. 347-370 (2014).
  5. Tsvetanova, N. G., Klass, D. M., Salzman, J., Brown, P. O. Proteome-wide search reveals unexpected RNA-binding proteins in Saccharomyces cerevisiae. PLoS One. 5, (9), (2010).
  6. Castello, A., et al. Insights into RNA biology from an atlas of mammalian mRNA-binding proteins. Cell. 149, (6), 1393-1406 (2012).
  7. Baltz, A. G., et al. The mRNA-bound proteome and its global occupancy profile on protein-coding transcripts. Molecular Cell. 46, (5), 674-690 (2012).
  8. Castello, A., et al. System-wide identification of RNA-binding proteins by interactome capture. Nature Protocols. 8, (3), 491-500 (2013).
  9. Liao, Y., et al. The Cardiomyocyte RNA-Binding Proteome: Links to Intermediary Metabolism and Heart Disease. Cell Reports. 16, (5), 1456-1469 (2016).
  10. Liepelt, A., et al. Identification of RNA-binding Proteins in Macrophages by Interactome Capture. Molecular Cell Proteomics. 15, (8), 2699-2714 (2016).
  11. Conrad, T., et al. Serial interactome capture of the human cell nucleus. Nature Communications. 7, 11212 (2016).
  12. Matia-Gonzalez, A. M., Laing, E. E., Gerber, A. P. Conserved mRNA-binding proteomes in eukaryotic organisms. Nature Structural and Molecular Biology. 22, (12), 1027-1033 (2015).
  13. Mitchell, S. F., Jain, S., She, M., Parker, R. Global analysis of yeast mRNPs. Nature Structural and Molecular Biology. 20, (1), 127-133 (2013).
  14. Beckmann, B. M., et al. The RNA-binding proteomes from yeast to man harbour conserved enigmRBPs. Nature Communications. 6, 10127 (2015).
  15. Wessels, H. H., et al. The mRNA-bound proteome of the early fly embryo. Genome Research. 26, (7), 1000-1009 (2016).
  16. Sysoev, V. O., et al. Global changes of the RNA-bound proteome during the maternal-to-zygotic transition in Drosophila. Nature Communications. 7, 12128 (2016).
  17. Despic, V., et al. Dynamic RNA-protein interactions underlie the zebrafish maternal-to-zygotic transition. Genome Research. 27, (7), 1184-1194 (2017).
  18. Zhang, Z., et al. UV crosslinked mRNA-binding proteins captured from leaf mesophyll protoplasts. Plant Methods. 12, 42 (2016).
  19. Reichel, M., et al. In Planta Determination of the mRNA-Binding Proteome of Arabidopsis Etiolated Seedlings. Plant Cell. 28, (10), 2435-2452 (2016).
  20. Koster, T., Marondedze, C., Meyer, K., Staiger, D. RNA-Binding Proteins Revisited - The Emerging Arabidopsis mRNA Interactome. Trends Plant Sciences. 22, (6), 512-526 (2017).
  21. Hamasaki, K., Killian, J., Cho, J., Rando, R. R. Minimal RNA constructs that specifically bind aminoglycoside antibiotics with high affinities. Biochemistry. 37, (2), 656-663 (1998).
  22. Bachler, M., Schroeder, R., von Ahsen, U. StreptoTag: a novel method for the isolation of RNA-binding proteins. RNA. 5, (11), 1509-1516 (1999).
  23. Vazquez-Pianzola, P., Urlaub, H., Rivera-Pomar, R. Proteomic analysis of reaper 5' untranslated region-interacting factors isolated by tobramycin affinity-selection reveals a role for La antigen in reaper mRNA translation. Proteomics. 5, (6), 1645-1655 (2005).
  24. Hartmuth, K., Vornlocher, H. P., Luhrmann, R. Tobramycin affinity tag purification of spliceosomes. Methods Molecular Biology. 257, 47-64 (2004).
  25. Beach, D. L., Keene, J. D. Ribotrap : targeted purification of RNA-specific RNPs from cell lysates through immunoaffinity precipitation to identify regulatory proteins and RNAs. Methods Molecular Biology. 419, 69-91 (2008).
  26. Slobodin, B., Gerst, J. E. A novel mRNA affinity purification technique for the identification of interacting proteins and transcripts in ribonucleoprotein complexes. RNA. 16, (11), 2277-2290 (2010).
  27. Slobodin, B., Gerst, J. E. RaPID: an aptamer-based mRNA affinity purification technique for the identification of RNA and protein factors present in ribonucleoprotein complexes. Methods Molecular Biology. 714, 387-406 (2011).
  28. Yoon, J. H., Gorospe, M. Identification of mRNA-Interacting Factors by MS2-TRAP (MS2-Tagged RNA Affinity Purification). Methods Molecular Biology. 1421, 15-22 (2016).
  29. Leppek, K., Stoecklin, G. An optimized streptavidin-binding RNA aptamer for purification of ribonucleoprotein complexes identifies novel ARE-binding proteins. Nucleic Acids Research. 42, (2), 13 (2014).
  30. Blencowe, B. J., Sproat, B. S., Ryder, U., Barabino, S., Lamond, A. I. Antisense probing of the human U4/U6 snRNP with biotinylated 2'-OMe RNA oligonucleotides. Cell. 59, (3), 531-539 (1989).
  31. Lingner, J., Cech, T. R. Purification of telomerase from Euplotes aediculatus: requirement of a primer 3' overhang. Proceedings of the National Academy of Sciences U S A. 93, (20), 10712-10717 (1996).
  32. Upadhyay, A., Dixit, U., Manvar, D., Chaturvedi, N., Pandey, V. N. Affinity capture and identification of host cell factors associated with hepatitis C virus (+) strand subgenomic RNA. Molecular Cell Proteomics. 12, (6), 1539-1552 (2013).
  33. Imig, J., et al. miR-CLIP capture of a miRNA targetome uncovers a lincRNA H19-miR-106a interaction. Nature Chemical Biology. 11, (2), 107-114 (2015).
  34. Chu, C., et al. Systematic discovery of Xist RNA binding proteins. Cell. 161, (2), 404-416 (2015).
  35. McHugh, C. A., et al. The Xist lncRNA interacts directly with SHARP to silence transcription through HDAC3. Nature. 521, (7551), 232-236 (2015).
  36. Rogell, B., et al. Specific RNP capture with antisense LNA/DNA mixmers. RNA. 23, (8), 1290-1302 (2017).
  37. Matia-Gonzalez, A. M., Iadevaia, V., Gerber, A. P. A versatile tandem RNA isolation procedure to capture in vivo formed mRNA-protein complexes. Methods. 93-100 (2017).
  38. Gruber, A. R., Lorenz, R., Bernhart, S. H., Neubock, R., Hofacker, I. L. The Vienna RNA websuite. Nucleic Acids Research. 36, (Web Server issue), Available from: http://rna.tbi.univie.ac.at/cgi-bin/RNAWebSuite/RNAfold.cgi W70-W74 (2008).
  39. Kalendar, R., Khassenov, B., Ramankulov, Y., Samuilova, O., Ivanov, K. I. FastPCR: An in silico tool for fast primer and probe design and advanced sequence analysis. Genomics. 109, (3-4), Available from: http://primerdigital.com/tools/PrimerAnalyser.html 312-319 (2017).
  40. Altschul, S. F., Gish, W., Miller, W., Myers, E. W., Lipman, D. J. Basic local alignment search tool. Journal of Molecular Biology. 215, (3), 403-410 (1990).
  41. Stiernagle, T. Maintenance of C. elegans. WormBook. 1-11 (2006).
  42. Kedde, M., et al. A Pumilio-induced RNA structure switch in p27-3' UTR controls miR-221 and miR-222 accessibility. Nature Cell Biology. 12, (10), 1014-1020 (2010).
  43. Schumacher, B., et al. Translational repression of C. elegans p53 by GLD-1 regulates DNA damage-induced apoptosis. Cell. 120, (3), 357-368 (2005).
  44. Ziegeler, G., et al. Embryonic lethal abnormal vision-like HuR-dependent mRNA stability regulates post-transcriptional expression of cyclin-dependent kinase inhibitor p27Kip1. Journal of Biological Chemistry. 285, (20), 15408-15419 (2010).
  45. Itri, F., et al. Femtosecond UV-laser pulses to unveil protein-protein interactions in living cells. Cellular and Molecular Life Sciences. 73, (3), 637-648 (2016).
  46. Zhang, L., Zhang, K., Prandl, R., Schoffl, F. Detecting DNA-binding of proteins in vivo by UV-crosslinking and immunoprecipitation. Biochemical and Biophysical Research Communications. 322, (3), 705-711 (2004).
Ein Oligonukleotid-basierte Tandem RNA Isolierung Vorgehensweise eukaryotischen mRNA-Protein-komplexe
Play Video
PDF DOI

Cite this Article

Iadevaia, V., Matia-González, A. M., Gerber, A. P. An Oligonucleotide-based Tandem RNA Isolation Procedure to Recover Eukaryotic mRNA-Protein Complexes. J. Vis. Exp. (138), e58223, doi:10.3791/58223 (2018).More

Iadevaia, V., Matia-González, A. M., Gerber, A. P. An Oligonucleotide-based Tandem RNA Isolation Procedure to Recover Eukaryotic mRNA-Protein Complexes. J. Vis. Exp. (138), e58223, doi:10.3791/58223 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter