Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biochemistry

एक Oligonucleotide आधारित मिलकर आरएनए अलगाव प्रक्रिया Eukaryotic mRNA-प्रोटीन परिसरों को पुनर्प्राप्त करने के लिए

doi: 10.3791/58223 Published: August 18, 2018
* These authors contributed equally

Summary

endogenously गठित mRNA-प्रोटीन कॉम्प्लेक्स की वसूली के लिए एक मिलकर आरएनए अलगाव प्रक्रिया (ट्रिप) का वर्णन किया गया है । विशेष रूप से, आरएनए-प्रोटीन कॉंप्लेक्स vivo मेंcrosslinked हैं, polyadenylated RNAs oligo (डीटी) मोतियों के साथ अर्क से अलग कर रहे हैं, और विशेष रूप से mRNAs संशोधित आरएनए antisense oligonucleotides के साथ कब्जा कर रहे हैं । mRNAs से बंधे प्रोटीन immunoblot विश्लेषण द्वारा पाए जाते हैं ।

Abstract

आरएनए-बाइंडिंग प्रोटीन्स (RBPs) जीन एक्सप्रेशन के पोस्ट-transcriptional कंट्रोल में प्रमुख भूमिकाएं निभाते हैं । इसलिए, mRNA-प्रोटीन परिसरों के जैव रासायनिक लक्षण वर्णन प्रोटीन या गैर कोडिंग RNAs बातचीत द्वारा mRNA नियमन को समझने के लिए आवश्यक है । साथ ही, हम एक मिलकर आरएनए अलगाव प्रक्रिया (यात्रा) है कि सेलुलर निष्कर्षों से endogenously गठन mRNA-प्रोटीन परिसरों की शुद्धि सक्षम बनाता है का वर्णन । दो कदम प्रोटोकॉल antisense oligo (डीटी) मोतियों के साथ polyadenylated mRNAs के अलगाव और 3 '-mRNA 2 ' के साथ ब्याज की एक biotinylated के बाद कब्जा शामिल है-O-methylated antisense आरएनए oligonucleotides, जो तब के साथ अलग किया जा सकता है streptavidin मोतियों की माला । यात्रा आगे आरएनए और प्रोटीन विश्लेषण के लिए vivo crosslinked mRNA-ribonucleoprotein (mRNP) खमीर, सूत्रकृमि और मानव कोशिकाओं से परिसरों में ठीक करने के लिए इस्तेमाल किया गया था । इस प्रकार, यात्रा एक बहुमुखी दृष्टिकोण है कि जीवों के पार polyadenylated RNAs के सभी प्रकार के लिए अनुकूलित किया जा सकता है intracellular या पर्यावरण cues द्वारा लगाया mRNPs की गतिशील पुनः व्यवस्था का अध्ययन ।

Introduction

पोस्ट-transcriptional जीन विनियमन आरएनए-बंधन प्रोटीन (RBPs), गैर कोडिंग RNAs (ncRNAs) और mRNAs, जो प्रसंस्करण, स्थानीयकरण, अनुवाद और कोशिकाओं के भीतर हर प्रतिलिपि के क्षय प्रत्यक्ष के बीच बातचीत के माध्यम से संचालित है1 , 2. RBPs और ncRNA की पहचान विशेष mRNAs के साथ बातचीत, जो ribonucleoprotein परिसरों/कणों (RNPs) के रूप में जाना जाता है की स्थापना, इसलिए mRNAs और जीन अभिव्यक्ति नियंत्रण के भाग्य को समझने के लिए महत्वपूर्ण है । पूरक दृष्टिकोण RNP परिसरों3,4के जैव रासायनिक लक्षण वर्णन के लिए किए गए हैं: जबकि "प्रोटीन केंद्रित दृष्टिकोण" विशिष्ट RBPs की शुद्धि पर आधारित है, "आरएनए-केंद्रित" दृष्टिकोण शामिल है उपजनसंख् या व् यक्तिगत RNAs का अलगाव और उसके बाद के विश्लेषण में प्रोटीन या RNAs का आदान-प्रदान । हाल ही में, RBP प्रदर्शनों की पहचान के लिए एक आरएनए-केंद्रित दृष्टिकोण polyadenylated (पाली (ए)) के साथ बातचीत करने की RNAs5 एक पराबैंगनी (यूवी) प्रकाश crosslinking कदम को शामिल करके तेजी से लोकप्रिय हो गया है प्रोटीन-आरएनए को स्थिर करने के लिए बातचीत mRNAs, जो नाटकीय रूप से मानव कोशिकाओं6,7,8,9,10,11में RBPs की सूची विस्तारित के अलगाव से पहले, Caenorhabditis एलिगेंस 12, Saccharomyces cerevisiae12,13,14, व अन्य जीव15,16,17,18, 19,20. हालांकि, प्रोटीन और/या विशेष टेप पर इकट्ठे ncRNAs की मानचित्रण अभी भी एक बड़ी चुनौती है । इस अंत करने के लिए, दो मुख्य दृष्टिकोण वर्तमान में इस्तेमाल कर रहे हैं: एक तरफ, आरएनए aptamer टैग संबंध शुद्धिकरण सक्षम करने के लिए ब्याज की आरएनए के लिए जुड़े हुए हैं. इस प्रकार, आरएनए aptamers tobramycin और streptomycin21,22,23,24, या प्रोटीन के लिए सहित aminoglycoside एंटीबायोटिक दवाओं के लिए उच्च समानता के साथ बांध, इस तरह के कोट प्रोटीन के रूप में R17/MS2 भोजी या बैक्टीरियल streptavidin एस25,26,27,28,29से । हालांकि इस दृष्टिकोण को अपेक्षाकृत मजबूत और बहुमुखी दिखाया गया था, यह जांच के तहत आरएनए डिजाइन क्लोनिंग की आवश्यकता है, और इस तरह प्राकृतिक mRNAs पर कब्जा नहीं किया जा सकता है । दूसरी ओर, antisense oligonucleotides (ASOs) पर वसूली और अत्यधिक व्यक्त की देशी RNPs30,31 और वायरल RNAs३२के लक्षण वर्णन के लिए जल्दी पर इस्तेमाल किया गया । हाल ही में, ASOs लंबे समय गैर कोडिंग RNAs३३,३४,३५ पर कब्जा करने के लिए लागू किया गया और इन विट्रो में mRNPs३६का गठन । सभी आरएनए केंद्रित दृष्टिकोण के साथ एक प्रमुख सीमित कारक ब्याज की आरएनए की कॉपी संख्या है, कम व्यक्त mRNAs अधिक समस्याग्रस्त की वसूली कर रही है. इस सीमा की प्रतिक्रिया को बढ़ाने से दूर किया जा सकता है; हालांकि, यह संभवतः पृष्ठभूमि बढ़ाने के लिए नेतृत्व कर सकते हैं ।

साथ ही, हम वर्णन हमारे हाल ही में विकसित ASO आधारित आरएनए अलगाव प्रक्रिया (ट्रिप) उच्च selectivity३७ (चित्रा 1) के साथ देशी mRNA-प्रोटीन परिसरों को अलग करने के लिए प्रोटोकॉल दो अनुक्रमिक ASO आधारित शुद्धि कदम, अर्थात् पाली के अलगाव (एक) व्यावसायिक रूप से उपलब्ध oligo (डीटी) के साथ mRNAs विशेष रूप से डिजाइन लघु biotinylated 2 ' का उपयोग कर विशिष्ट mRNAs पर कब्जा करने के बाद मोती युग्मित शामिल है '-methoxy आरएनए ASOs. यह दो कदम प्रक्रिया दूषित प्रोटीन को नष्ट करने में मदद करता है और समायोजन और अनुकूलन के लिए अवसर जोड़ता है । इस उदाहरण में, यात्रा खमीर, सूत्रकृमि, और मानव कोशिकाओं से चयनित mRNAs पर लागू किया गया vivo में पुष्टि mRNA-प्रोटीन परिसरों का गठन ।

Protocol

1. डिजाइन Antisense Oligonucleotides (ASOs)

  1. mRNA या उपलब्ध ऑनलाइन उपकरण३८का उपयोग कर एक टुकड़ा के माध्यमिक संरचना का विश्लेषण । इसलिए, खाली बॉक्स में न्यूक्लियोटाइड (nt) अनुक्रम दर्ज करें । मूलभूत विकल्प बॉक्स में, न्यूनतम मुक्त ऊर्जा (MFE) और विभाजन फ़ंक्शन का चयन करें और पृथक आधार जोड़ों से बचें. आउटपुट विकल्प बॉक्स में, सहभागी आरएनए द्वितीयक संरचना प्लॉट का चयन करें और अंत में आगे बढ़ें बटन क्लिक करें । एक नई विंडो पॉप-अप होगी जो ब्याज की mRNA की द्वितीयक संरचना को प्रदर्शित करती है ।
  2. रुचि के mRNA के भीतर, तरजीही (जैसे, unstructure छोरों में) और 3 ' unstructure क्षेत्रों (UTR) में (उदाहरणके लिए, unstructure्ड लूप में) का अभाव क्षेत्रों में कम से तीन अलग 21-24 एनटीएस लंबे अनुक्रम का चयन करें ।
    नोट: यह देखा गया है कि ASOs एनीलिंग 3 ' untranslated क्षेत्रों (UTR) में अनुक्रम के लिए सबसे अच्छा प्रदर्शन किया । एक संभावना यह है कि कोडिंग अनुक्रम (CDS) से बाउंड ribosomes कभी-कभार ASOs के एनीलिंग को बाधा कर सकता है । ASOs एनीलिंग 5 ' UTRs की जांच नहीं की गई ।
    1. ५०% के करीब एक guanidine/cytosine अनुपात के साथ क्षेत्रों का चयन करें और hairpins या स्वयं एनीलिंग के संभावित गठन से बचने के लिए न्यूक्लियोटाइड मिलकर दोहराता कमी ।
  3. मैन्युअल रूप से डिजाइन 2 '-methoxy संशोधित आरएनए 3 ' में एक बायोटिन moiety असर oligonucleotides, पूरी तरह से चयनित क्षेत्रों के लिए पूरक (चरण १.२) वांछित लक्ष्य mRNA के भीतर.
    नोट: 2 '-methoxy संशोधन आरएनए सेलुलर RNases के लिए प्रतिरोधी प्रदान और द्वैध पिघलने तापमान, जो कड़े धोने के लिए अनुमति देता है बढ़ जाती है । streptavidin के साथ ASOs पर कब्जा करने के लिए बायोटिन moiety की आवश्यकता होती है ।
    1. आरएनए संकर के पिघलने तापमान को समायोजित करें ~ 60-65 ° c और यह सुनिश्चित करें कि यह एक उच्च भाषाई अनुक्रम जटिलता है (> 60%) के रूप में उपयुक्त ऑनलाइन उपकरण३९के साथ निर्धारित किया है ।
    2. transcriptome में अंय mRNAs के साथ संभावित ASO क्रॉस-संकरण के लिए खोज करने के लिए मूल स्थानीय संरेखण खोज उपकरण४० का उपयोग करें । न्यूक्लियोटाइड ब्लास्टका चयन करें, खाली डब्बे में जुगाड़ डालें और प् याज के जीव का चयन करें । शेष पैरामीटर डिफ़ॉल्ट के रूप में रखें और क्लिक करें ब्लास्ट
      नोट: 8-10 एनटीएस का सम आंशिक निरंतर संरेखण इस mRNA के पार-संकरण और पुनर्प्राप्ति का कारण बन सकता है ।

2. सेल संस्कृति, यूवी विकिरण और सेल Lysis

नोट: निंनलिखित में, प्रक्रिया के लिए वर्णित है नवोदित खमीर एस cerevisiae, सूत्रकृमि सी एलिगेंस, और मानव भ्रूण गुर्दे की कोशिकाओं (HEK293) । फिर भी, यह अंय जीवों के रूप में अच्छी तरह से अनुकूलित किया जा सकता है, हालांकि यह स्पष्ट रूप से अभी तक परीक्षण नहीं किया गया ।

  1. एस. cerevisiae
    1. बढ़ती खमीर कोशिकाओं (जैसे, तनाव BY4743 derivate; MATa/α his3Δ1/his3Δ1 leu2Δ0/leu2Δ0 LYS2/lys2Δ0 met15Δ0/MET15ura3Δ0/ura3Δ0 PFK2: PFK2 मीडिया के ५०० मिलीलीटर (1% खमीर निकालने, 2% YPD, 2% डी ग्लूकोज) में २२० rpm पर लगातार मिलाते के साथ 30 डिग्री सेल्सियस पर ठोकर/
    2. मिड-लॉग चरण में कोशिकाओं को इकट्ठा (६०० एनएम (आयुध डिपो)६०० ~ ०.६ पर ऑप्टिकल घनत्व) निस्पंदन द्वारा ०.४५ µm नायलॉन फिल्टर का उपयोग कर या के लिए ३,००० × g पर 2 मिनट के लिए कमरे के तापमान (आरटी) । प्रवाह-के माध्यम से या supernatant, क्रमशः त्यागें ।
    3. कोशिकाओं को धो फॉस्फेट के 25 मिलीलीटर के साथ तीन बार बफर-खारा (पंजाब) ०.४५ µm नायलॉन फ़िल्टर का उपयोग कर या ३,००० × g पर 2 मिनट के लिए RT पर और supernatant त्याग द्वारा इकट्ठा । जितनी जल्दी हो सके कोशिकाओं को इकट्ठा करने के रूप में लगाया तनाव आरएनए-प्रोटीन बातचीत पर एक प्रभाव हो सकता है ।
    4. पंजाब के 25 एमएल में कोशिकाओं को फिर से सस्पेंड और फिर एक 15 सेमी पेट्री डिश में सस्पेंशन डालना । बर्फ पर पकवान प्लेस, ढक्कन हटाने के लिए, और कोशिकाओं को बेनकाब ४०० एम एम सेमी-2 २५४ एनएम यूवी प्रकाश के साथ एक यूवी-crosslinker में 2-ंयूनतम कोमल मिश्रण के साथ प्रत्येक जोखिम चक्र के बीच बर्फ पर टूट जाता है के साथ तीन बार ।
    5. एक ५० मिलीलीटर ट्यूब करने के लिए कोशिकाओं को हस्तांतरण और 4 डिग्री सेल्सियस पर 3 मिनट के लिए ३,००० × जी पर केंद्रापसारक द्वारा कोशिकाओं को इकट्ठा । supernatant को त्यागें और गोली रखें ।
      नोट: कोशिकाओं को तरल नाइट्रोजन में जमे हुए स्नैप किया जा सकता है और-८० डिग्री सेल्सियस पर संग्रहीत ।
    6. ठंडा lysis बफर के 4 मिलीलीटर में कोशिकाओं resuspend (पौंड-a; १०० एमएम Tris-एचसीएल, पीएच ७.५, ५०० एमएम LiCl, 10 एमएम EDTA, 1% ट्राइटन एक्स-१००, 5 एमएम डीटीटी, 20 यू एमएल-1 DNase, १०० यू एमएल-1 RNasin, पूरा EDTA-फ्री टीज़-अवरोधक कॉकटेल) ।
    7. दो 2 मिलीलीटर ट्यूबों में कोशिकाओं स्थानांतरण । अधिकतम जोड़ें । ठंडा गिलास मोतियों की ⅔ मात्रा और 30 हर्ट्ज पर एक ऊतक lyser में कोशिकाओं को बाधित पर 10 मिनट के लिए 4 डिग्री सेल्सियस.
    8. एक गर्म सुई के साथ ट्यूब के तल में एक छेद पंच और 30 एस के लिए ६०० × जी पर केंद्रापसारक द्वारा एक ताजा १.५ मिलीलीटर ट्यूब के लिए lysate हस्तांतरण ।
    9. 3 मिनट के लिए ३,००० × जी में 4 डिग्री सेल्सियस पर तीन अनुक्रमिक केंद्रापसारक द्वारा lysate स्पष्ट है, तो ५,००० × g और १०,००० × 5 मिनट प्रत्येक के लिए जी ।
      नोट: अर्क तरल नाइट्रोजन में स्नैप-जमे हुए और-८० डिग्री सेल्सियस पर संग्रहित किया जा सकता है ।
  2. C. एलिगेंस
    1. संस्कृति ब्रिस्टल N2 कीड़े 20 डिग्री सेल्सियस पर निमेटोड विकास मध्यम (NGM) प्लेटों पर (०.३% NaCl, १.७% आगर, ०.२५% peptone, 1 मिमी CaCl2, 5 µ जी/एमएल कोलेस्ट्रॉल, 1 मिमी MgSO4, 25 मिमी केपीओ4 बफर, पीएच ६.०) OP50 ई कोलाई तनाव के साथ वरीयता प्राप्त ४१ .
    2. M9 बफर४१ के 5 मिलीलीटर जोड़ें (०.३% KH2PO4, ०.६% न2HPO4, ०.५% NaCl, 1 मिमी MgSO4) प्रत्येक थाली के लिए, प्लेट हिला कीड़े resuspend और एक 15 मिलीलीटर ट्यूब करने के लिए कीड़े हस्तांतरण । एक स्लाइड में निलंबन के 2 µ एल प्लेस और एक खुर्दबीन के साथ निलंबन में कीड़े गिनती । फिर थाली प्रति कीड़े की संख्या की गणना करने के लिए कारक लागू होते हैं ।
    3. कमरे के तापमान (४०० × g, 2 min, RT) पर केंद्रापसारक द्वारा ~ १२०,००० कीड़े इकट्ठा करने और supernatant त्यागें ।
    4. तीन बार कीड़े धो लें । इसलिए, M9 बफर के 10 मिलीलीटर जोड़ने, उलटा द्वारा मिश्रण और आरटी पर 2 मिनट के लिए ४०० × जी में केंद्रापसारक द्वारा कीड़े इकट्ठा ।
    5. 15 मिनट के लिए RT पर एक rotatory व्हील पर कीड़े और जगह करने के लिए M9 बफर के १५ मिलीलीटर जोड़ें
    6. NGM प्लेटों के लिए कीड़े हस्तांतरण (~ ४,००० थाली प्रति कीड़े) और यूवी प्रकाश (२५४ एनएम) ३०० पर एक यूवी-crosslinker में सेमी-2 में बेनकाब ।
    7. M9 बफर के 5 मिलीलीटर सीधे प्लेट में जोड़ें और बफर में कीड़े resuspend करने के लिए प्लेट हिला । एक 15 मिलीलीटर ट्यूब के लिए एक पिपेट के साथ निलंबन स्थानांतरण और आर टी पर 2 मिनट के लिए ४०० × जी पर केंद्रापसारक द्वारा कीड़े इकट्ठा ।
    8. lysis बफर बी के 2 मिलीलीटर में कीड़े resuspend (LB-b; १०० एमएम Tris-एचसीएल, पीएच ८.०, १५० एमएम NaCl, 1 एमएम EDTA, ०.७५% IGEPAL, 1 एमएम डीटीटी, 20 यू एमएल-1 DNase, १०० यू एमएल-1 RNasin, पूरा EDTA-फ्री टीज़र-अवरोधक कॉकटेल) ।
    9. तरल नाइट्रोजन से भरे मोर्टार में कीड़े को पीस लें । एक ५० मिलीलीटर ट्यूब में पाउडर ले लीजिए और आरटी पर गल ।
      नोट: तरल नाइट्रोजन सुरक्षा प्रक्रियाओं (जैसे, धुएं डाकू और सुरक्षा दस्ताने) के अनुसार संभाला जाना चाहिए
    10. 10 मिनट के लिए १४,००० × जी पर केंद्रापसारक द्वारा वसा परत सहित lysate स्पष्ट है और बाद में एक सिरिंज के साथ एक ०.४५ माइक्रोन फिल्टर के माध्यम से स्पष्ट lysate पारित ।
  3. मानव संस्कृतिक कोशिकाओं
    नोट: निम्नलिखित विवरण pGL3-CDKN1B-3'UTR रिपोर्टर प्लाज्मिड के साथ HEK293 कोशिकाओं के क्षणिक अभिकर्मक पर आधारित है जो UTR के 3 ' CDKN1B/ जुगनू luciferase जीन४२के 27 बहाव को व्यक्त करता है ।
    1. Dulbecco के संशोधित ईगल के माध्यम में संस्कृति HEK293 कोशिकाओं (DMEM) 25 मिमी ग्लूकोज और 1 मिमी सोडियम पाइरूवेट, १०० यू एमएल के साथ पूरक-1 पेनिसिलिन, १०० µ जी एमएल-1 streptomycin और 10% भ्रूण गोजातीय सीरम (FBS), और एक में ३७ डिग्री सेल्सियस पर मशीन humidified चैंबर (मशीन) 5% सह2युक्त ।
    2. बीज ~ 3 × 106 एक मानक 10 सेमी ऊतक संस्कृति डिश में HEK293 कोशिकाओं अभिकर्मक से पहले दिन । किसी hemocytometer के साथ कक्षों की गणना करना.
    3. मिक्स रिपोर्टर जीन के 2 µ जी (जैसे, pGL3-p27-3 ' UTR) µ रिएजेंट के 20 अभिकर्मक एल के साथ और transfect ७०% पर कोशिकाओं को प्रभावित (~ 7 × 106 कोशिकाओं) ।
    4. एक मशीन में ३७ डिग्री सेल्सियस पर आगे ४८ एच के लिए कटाई से पहले कोशिकाओं प्लेस ।
    5. एक सीरम वैज्ञानिक पिपेट के साथ मध्यम निकालें और जल्दी से दो बार ३७ डिग्री सेल्सियस पर पूर्व गर्म पंजाबियों की 10 मिलीलीटर के साथ कोशिकाओं को धो । एक सीरम वैज्ञानिक पिपेट के साथ पंजाबियों को हटा दें ।
    6. पकवान, बर्फ पर जगह के लिए पंजाब के 6 मिलीलीटर जोड़ें और फिर यूवी प्रकाश (२५४ एनएम) में १०० माइकल एम एम सेमी-2 में एक यूवी-crosslinker में कोशिकाओं को बेनकाब ।
      नोट: थाली यूवी प्रकाश जोखिम के दौरान बर्फ पर रखा जाना चाहिए ।
    7. पंजाबियों में (कुल ~ 107 कोशिकाओं में) बंद कोशिकाओं परिमार्जन और एक 15 मिलीलीटर ट्यूब करने के लिए स्थानांतरण ।
    8. 4 डिग्री सेल्सियस पर 10 मिनट के लिए २५० × जी में कोशिकाओं को नीचे स्पिन और फिर एक पिपेट के साथ supernatant निकालें ।
      नोट: सेल गोली तरल नाइट्रोजन में स्नैप-जम जा सकता है और उपयोग करने तक-८० ° c पर संग्रहीत ।
    9. पहले से 2 मिलीलीटर में कोशिकाओं resuspend-ठंडा lysis बफर (पौंड-A) ऊपर और नीचे के लिए pipetting द्वारा 5-6 बार, जबकि बर्फ पर ट्यूब रखते हुए ।
    10. lysate एक पिपेट के साथ एक 5 मिलीलीटर ट्यूब बर्फ पर रखा के लिए स्थानांतरण ।
    11. बर्फ पर ठंडा अवधि के 30 एस के साथ 10 माइक्रोन आयाम में 20 एस फटने से मिलकर sonication के तीन दौर के लिए lysate विषय ।
      नोट: यह कोशिकाओं के lysis पूरा करता है और डीएनए टुकड़े के रूप में Sonication की सिफारिश की है ।
    12. 2 मिलीलीटर ट्यूबों के लिए lysate स्थानांतरण और 4 डिग्री सेल्सियस पर 10 मिनट के लिए १५,००० × जी में केंद्रापसारक । supernatant इकट्ठा (= निकालें) और एक नई ट्यूब के लिए स्थानांतरण । एक विश्लेषणात्मक नमूना (5-10%) आगे प्रोटीन और आरएनए विश्लेषण के लिए निकालें ।
      नोट: यह चरण किसी भी शेष कक्ष मलबे को निकालने के लिए महत्वपूर्ण है और दोहराया जा सकता है ।

3. पहला कदम: पाली (क) आरएनए अलगाव

  1. Equilibrate 1 oligo के मिलीग्राम (dT)25-संबंधित lysis बफर के ५०० µ एल में चुंबकीय मोती युग्मित ।
  2. मिश्रण 5 मिलीग्राम, 10 मिलीग्राम या 4 मिलीग्राम (प्रोटीन) एस cerevisiae, सी एलिगेंस या HEK293 अर्क, क्रमशः, के साथ 1 oligo की मिलीग्राम (dT)25 -चुंबकीय मोती युग्मित. एक मिक्सर में 25 डिग्री सेल्सियस पर 10 मिनट के लिए जोरदार नमूने मिश्रण ।
    नोट: अर्क के प्रोटीन सांद्रता एक संदर्भ मानक के रूप में गोजातीय सीरम एल्ब्युमिन (BSA) का उपयोग कर ब्रैडफोर्ड परख के साथ निर्धारित किया जा सकता है । नमूनों की जोरदार झटकों मोतियों की तलछट को रोकता है । mRNA अलगाव की विशिष्टता का मूल्यांकन करने के लिए, एक नियंत्रण प्रयोग समानांतर में polyadenylic एसिड (फिलीस्तीनी अथॉरिटी) के एक अतिरिक्त (20 µ जी) जोड़कर किया जा सकता है ।
  3. 10 एस के लिए एक चुंबकीय स्टैंड पर ट्यूबों प्लेस और supernatant हटा दें । वसूली के बाद के दौर के लिए बर्फ पर supernatant रखें (३.७ कदम) ।
  4. जोड़ें ५०० µ एल धोने बफर एक (10 मिमी Tris-एचसीएल, पीएच ७.५, ६०० मिमी LiCl, 1 मिमी EDTA, ०.१% ट्राइटन एक्स-१००) के लिए मोती और भंवर के लिए 5 एस.
    नोट: LiCl की एकाग्रता में वाश बफ़र्स भिन्न हो सकते हैं । ६०० मिमी LiCl की सिफारिश की है, लेकिन कम सांद्रता भी परीक्षण किया गया (५०० मिमी के लिए सी. एलिगेंस, ३०० मिमी के लिए HEK293).
  5. एक चुंबक के साथ मोतियों को इकट्ठा करने और फिर धोने बफर बी के ५०० µ एल के साथ दो बार मोतियों धोने (पश्चिम बंगाल; 10 मिमी Tris-एचसीएल, पीएच ७.५, ६०० मिमी LiCl, 1 मिमी EDTA) ।
  6. Elute 10 मिमी Tris-एचसीएल के 30 µ एल में आरएनए, एक मिक्सर में लगातार मिलाते हुए (१,००० rpm) के साथ 2 मिनट के लिए ८० डिग्री सेल्सियस पर पीएच ७.५ । तुरंत चुंबकीय स्टैंड में ट्यूब जगह और eluate के बाद 10 एस इकट्ठा । शुद्धिकरण के अतिरिक्त फेरे के लिए मोतियों को बचाएं.
    नोट: कम तापमान पर मोतियों को mRNAs के संभावित rebindinging को रोकने के लिए जितनी जल्दी हो सके eluate इकट्ठा ।
  7. कदम ३.३ पर एकत्र supernatant के लिए पिछले कदम से मोती जोड़ें, और दोहराने पर कब्जा, कपड़े धोने और mRNAs के रेफरेंस में दो बार (कदम 3.3-3.6) । दोहराया दौर से eluates तो संयुक्त कर रहे है और-८० डिग्री सेल्सियस पर संग्रहित किया जा सकता है ।

4. दूसरा चरण: 3 '-Biotinylated 2 ' के साथ विशिष्ट mRNAs का कब्जा-Methoxy संशोधित Antisense आरएनए Oligonucleotides

नोट: ASOs की उपयुक्तता का परीक्षण करने के लिए, निम्न कार्यविधि कुल RNAs कक्षों से पृथक के साथ किया जा सकता है ।

  1. Equilibrate 30 µ एल के streptavidin-युग्मित और धो बफर के 1 मिलीलीटर में चुंबकीय मोतियों से मिलकर (B & W बफर; 10 मिमी Tris-एचसीएल, पीएच ७.५, १५० मिमी NaCl, ०.५ मिमी EDTA, पीएच ८.०) युक्त ०.१ मिलीग्राम एमएल-1ई कोलाई हस्तांतरण आरएनए (tRNA) एक रोटेटर पर 1 ज के लिए आरटी.
    1. बी और डब्ल्यू बफर के ७५० µ एल के साथ तीन बार मोतियों को धो लें ।
    2. बी और डब्ल्यू बफर के 30 µ एल में मोती resuspend और उपयोग जब तक बर्फ पर रखो ।
  2. पतला ~ ३५ पिछले पाली से कुल प्रोटीन का µ जी (एक) अलगाव (3 देखें) में १०० µ एल के B & W बफर एक १.५ मिलीलीटर ट्यूब में ।
    नोट: कुल आरएनए के साथ ASOs की विशिष्टता का परीक्षण करने के लिए, बी एंड डब्ल्यू बफर के १०० µ एल के लिए शुद्ध कुल आरएनए के ६०० एनजी जोड़ें ।
  3. संबंधित ASO के २०० pmol जोड़ें और 5 मिनट के लिए ७० ° c पर मशीन ।
    नोट: ऊंचा तापमान ASO के एनीलिंग की सुविधा के लिए आरएनए में माध्यमिक संरचनाओं का निराकरण करता है ।
  4. डिवाइस से पूरे गर्मी ब्लॉक निकालें और यह आरटी पर 10 मिनट के लिए जगह धीरे नीचे शांत करने के लिए ।
  5. equilibrated streptavidin के 30 µ एल जोड़ें-नमूना करने के लिए कदम ४.१ से चुंबकीय मोती युग्मित ।
  6. एक मिक्सर में ९५० rpm पर लगातार मिलाते के साथ 25 डिग्री सेल्सियस में 30 मिनट के लिए मिश्रण की मशीन ।
    नोट: यह हर 10 मिनट के लिए मोतियों की तलछट को रोकने के लिए ट्यूबों झटका सिफारिश की है ।
  7. चुंबकीय स्टैंड पर ट्यूबों प्लेस, supernatant को दूर करने और ५५ डिग्री सेल्सियस पर पूर्व गरम बी और डब्ल्यू बफर के ७५० µ एल के साथ तीन बार मोती धो लो ।
    नोट: इष्टतम धो तापमान थोड़ा अलग हो सकता है/ यह सेल अर्क के साथ प्रयोग करने से पहले गैर crosslinked कुल आरएनए के साथ इस शर्त को समायोजित करने की सिफारिश की है ।
  8. 10 मिमी Tris के 20 µ एल में आरएनए Elute-एचसीएल, एक मिक्सर में ९५० rpm पर लगातार झटकों के साथ 10 मिनट के लिए ९० डिग्री सेल्सियस पर पीएच ७.५ चुंबकीय स्टैंड में ट्यूबों प्लेस और तुरंत eluate इकट्ठा ।
    नोट: प्रोटीन विश्लेषण के लिए, 1 × Laemmli बफर के 20 µ एल जोड़ें मोती और ९५ ° c पर मशीन के लिए 5 min. प्रोटीन मानक प्रयोगशाला प्रोटोकॉल के बाद immunoblot विश्लेषण द्वारा निगरानी कर रहे हैं ।

Representative Results

हम तीन अलग जीवों३७से उनके बंधे प्रोटीन के साथ विशेष रूप से mRNAs पर कब्जा करने के लिए एक ASO आधारित आरएनए अलगाव रणनीति, अवधि की यात्रा, विकसित की है । मूलतः, आरएनए-प्रोटीन परिसरों २५४ एनएम पर कोशिकाओं के यूवी विकिरण द्वारा vivo में crosslinked थे, और पाली (एक) RNAs व्यावसायिक रूप से उपलब्ध oligo (डीटी) युग्मित-चुंबकीय मोतियों के साथ बरामद किया गया, तो ब्याज की mRNA के साथ अलग किया गया था 3 '-biotinylated 2-0 '-methoxy संशोधित antisense आरएनए oligonucleotides (चित्रा 1). इसलिए हम तैयार खमीर, सी एलिगेंस और मानव से चयनित mRNAs में क्षेत्रों के लिए पूर्ण complementarity के साथ कई 21-24 एनटीएस संशोधित ASOs, और उनकी उपयुक्तता का परीक्षण करने के लिए ब्याज की mRNA (प्राइमरों और ASOs की एक सूची तालिका में दिया जाता है ठीक 1). व्यक्तिगत ASOs की दक्षता और विशिष्टता पहले गैर crosslinked कुल आरएनए संबंधित जीव से पृथक के साथ मूल्यांकन किया गया । इन प्रयोगों में आरएनए ASOs streptavidin-संयुग्मित paramagnetic मोतियों को युग्मित किया गया और इसी जीव से तैयार गैर-crosslinked कुल आरएनए के साथ मशीनी बनाई गई. मोतियों से छीना mRNAs की रिहाई के बाद mRNA लक्ष्य की उपस्थिति के साथ ही असंबंधित नियंत्रण mRNAs रिवर्स प्रतिलेखन (आरटी) द्वारा निगरानी की गई थी-पोलीमरेज़ चेन रिएक्शन (पीसीआर)३७। हमने देखा है कि दो चर, नमक एकाग्रता और धो बफ़र्स के तापमान, खमीर से PFK2 mRNA के कब्जा की क्षमता में महत्वपूर्ण भूमिका निभाई है कि तीन अलग ASOs (चित्रा 2a) के साथ परीक्षण किया गया था । 25 मिमी करने के लिए नमक (NaCl) एकाग्रता को कम करने नकारात्मक नियंत्रण mRNA (PFK1) के सभी ASOs के साथ गैर जासूसी स्तर के लिए की वसूली कम हो, लेकिन यह भी वांछित लक्ष्य mRNA PFK2 की वसूली (इनपुट का 10-15%) कम कर दिया. इसके विपरीत, शारीरिक स्तर के लिए नमक सांद्रता की वृद्धि (१५० mM NaCl) ASO PFK2-2 के साथ ७५% करने के लिए PFK2 mRNAs की वसूली में वृद्धि हुई है, कि नियंत्रण PFK1 mRNA की अधिक से कम 5 गुना (चित्रा 2a) से अधिक । आगे ध्यान दें की, विभिंन ASOs शारीरिक नमक पर mRNA लक्ष्य पर कब्जा efficacies के महान रूपांतर दिखाया-सांद्रता, ASOs के अनुभवजंय सत्यापन के लिए आवश्यकता पर बल वॉश बफर के तापमान पर mRNA वसूली की निर्भरता C. एलिगेंस वयक-1 और खमीर RPS20 mRNAs, संबंधित ASOs (तालिका 1) का उपयोग कर के लिए उदाहरण है । हमने देखा है कि इष्टतम धो तापमान ५० डिग्री सेल्सियस और ५५ डिग्री सेल्सियस के बीच था, के रूप में असंबंधित mRNAs और mRNAs लक्ष्य (चित्रा बी) के कुशल वसूली के साथ कम पृष्ठभूमि से स्पष्ट है । इस बिंदु पर, हम अंय mRNAs के साथ ASOs के पार संकरण की संभावना पर जोर देना चाहते हैं । उदाहरण के लिए, DNM1 ASO पूरी तरह से DNM1 कोडन अनुक्रम के भीतर एक अनुक्रम के लिए पूरक है, लेकिन यह भी आंशिक रूप से ACT1 mRNA के साथ anneals । DNM1 ASOs दोनों mRNAs चाहे धोने तापमान, पार संकरण (चित्रा 2c) के लिए मजबूत प्रवृत्ति दिखा बरामद किया । अंत में, हम उपर्युक्त परीक्षणों और अनुकूलन का इस्तेमाल किया है तीन ASOs है कि कुल आरएनए से संबंधित लक्ष्य mRNAs की वसूली के लिए उपयुक्त थे का चयन करने के लिए एस cerevisiae, सी एलिगेंस और मानव कोशिकाओं से अलग (चित्रा 2d ).

इन विट्रो में उपयुक्त ASOs के प्रारंभिक चयन के बाद, हम सेल अर्क यूवी-crosslinked जीवों से प्राप्त के साथ यात्रा का प्रदर्शन किया (चित्रा 1) । विशेष रूप से, हमने तीन विभिन्न जीवों से तीन भिन्न mRNAs की वसूली का परीक्षण किया: PFK2 mRNA से खमीर एस. cerevisiae, वयक-1 से निमेटोड सी. एलिगेंस, और एक रिपोर्टर mRNA (pGL3-CDKN1B-3'UTR) असर 3 ' UTR मानव ल्यूक कोशिकाओं में क्षणिक अभिव्यक्ति के लिए एक luciferase (HEK293) रिपोर्टर से जुड़े हुए मानव CDKN1B/p27 mRNA के अनुक्रम । आरएनए अलगाव की विशिष्टता को नियंत्रित करने के लिए, हम कई असंबंधित mRNAs की वसूली पर नजर रखी, और हम सेल अर्क है, जो सेलुलर mRNAs oligo (डीटी) 25 के बंधन के साथ प्रतिस्पर्धा करने के लिए फिलीस्तीनी अथॉरिटी के एक अतिरिक्त के अलावा द्वारा प्रतियोगिता प्रयोगों प्रदर्शन पहला कदम शुद्धिकरण कदम के दौरान मोती । के रूप में पहले गैर crosslinked कुल आरएनए नमूनों (चित्रा 2) के साथ देखा, आर टी-पीसीआर यात्रा के दौरान संबंधित mRNAs लक्ष्य mRNA के संवर्धन की पुष्टि की, जबकि कई गैर संबंधित नियंत्रण mRNAs (3 ए आंकड़ा) समृद्ध नहीं थे । इसके अलावा, न तो mRNAs ASOs के बिना मोतियों पर पाए गए, उपयुक्त अवरुद्ध प्रक्रियाओं है कि विशिष्ट बाध्यकारी से बचने का संकेत है । इस लाइन पर, असंबंधित/तले ASOs भी नियंत्रण के रूप में इस्तेमाल किया जा सकता है, हालांकि कुछ mRNAs और बाध्य प्रोटीन के आस्थगित कब्जा के साथ पार संकरण के लिए क्षमता है तो खाते में लिया जाना है । अंतिम eluate में प्रोटीन के बाद से चांदी सना हुआ polyacrylamide जैल पर शायद ही visualized किया जा सकता है (नहीं दिखाया गया डेटा), पहले से ज्ञात mRNA की उपस्थिति प्रोटीन आगे immunoblot विश्लेषण द्वारा मूल्यांकन किया गया था । यह एस cerevisiaeसे Pfk2p शामिल है, जो चुनिंदा PFK2 mRNA में एक ribosome स्वतंत्र तरीके से बांधता है12; C. एलिगेंस GLD-1, एक विहित RBP जो 3 को बांधता है ' UTR के लिए वयक-1 mRNA के जुगाड़ के लिए शोधों के विनियमन४३; और हूर, एक RBP कि mRNA स्थिरता और p27 के अनुवाद /CDKN1B mRNA४४को नियंत्रित करता है । जैसा कि उंमीद थी, इन प्रोटीन के सभी पश्चिमी दाग विश्लेषण (चित्र बी) द्वारा संबंधित mRNAs के ट्रिप eluates में पहचान की गई ।

Figure 1
चित्र 1. यात्रा के योजनाबद्ध प्रतिनिधित्व । प्रोटीन vivo में यूवी-विकिरण द्वारा आरएनए के लिए crosslinked हैं । पहले चरण में (लाइट ग्रीन बॉक्स), पाली (ए) आरएनए-प्रोटीन कॉम्प्लेक्स oligo (डीटी)25 मोतियों के साथ कठोर धुलाई शर्तों को लागू करने के लिए असीम प्रोटीन को दूर करने के लिए बरामद कर रहे हैं । दूसरे चरण (गुलाबी बॉक्स) में, लक्ष्य mRNP biotinylated antisense आरएनए oligonucleotides और streptavidin मोतियों के साथ बाहर निकाला जाता है । शुद्ध mRNPs तो आर टी-पीसीआर और immunoblot/मास-स्पेक्ट्रोमेट्री (एमएस) द्वारा RNAs और प्रोटीन की पहचान करने के लिए ब्याज की mRNA के साथ बातचीत, क्रमशः विश्लेषण कर रहे हैं । यह आंकड़ा पिछले प्रकाशन३७ से अनुमति के साथ संशोधित किया गया था । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 2
चित्र 2. संशोधित antisense आरएनए कैप्चर जांच का उपयोग करते हुए गैर-crosslinked कोशिकाओं की कुल आरएनए से चयनित mRNAs का अलगाव/ () ASOs के साथ खमीर PFK2 mRNA के कैप्चरिंग दक्षता पर नमक सांद्रता के प्रभाव । खमीर कोशिकाओं से कुल आरएनए संकेत ASOs के साथ संयुक्त और ५५ डिग्री सेल्सियस पर निर्दिष्ट नमक (NaCl) एकाग्रता युक्त बफर के साथ धोया गया था । ग्रीन, ब्लू और ऑरेंज लाइनों RT-पीसीआर३७: PFK2-1 और PFK2-2 ऐनी में 3 ' UTR, PFK2-4 में द्वारा निर्धारित के रूप में विभिन्न ASOs के साथ PFK2 mRNA वसूली का प्रतिनिधित्व सीडी में. PFK1 नकारात्मक नियंत्रण mRNA. पीसीआर ३२ प्रवर्धन चक्र और quantified के साथ प्रदर्शन के रूप में पहले३७वर्णित किया गया था । () सी. eleganscep के अंश-1 और खमीर RPS20 ASO बाउंड mRNAs को अलग वॉश तापमान पर, क्रमशः काले और लाल रेखाओं में दर्शाया गया है । C. eleganspgk-1 और यीस्ट ACT1 नॉन टारगेट (control) mRNAs हैं । 30 और ३२ पीसीआर साइकिल क्रमशः खमीर और सी एलिगेंस mRNAs, का पता लगाने के लिए आवेदन किया गया था । () DNM1 mRNA में अनुक्रम के साथ-साथ DNM1 ASO (लाल) के संकरण का योजनाबद्ध निरूपण और साथ ही संकरण ACT1 के साथ संभावित पार mRNA को बाईं ओर दिखाया गया है. एक agarose जेल आरटी से उत्पादों को दिखा रहा है-पीसीआर प्रतिक्रियाओं (30 चक्र) के लिए खमीर DNM1 और ACT1 mRNAs eluted के मोतियों से पता लगाने के लिए सही करने के लिए दिखाया गया है । इनपुट, कुल आरएनए; Sn, ASOs के साथ मशीन के बाद supernatant; ई, eluates के संकेत तापमान पर धोया मोतियों से पूर्व रेफरेंस (४० डिग्री सेल्सियस, ५० डिग्री सेल्सियस और ६० डिग्री सेल्सियस) । एक नियंत्रण प्रयोग (Ctrl) ASO जोड़ने के बिना समानांतर में किया गया था । (घ) mRNAs का पता लगाने के लिए आरटी-पीसीआर उत्पाद दिखा Agarose जेल (दाएं) खमीर एस cerevisiae, सी एलिगेंस, और मानव HEK293 कोशिकाओं (एच sapiens) की कुल आरएनए से कब्जा कर लिया । इनपुट, कुल आरएनए; Sn, supernatant; ई, मोतियों से eluates. पीसीआर खमीर mRNAs, सी एलिगेंस mRNAs के लिए ३२ चक्र, और 28 और मानव tubulin और p27 mRNAs, क्रमशः के लिए 30 चक्र के लिए 30 प्रवर्धन चक्र द्वारा किया गया था । यह आंकड़ा पिछले प्रकाशन३७ से अनुमति के साथ संशोधित किया गया था । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 3
चित्र 3. यात्रा के साथ यूवी crosslinked कोशिकाओं से व्युत्पंन अर्क से विशिष्ट mRNA-प्रोटीन परिसरों का कब्जा । (A) oligo (dT) के साथ कैप्चर करने पर RT-पीसीआर के साथ mRNAs (right) का पता लगाने के लिए Agarose जैल और एस cerevisiae, सी. एलिगेंस और ह्यूमन (एच. sapiens) सेल के अर्क से संकेत ASOs. इनपुट, crosslinked कोशिकाओं से कुल आरएनए/ Ctrl, ASO के बिना नियंत्रण । पाली (अ), पाली (अ) के साथ प्रतियोगिता । आर टी-पीसीआर ल्यूक, p27के लिए ३२ चक्र, और tubulinके लिए 29 चक्र के लिए ३५ प्रवर्धन चक्र के साथ३७ वर्णित के रूप में प्रदर्शन किया गया । () संकेत एंटीबॉडी के साथ mRNA-बाउंड प्रोटीन का Immunoblot विश्लेषण (दाएँ). लोड अंशों निंनानुसार हैं: ०.१%, २.५% और 1% खमीर, निमेटोड और मानव आदानों के लिए; 10%, 10% और खमीर के लिए 5%, निमेटोड और मानव oligo (डीटी) गलियों; और सभी ASOs गलियों के लिए ६६% । kilodaltons (केडीए) में आणविक भार (मेगावाट) दर्शाया गया है । ३७अनुमति के साथ पुनर्प्रकाशित चित्रा । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

प्राइमरी का नाम अनुक्रम लक्ष्य आकार
Pfk2_Fwd GTGTTAAGGGTTCACATGTCG PFK2 एस. cerevisiae १३३ बीपी
Pfk2_Rev CTTCCAACCAAATGGTCAGC PFK2 एस. cerevisiae १३३ बीपी
Pfk1_Fwd GGTGATTCTCCAGGTATGAATG PFK1 एस. cerevisiae ९७ बीपी
Pfk1_Rev CTTCGTAACCTTCGTAAACAGC PFK1 एस. cerevisiae ९७ बीपी
Act1_Fwd GTCTGGATTGGTGGTTCTATC ACT1 एस. cerevisiae ८५ बीपी
Act1_Rev GGACCACTTTCGTCGTATTC ACT1 एस. cerevisiae ८५ बीपी
Dnm1_Fwd CTGTGTTCGATGCATCAGAC DNM1 एस. cerevisiae १५६ बीपी
Dnm1_Rev CGCACTCCAATTCTTCTCTC DNM1 एस. cerevisiae १५६ बीपी
Rps20_Fwd CGCTGAACAACACAACTTGG RPS20 एस. cerevisiae २२८ बीपी
Rps20_Rev GGAAGCAACAACAACTTCGAC RPS20 एस. cerevisiae २२८ बीपी
Cep1_Fwd CGATGAAGAGAAGTCGCTGT वयक-1 सी. एलिगेंस ११० बीपी
Cep1_Rev ATCTGGGAACTTTTGCTTCG वयक-1 सी. एलिगेंस ११० बीपी
Pgk1_Fwd GCGATATTTATGTCAATGATGCTTTC pgk-१ सी. एलिगेंस ७४ बीपी
Pgk1_Rev TGAGTGCTCGACTCCAACCA pgk-१ सी. एलिगेंस ७४ बीपी
Mpk1_Fwd TGCTCAGTAATCGGCCATTG mpk-१ सी. एलिगेंस ७४ बीपी
Mpk1_Rev TCCAACAACTGCCAAAATCAAA mpk-१ सी. एलिगेंस ७४ बीपी
p27_Fwd TTTAAAAATACATATCGCTGACTTCATGG p27 H. sapiens २१२ बीपी
p27_Rev CAAAGTTTATGTGCTACATAAAAGGTAAAAA p27 H. sapiens २१२ बीपी
Luc_Fwd AATGGCTCATATCGCTCCTGGAT Luciferase P. pγralis ११७ बीपी
Luc_Rev TGGACGATGGCCTTGATCTTGTCT Luciferase P. pγralis ११७ बीपी
β-TUBULIN_Fwd CTGAACCACCTTGTCTCAGC β-TUBULIN H. sapiens १३६ बीपी
β-TUBULIN_Rev AGCCAGGCATAAAGAAATGG β-TUBULIN H. sapiens १३६ बीपी
PFK2-1 ASO AAUAGAAAGUGUAAUAAAAGGUCAU 3 ' UTR PFK2 S. cerevisiae -
PFK2-2 ASO GUUUCAUGGGGUAGUACUUGU 3 ' UTR PFK2 S. cerevisiae -
PFK2-4 ASO CUUGAAGAGGAGCGUUCAUA ओआरएफ PFK2 एस. cerevisiae -
DNM1 Aso UCGGUCAGUGGAGGUUCAGCGUUU ओआरएफ DNM1 एस. cerevisiae -
RPS20 Aso GUCGGUAAUAGCCUUCUCAUUCUUG ओआरएफ RPS20 एस. cerevisiae -
वयक-1 Aso GUGAGAAAUGCGGUGCUUUGAAA 3 ' UTR वयक-1 सी. एलिगेंस -
p27 Aso UCAUACCCCGCUCCACGUCAGUU 3 ' UTR p27 H. sapiens -

तालिका 1. Oligonucleotide जुगाड़. इस काम में इस्तेमाल किया पीसीआर प्राइमरों और ASOs की सूची, प्राइमर अनुक्रम, जीन लक्ष्य और प्रवर्धन के बाद की उम्मीद टुकड़ा आकार.

Discussion

यात्रा जैव रासायनिक साधन के साथ vivo में विशिष्ट mRNAs के लिए बाध्य प्रोटीन के विश्लेषण की अनुमति देता है । जबकि हमने विभिन्न जीवों/कोशिकाओं से mRNA लक्ष्य के साथ विशेष RBPs की बातचीत को मान्य करने के लिए विधि का उपयोग किया है, यात्रा भी पाली के अन्य प्रकार के अध्ययन के लिए लागू किया जा सकता है (एक) RNAs, जैसे cytoplasmic लंबे ncRNAs. इसके अलावा, सीमित प्रोटीन का व्यवस्थित विश्लेषण और/या RNAs एमएस या आरएनए अनुक्रमण के साथ प्रक्रिया की एक अप-स्केलिंग द्वारा प्राप्त किया जा सकता है । इस संबंध में, हमारे प्रारंभिक डेटा इंगित करता है कि 1 खमीर संस्कृतियों के एल और मानव HEK293 कोशिकाओं के कम से १००,०००,००० पर्याप्त शुरू करने के लिए अच्छी तरह से व्यक्त mRNAs (अप्रकाशित परिणाम) के लिए विश्वसनीय एमएस डेटा प्राप्त सामग्री प्रदान कर सकता है ।

वर्णित यात्रा प्रोटोकॉल crosslink आरएनए-प्रोटीन बातचीत करने के लिए २५४ एनएम पर यूवी प्रकाश के साथ कोशिकाओं के विकिरण भी शामिल है । यह शुद्धि के दौरान कड़े धोने शर्तों के कार्यांवयन में सक्षम बनाता है । फिर भी, हालांकि स्पष्ट रूप से परीक्षण नहीं, हम ध्यान दें कि crosslinking वैकल्पिक है और सक्रिय RNPs शारीरिक बफ़र्स के साथ पुनर्प्राप्त किया जा सकता है चाहते हैं । हालांकि, इस मामले में, lysates में लक्ष्य आरएनए पर प्रोटीन और या RNAs की संभावित पुनः व्यवस्था को ध्यान में रखा जाना चाहिए । इसके विपरीत, यदि यूवी या अंय crosslinking प्रक्रियाओं (जैसे, formaldehyde) लागू कर रहे हैं, आरएनए की अखंडता का मूल्यांकन किया जाना चाहिए के रूप में आरएनए गिरावट mRNPs की कम वसूली के लिए नेतृत्व कर सकते हैं । इसके अतिरिक्त, यूवी crosslinking बजाय अक्षम है (~ 5%) और भी कम प्रोटीन के लिए तो डबल असहाय आरएनए के साथ बातचीत, जो12RBPs के कुछ वर्गों का पता लगाने के लिए पूर्वाग्रह का परिचय सकता है । अंत में, यूवी विकिरण भी प्रोटीन प्रोटीन और प्रोटीन-डीएनए crosslinks कि डेटा व्याख्या४५,४६के लिए विचार किया जाना चाहिए प्रेरित कर सकते हैं । इसलिए, वैकल्पिक crosslinking प्रक्रियाओं, formaldehyde के साथ उदाहरण के लिए, भी विशेष रुचि के mRNAs पर बड़ा प्रोटीन असेंबलियों पर कब्जा हो सकता है ।

यात्रा की एक प्रमुख विशेषता है दो कदम ASO-आधारित शुद्धि प्रक्रिया विशेष RNAs को ठीक करने के लिए, जिससे selectivity बढ़ाने और सह-शुद्धि पदार्थों की संभाव्यता कम हो रही है । उदाहरण के लिए, एक चिंता biotinylated ASOs सीधे जोड़ने के लिए सेल निष्कर्षों है, जो सह करने के लिए नेतृत्व कर सकता से संबंधित है बायोटिन-बाध्यकारी प्रोटीन की शुद्धि । इस यात्रा में पाली के शुद्धिकरण के पहले दौर (क) RNAs covalently युग्मित oligo-(डीटी)25 चुंबकीय मोती है, जो आरएनए-प्रोटीन interactome कब्जा के लिए किया के रूप में कड़े शोधन शर्तों के लिए अनुमति देता है का उपयोग करके दरकिनार है । इसके अलावा, पाली (क) आरएनए चयन अत्यधिक प्रचुर ncRNAs को निकालता है, जैसे राइबोसोमल RNAs और tRNAs, और इसलिए क्रॉस-संकरण और संदूषण के लिए नमूना और संभावित स्रोतों की जटिलता को कम करता है । दूसरे चरण में, विशेष mRNAs biotinylated और संशोधित ASOs है कि mRNA लक्ष्यों पर क्षेत्रों के साथ ऐनी के साथ बरामद कर रहे हैं । वैकल्पिक रूप से, संशोधित ASOs भी सीधे एक अमीन-linker के द्वारा चुंबकीय मोतियों से जुड़ी covalently सकता है, प्रवृत्ति को कम करने के लिए बायोटिन बाध्यकारी प्रोटीन पर कब्जा । हालांकि, हमारे अनुभव में, पाली की मशीन (एक) streptavidin मोतियों के अलावा से पहले ASOs के साथ आरएनए अंश ASO-युग्मित मोतियों के प्रत्यक्ष अलावा से अधिक कुशलता से mRNPs बरामद किया । संभवतः, मुक्त ओलिगोस्पर्मिया के रूप में मैटीरियल ओलिगोस्पर्मिया की तुलना में संरचित आरएनए में दृश्यों के लिए बेहतर पहुँच के साथ-साथ इष्ट हैं । इसलिए, ASOs के आबंध युग्मन नमूने के साथ मशीन से पहले मोतियों को आरएनए लक्ष्य की वसूली के लिए हानिकारक हो सकता है और empirically का परीक्षण किया जाना है ।

ASO आधारित विधियों के साथ एक खामी कुछ लक्ष्य mRNAs की अकुशल वसूली है । इसलिए हम कई ASOs के मूल्यांकन की सिफारिश है कि प्रतिलिपि के विभिंन क्षेत्रों के लिए ऐनी । विशेष रूप से, हम 2-3 ASOs के डिजाइन कि 3 ' में अनुक्रम के साथ ऐनी-UTR या ब्याज की mRNA की सीडी सुझाव है । प्रत्येक ASO संबंधित mRNA लक्ष्य की वसूली के लिए एक अलग दक्षता प्रदर्शन कर सकते हैं और empirically परीक्षण किया जाना चाहिए (चित्रा 2a, बी, डेटा नहीं दिखाया गया है). अंत में, हमने पाया है कि 3 ' UTRs के लिए ASOs एनीलिंग बेहतर लोगों को सीडी के लिए एनीलिंग की तुलना में प्रदर्शन किया । यह ribosomes अनुवाद के अभाव के कारण UTRs में बाध्यकारी साइटों की वृद्धि की पहुंच के कारण हो सकता है, जबकि ribosomes सीडी के भीतर कुशल संकरण बाधा हो सकता है । हम यह भी अनुभव है कि कई ASOs के संयोजन प्रचुर मात्रा में गैर लक्ष्य mRNAs और कम खींचने से संदूषण वृद्धि के लिए नेतृत्व कर सकता है दक्षता नीचे । किसी भी स्थिति में, चुने हुए ओलिगोस्पर्मिया के selectivity प्रतियोगिता प्रयोगों (जैसे, प्रतिस्पर्धा ओलिगोस्पर्मिया के अलावा) द्वारा नियंत्रित किया जा सकता है ।

एक और चिंता असंबद्ध RNAs के साथ संभावित पार संकरण से संबंधित है, जैसा कि हमने देखा कि अंय mRNAs के साथ भी आंशिक संकरण कि mRNA (चित्रा 2c) की वसूली के लिए नेतृत्व कर सकते हैं । डिजाइन ASOs की उपयुक्तता का मूल्यांकन करने के लिए, हम इसलिए में प्रारंभिक प्रदर्शन करने की सिफारिश कुल RNAs के साथ परीक्षण करने के लिए नमक सांद्रता और बफ़र्स की धुलाई तापमान का अनुकूलन । हमारे हाथों में, streptavidin की धुलाई-५५ ° c पर १५० mM NaCl युक्त बफ़र्स में चुंबकीय मोती युग्मित सबसे अच्छा प्रदर्शन किया, लेकिन हम प्रत्येक डिजाइन ASO के लिए शर्तों के स्वतंत्र परीक्षणों की सलाह देते हैं । उल्लेखनीय है, हमने पाया है कि सभी ASOs इन विट्रो प्रयोगों (चित्रा 2d) से चयनित crosslinked सेल निष्कर्षों (चित्रा 3) से संबंधित mRNA लक्ष्य पर कब्जा करने के लिए उपयुक्त थे, आगे की वैधता substantiating में इन विट्रो भन्ने । mRNA कैप्चर के लिए उपयुक्त ASOs डिजाइन करने के अलावा, selectivity पर अतिरिक्त कारकों का प्रभाव पड़ सकता है । इसलिए, व्यापक BSA और/या मनका प्रकार विनिर्देशों के अनुसार tRNA के साथ प्रक्रियाओं को रोकने के मोती के लिए विशिष्ट बाध्यकारी रोक सकते हैं । आगे प्रोटीन की विशिष्ट अवशोषण को कम करने के लिए, हम भी लो-बांध ट्यूबों के उपयोग की सिफारिश, खासकर जब नमूनों की कम मात्रा के साथ काम कर रहे ।

आम तौर पर, यात्रा पहले से स्थापित दृष्टिकोण ASOs के साथ RNAs पर कब्जा पूरक कर सकते हैं । उदाहरण के लिए, गैर कोडिंग आरएनए Xist लंबे (९०-मेर) biotinylated डीएनए oligonucleotides कि पूरे प्रतिलिपि कवर की एक सरणी का उपयोग करके 200-800 मिलियन यूवी crosslinked कोशिकाओं से व्युत्पंन परमाणु निष्कर्षों से बाध्य प्रोटीन के साथ अलग किया गया था ३४,३५. हालांकि, चुना टाइलिंग दृष्टिकोण पार के लिए महान क्षमता के प्रकाश में समस्याग्रस्त हो सकता है संकरण असंबंधित RNAs के साथ, और यह विशिष्ट प्रतिलिपि, उदाहरणके लिए, वैकल्पिक रूप से ब्याह रूपों का चयन नहीं किया जा सकता है । हाल ही में, विशेष रूप से न्यूक्लिक एसिड बंद डिजाइन (LNA) या डीएनए ASO mixmers एक चुंबकीय राल से जुड़ी covalently थे इन विट्रो प्रतिलिपि में ठीक या उच्च कोशिका से राइबोसोमल RNAs व्यक्त मुक्त निष्कर्षों; हालांकि, यह की वसूली के लिए परीक्षण नहीं किया गया vivo में गठित mRNA-प्रोटीन कॉम्प्लेक्स३६. RBPs और ncRNA द्वारा पोस्ट-transcriptional जीन नियंत्रण की वृद्धि हुई मांयता के प्रकाश में, हमें विश्वास है कि यात्रा एक उपयोगी तरीका है और intracellular और पर्यावरण cues और इसके प्रभाव पर कोशिकाओं के भीतर RNP परिसरों की गतिशीलता की जांच करने के लिए है स्वास्थ्य और रोग में ।

Disclosures

लेखकों का खुलासा करने के लिए कुछ नहीं है ।

Acknowledgments

हम आभारी हैं डॉ जोनाथन हॉल और Mauro Zimmermann (ETH ज्यूरिख) के संश्लेषण के लिए PFK2 और वयक-1 ASOs, डॉ Maikel वाउटर के डिजाइन के लिए p27/CDKN1B ASOs, और डॉ रफाल Ciosk (फ्रेडरिक Miescher इंस्टीट्यूट फॉर बायोमेडिकल रिसर्च, बेसल) एंटी-GLD-1 एंटीबॉडी के लिए । यह काम जैव प्रौद्योगिकी और जैव विज्ञान अनुसंधान परिषद् द्वारा समर्थित किया गया था (BB/K009303/1) और एक रॉयल सोसाइटी Wolfson रिसर्च मेरिट अवार्ड (WM170036) को A.P.G.

Materials

Name Company Catalog Number Comments
MaxQ 5000 Large Incubated and Refrigerated Orbital Shaker Thermo Fisher Scientific SHKE5000-8CE Floor shaker to grow yeast cells
BBD 6220 Thermo Fisher Scientific CO2 incubator to grow human cells
Sonicator Soniprep150 MSE MSS150.CX4.5 Sonicator/cell disruptor. Used to shear DNA in human cell lysates
Stratalinker 1800 Stratagene Stratalinker to expose cells to UV light at 254 nm
Tissue Lyser Qiagen RETSCH MM200 Device to mechanically disrupt yeast cells
Refrigerated Centrifuge Eppendorf 5810R Centrifuge to spin down cells, lysates
Shaking incubator, Thriller Peqlab Thermoshaker for 1.5 mL tubes
Glass beads 0.5mm Stratech Scientific Limited 11079105 Lysis of yeast cells
Nylon Filter, 0.41 μm Millipore NY4104700 Collection of yeast cells
Millex-HA Filter, 0.45 µm EMD Millipore SLHA02510 Filter to clear nematode lysate
Eppendorf LoBind microcentrifuge tubes Protein 1.5 mL Sigma-Aldrich 22431081 Minimise protein loss
2 mL microfuge tube Ambion AM12425 Yeast extract preparation and other applications
5 mL tube Thermo Fisher Scientific 129A Collection of HEK293 cell lysate
15 mL tube Sarstedt 62.547.254 Collection C. elegans
50 mL plastic tube Sarstedt 62.554.502 Collection yeast cells
DMEM, high glucose, pyruvate Thermo Fisher Scientific 41966 Media for culturing HEK293 cells
Penicillin-Streptomycin Sigma-Aldrich P4333 Used to supplement cell culture media to control bacterial contamination
Fetal Bovine Serum (FBS) Sigma-Aldrich F7524 Used to supplement cell culture media
Lipofectamine 2000 Thermo Fisher Scientific 11668027 Transfection reagent
RQ1 RNase-Free DNase Promega M6101 DNAse I to degrade DNA from cell lysate
RNasin Plus RNase Inhibitor Promega N2611 RNase inhibitor to avoid RNA degradation
cOmplete, Mini, EDTA-free Protease Inhibitor Cocktail Roche 11836170001 Protease inhibitor cocktail to avoid protein degradation
Dynabeads Oligo (dT)25 Thermo Fisher Scientific 61011 Magnetic beads required for the first step of mRNA-protein complex purification
Dynabeads M-280 Streptavidin Thermo Fisher Scientific 11205D Magnetic beads required for the second step of mRNA-protein complex purification
E. coli tRNA Sigma-Aldrich 10109550001 transfer RNA from E. coli used for blocking streptavidin beads and avoid unsepecific interactions
Quick Start Bradford 1x Dye Reagent BioRad 5000205 To determine protein concentration within lysates, using BSA as reference
Bovine Serum Albumin Sigma A7906-100G Used to perform the standard curve that will be used as reference for protein concentration determination
mouse anti-Act1 MP Biomedicals 869100 Antibody for detection of yeast actin in Western blot (1:2,500)
mouse anti-Act1 Sigma A1978 Antibody for detection of human actin in Western blot (1:2,000)
mouse anti-HuR Santa Cruz sc-5261 Antibody for detection of HuR in Western blot (1:500)
mouse anti–CYC-1 Invitrogen 456100 Antibody for detection of Cyc-1 in Western blot (1:1,000)
peroxidase anti-peroxidase soluble complex Sigma P1291 Detection of Pfk2:TAP in Western blot (1:5,000)
HRP-conjugated sheep anti-mouse IgG Amersham NXA931 HRP-coupled secondary antibody

DOWNLOAD MATERIALS LIST

References

  1. Mitchell, S. F., Parker, R. Principles and properties of eukaryotic mRNPs. Molecular Cell. 54, (4), 547-558 (2014).
  2. Iadevaia, V., Gerber, A. P. Combinatorial Control of mRNA Fates by RNA-Binding Proteins and Non-Coding RNAs. Biomolecules. 5, (4), 2207-2222 (2015).
  3. McHugh, C. A., Russell, P., Guttman, M. Methods for comprehensive experimental identification of RNA-protein interactions. Genome Biology. 15, (1), 203 (2014).
  4. Matia-González, A. M., Gerber, A. P. Ch. 14. Fungal RNA Biology. Sesma, A., von der Haar, T. Springer. 347-370 (2014).
  5. Tsvetanova, N. G., Klass, D. M., Salzman, J., Brown, P. O. Proteome-wide search reveals unexpected RNA-binding proteins in Saccharomyces cerevisiae. PLoS One. 5, (9), (2010).
  6. Castello, A., et al. Insights into RNA biology from an atlas of mammalian mRNA-binding proteins. Cell. 149, (6), 1393-1406 (2012).
  7. Baltz, A. G., et al. The mRNA-bound proteome and its global occupancy profile on protein-coding transcripts. Molecular Cell. 46, (5), 674-690 (2012).
  8. Castello, A., et al. System-wide identification of RNA-binding proteins by interactome capture. Nature Protocols. 8, (3), 491-500 (2013).
  9. Liao, Y., et al. The Cardiomyocyte RNA-Binding Proteome: Links to Intermediary Metabolism and Heart Disease. Cell Reports. 16, (5), 1456-1469 (2016).
  10. Liepelt, A., et al. Identification of RNA-binding Proteins in Macrophages by Interactome Capture. Molecular Cell Proteomics. 15, (8), 2699-2714 (2016).
  11. Conrad, T., et al. Serial interactome capture of the human cell nucleus. Nature Communications. 7, 11212 (2016).
  12. Matia-Gonzalez, A. M., Laing, E. E., Gerber, A. P. Conserved mRNA-binding proteomes in eukaryotic organisms. Nature Structural and Molecular Biology. 22, (12), 1027-1033 (2015).
  13. Mitchell, S. F., Jain, S., She, M., Parker, R. Global analysis of yeast mRNPs. Nature Structural and Molecular Biology. 20, (1), 127-133 (2013).
  14. Beckmann, B. M., et al. The RNA-binding proteomes from yeast to man harbour conserved enigmRBPs. Nature Communications. 6, 10127 (2015).
  15. Wessels, H. H., et al. The mRNA-bound proteome of the early fly embryo. Genome Research. 26, (7), 1000-1009 (2016).
  16. Sysoev, V. O., et al. Global changes of the RNA-bound proteome during the maternal-to-zygotic transition in Drosophila. Nature Communications. 7, 12128 (2016).
  17. Despic, V., et al. Dynamic RNA-protein interactions underlie the zebrafish maternal-to-zygotic transition. Genome Research. 27, (7), 1184-1194 (2017).
  18. Zhang, Z., et al. UV crosslinked mRNA-binding proteins captured from leaf mesophyll protoplasts. Plant Methods. 12, 42 (2016).
  19. Reichel, M., et al. In Planta Determination of the mRNA-Binding Proteome of Arabidopsis Etiolated Seedlings. Plant Cell. 28, (10), 2435-2452 (2016).
  20. Koster, T., Marondedze, C., Meyer, K., Staiger, D. RNA-Binding Proteins Revisited - The Emerging Arabidopsis mRNA Interactome. Trends Plant Sciences. 22, (6), 512-526 (2017).
  21. Hamasaki, K., Killian, J., Cho, J., Rando, R. R. Minimal RNA constructs that specifically bind aminoglycoside antibiotics with high affinities. Biochemistry. 37, (2), 656-663 (1998).
  22. Bachler, M., Schroeder, R., von Ahsen, U. StreptoTag: a novel method for the isolation of RNA-binding proteins. RNA. 5, (11), 1509-1516 (1999).
  23. Vazquez-Pianzola, P., Urlaub, H., Rivera-Pomar, R. Proteomic analysis of reaper 5' untranslated region-interacting factors isolated by tobramycin affinity-selection reveals a role for La antigen in reaper mRNA translation. Proteomics. 5, (6), 1645-1655 (2005).
  24. Hartmuth, K., Vornlocher, H. P., Luhrmann, R. Tobramycin affinity tag purification of spliceosomes. Methods Molecular Biology. 257, 47-64 (2004).
  25. Beach, D. L., Keene, J. D. Ribotrap : targeted purification of RNA-specific RNPs from cell lysates through immunoaffinity precipitation to identify regulatory proteins and RNAs. Methods Molecular Biology. 419, 69-91 (2008).
  26. Slobodin, B., Gerst, J. E. A novel mRNA affinity purification technique for the identification of interacting proteins and transcripts in ribonucleoprotein complexes. RNA. 16, (11), 2277-2290 (2010).
  27. Slobodin, B., Gerst, J. E. RaPID: an aptamer-based mRNA affinity purification technique for the identification of RNA and protein factors present in ribonucleoprotein complexes. Methods Molecular Biology. 714, 387-406 (2011).
  28. Yoon, J. H., Gorospe, M. Identification of mRNA-Interacting Factors by MS2-TRAP (MS2-Tagged RNA Affinity Purification). Methods Molecular Biology. 1421, 15-22 (2016).
  29. Leppek, K., Stoecklin, G. An optimized streptavidin-binding RNA aptamer for purification of ribonucleoprotein complexes identifies novel ARE-binding proteins. Nucleic Acids Research. 42, (2), 13 (2014).
  30. Blencowe, B. J., Sproat, B. S., Ryder, U., Barabino, S., Lamond, A. I. Antisense probing of the human U4/U6 snRNP with biotinylated 2'-OMe RNA oligonucleotides. Cell. 59, (3), 531-539 (1989).
  31. Lingner, J., Cech, T. R. Purification of telomerase from Euplotes aediculatus: requirement of a primer 3' overhang. Proceedings of the National Academy of Sciences U S A. 93, (20), 10712-10717 (1996).
  32. Upadhyay, A., Dixit, U., Manvar, D., Chaturvedi, N., Pandey, V. N. Affinity capture and identification of host cell factors associated with hepatitis C virus (+) strand subgenomic RNA. Molecular Cell Proteomics. 12, (6), 1539-1552 (2013).
  33. Imig, J., et al. miR-CLIP capture of a miRNA targetome uncovers a lincRNA H19-miR-106a interaction. Nature Chemical Biology. 11, (2), 107-114 (2015).
  34. Chu, C., et al. Systematic discovery of Xist RNA binding proteins. Cell. 161, (2), 404-416 (2015).
  35. McHugh, C. A., et al. The Xist lncRNA interacts directly with SHARP to silence transcription through HDAC3. Nature. 521, (7551), 232-236 (2015).
  36. Rogell, B., et al. Specific RNP capture with antisense LNA/DNA mixmers. RNA. 23, (8), 1290-1302 (2017).
  37. Matia-Gonzalez, A. M., Iadevaia, V., Gerber, A. P. A versatile tandem RNA isolation procedure to capture in vivo formed mRNA-protein complexes. Methods. 93-100 (2017).
  38. Gruber, A. R., Lorenz, R., Bernhart, S. H., Neubock, R., Hofacker, I. L. The Vienna RNA websuite. Nucleic Acids Research. 36, (Web Server issue), Available from: http://rna.tbi.univie.ac.at/cgi-bin/RNAWebSuite/RNAfold.cgi W70-W74 (2008).
  39. Kalendar, R., Khassenov, B., Ramankulov, Y., Samuilova, O., Ivanov, K. I. FastPCR: An in silico tool for fast primer and probe design and advanced sequence analysis. Genomics. 109, (3-4), Available from: http://primerdigital.com/tools/PrimerAnalyser.html 312-319 (2017).
  40. Altschul, S. F., Gish, W., Miller, W., Myers, E. W., Lipman, D. J. Basic local alignment search tool. Journal of Molecular Biology. 215, (3), 403-410 (1990).
  41. Stiernagle, T. Maintenance of C. elegans. WormBook. 1-11 (2006).
  42. Kedde, M., et al. A Pumilio-induced RNA structure switch in p27-3' UTR controls miR-221 and miR-222 accessibility. Nature Cell Biology. 12, (10), 1014-1020 (2010).
  43. Schumacher, B., et al. Translational repression of C. elegans p53 by GLD-1 regulates DNA damage-induced apoptosis. Cell. 120, (3), 357-368 (2005).
  44. Ziegeler, G., et al. Embryonic lethal abnormal vision-like HuR-dependent mRNA stability regulates post-transcriptional expression of cyclin-dependent kinase inhibitor p27Kip1. Journal of Biological Chemistry. 285, (20), 15408-15419 (2010).
  45. Itri, F., et al. Femtosecond UV-laser pulses to unveil protein-protein interactions in living cells. Cellular and Molecular Life Sciences. 73, (3), 637-648 (2016).
  46. Zhang, L., Zhang, K., Prandl, R., Schoffl, F. Detecting DNA-binding of proteins in vivo by UV-crosslinking and immunoprecipitation. Biochemical and Biophysical Research Communications. 322, (3), 705-711 (2004).
एक Oligonucleotide आधारित मिलकर आरएनए अलगाव प्रक्रिया Eukaryotic mRNA-प्रोटीन परिसरों को पुनर्प्राप्त करने के लिए
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Iadevaia, V., Matia-González, A. M., Gerber, A. P. An Oligonucleotide-based Tandem RNA Isolation Procedure to Recover Eukaryotic mRNA-Protein Complexes. J. Vis. Exp. (138), e58223, doi:10.3791/58223 (2018).More

Iadevaia, V., Matia-González, A. M., Gerber, A. P. An Oligonucleotide-based Tandem RNA Isolation Procedure to Recover Eukaryotic mRNA-Protein Complexes. J. Vis. Exp. (138), e58223, doi:10.3791/58223 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter