Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Biochemistry

진 핵 세포 mRNA 단백질 복합물을 복구 하는 Oligonucleotide 기반 협동 RNA 격리 절차

doi: 10.3791/58223 Published: August 18, 2018
* These authors contributed equally

Summary

Endogenously 구성 된 mRNA 단백질 복합물의 복구에 대 한 협동 RNA 격리 절차 (여행) 설명 되어 있습니다. 특히, RNA-단백질 복합물 가교 된에서 vivo에서, polyadenylated RNAs는 격리 oligo(dT) 구슬, 추출 물 이며 특정 한 mRNAs와 수정 된 RNA 센스 oligonucleotides 캡처됩니다. 단백질 mRNAs에 바인딩된 immunoblot 분석에 의해 검색 됩니다.

Abstract

RNA 의무적인 단백질 (RBPs) post-transcriptional 유전자 발현 통제에 주요 역할을 재생합니다. 따라서, mRNA 단백질 복합물의 생 화 확 적인 특성 상호 작용 단백질 또는 비 코딩 RNAs에 의해 유추 하는 mRNA 규정을 이해 하는 데 필수적 이다. 여기, 탠덤 RNA 격리 절차 (여행) 세포 추출 물에서 endogenously 형성된 mRNA 단백질 복합물의 정화를 가능 하 게 설명 합니다. 2 단계 프로토콜 포함 polyadenylated mRNAs 센스 oligo(dT) 구슬 및 후속의 다음으로 고립 될 수 있다 3'-biotinylated 2'-O-갠 센스 RNA oligonucleotides와 함께 관심 있는 mRNA의 캡처의 격리 streptavidin 구슬입니다. 여행 가교 된 mRNA-ribonucleoprotein (mRNP) 단지 vivo에서 효 모, 선 충 및 추가 RNA와 단백질 분석에 대 한 인간의 세포에서 복구할 데 사용 되었습니다. 따라서, 여행은 mRNPs 세포내 또는 환경 단서에 의해 부과 된의 동적 다시 배열 공부 하는 생물에 걸쳐 polyadenylated RNAs의 모든 종류에 적용할 수 있습니다 다목적 접근 이다.

Introduction

Post-transcriptional 유전자 규칙 구동 RNA 의무적인 단백질 (RBPs), 비 코딩 RNAs (ncRNAs) 및 mRNAs 사이 상호 작용을 통해이 직접 처리, 현지화, 번역 및 셀1 에 내에서 모든 대 본의 , 2. RBPs 고 ribonucleoprotein 단지/입자 (RNPs)로 알려져 설정 특정 mRNAs와 상호 작용 하는 ncRNA mRNAs와 유전자 식 컨트롤의 운명을 이해 하는 열쇠 이므로. RNP 단지3,4의 생 화 확 적인 특성에 대 한 보완 방법을 착수: "RNA 중심" 접근을 포함 한다 "단백질 중심" 접근은 특정 RBPs의 정화를 바탕으로, 하는 동안은 모집단 또는 개별 RNAs 및 상호 작용 단백질 또는 RNAs의 후속 분석의 격리. 최근, polyadenylated와 상호 작용 하는 RBP 레 퍼 토리의 식별을 위한 RNA 중심 접근 (poly(A)) RNAs5 인기 끌고있다 점점 단백질-RNA 안정화 하는 자외선 (UV) 빛 가교 단계를 통합 하 여 상호 작용 이전 극적으로 인간 세포6,7,,89,10,11RBPs의 카탈로그를 확장, mRNAs의 격리 꼬마 선 충 12,14, saccharomyces cerevisiae12,13,및 다른 유기 체15,,1617,18, 19,20. 그러나, 단백질의 특정 사본에 ncRNAs 매핑 여전히 좋은 도전입니다. 이 위해, 두 가지 주요 방법을 현재 사용: 한편으로, RNA aptamer 태그 친 화력 정화 수 있도록 관심의 RNA를 융합 하는. 따라서, RNA aptamers aminoglycoside 항생제를 포함 한 tobramycin 및 스21,22,,2324또는 단백질 외 투 단백질 같은 높은 선호도와 바인딩 R17/MS2 살 균 소 또는 세균성 streptavidin S125,,2627,,2829. 비록이 방법은 상대적으로 강력 하 고 다재 다능 한 수를 표시 했다, 조사, 설계는 RNA 복제 요구 하 고 따라서 자연 mRNAs를 캡처하는 데 사용할 수 없습니다. 다른 한편으로, 센스 oligonucleotides (ASOs)는 복구에 대 한 초기에 사용 되었다 하 고의 높은 네이티브 RNPs30,31 및 바이러스 성 RNAs32표현. 더 최근에, ASOs 캡처 오래 비 코딩 RNAs33,,3435 에 적용 된 고 생체 외에서 mRNPs36형성. 모든 RNA 중심 접근 한 주요 제한 요인이 더 문제가 낮은 표현 mRNAs의 복구를 만들기 관심, RNA의 복사본입니다. 이 제한 반응; upscaling에 의해 극복 될 수 있다 그러나,이 잠재적으로 배경 증가 발생할 수 있습니다.

여기, 우리가 우리의 최근에 개발한 아소 기반 협동 RNA 격리 절차 (여행) 높은 선택도37 (그림 1). 와 네이티브 mRNA 단백질 복합물을 설명 두 개의 순차적 아소 기반 정화 단계를 포함 하는 프로토콜, 상용 oligo(dT)와 많은 mRNAs의 특별히 설계 된 짧은 biotinylated 2'-methoxy를 사용 하 여 특정 mRNAs의 캡처 다음 비즈를 결합 하는 즉 ASOs RNA입니다. 이 2 단계 절차는 오염 단백질을 제거 하는 데 도움이 하 고 조정 및 최적화에 대 한 기회를 추가 합니다. 이 경우에, 여행에서 효 모, 선 충, 선택 된 mRNAs에 적용 된 그리고 mRNA 단백질 복합물을 형성 하는 인간 세포 vivo에서 확인 하.

Protocol

1. 디자인 센스 Oligonucleotides (ASOs)

  1. mRNA 또는 단편38사용 가능한 온라인 도구 사용 하 여 그의 이차 구조를 분석 합니다. 따라서, 빈 상자에 뉴클레오티드 (nt) 시퀀스를 입력 합니다. 기본 옵션 상자에서 격리 된 기본적인 쌍을 방지최소 자유 에너지 (MFE) 및 파티션 함수를 선택 합니다. 출력 옵션 상자에서 대화형 RNA 이차 구조 플롯 을 선택 하 고 마지막 진행 버튼을 클릭 합니다. 새 창 관심의 mRNA의 이차 구조를 표시 하는 팝업이 됩니다.
  2. 적어도 3 개의 다른 탐지 보조 구조 부족 한 지역에 우선적으로 관심의 mRNA 내 21-24 국세청 긴 시퀀스를 선택 (., 구조화 되지 않은 루프에서) 및에서 3' 되지 않은 지역 (UTR).
    참고: 그것은 ASOs 3' 되지 않은 지역 (UTR) 시퀀스에 어 닐 링 최고의 수행 관찰 되었습니다. 1 개의 가능성은 리보솜 코딩 시퀀스 (CD)에 바인딩된 ASOs의 어 닐 링 방해 때때로 수 있습니다. 5 ' Utr는 어 닐 링 ASOs 테스트 하지 했다.
    1. 50 %guanidine / 시 토 신 비율 영역을 선택 하 고 헤어핀 또는 어 닐 링 자체의 잠재적인 형성을 피하기 위해 반복 뉴클레오티드 협동 부족.
  3. 디자인 2'-methoxy RNA oligonucleotides biotin moiety는 3', 선택된 영역 (1.2 단계) 원하는 내에 완벽 하 게 보완에 베어링을 수정 하는 수동으로 mRNA를 대상.
    참고: 2'-methoxy 수정 RNA 저항 세포 RNases를 렌더링 하 고 녹는 온도에 엄격한 수 있는 이중을 증가 한다. Biotin moiety는 streptavidin과 ASOs를 캡처 필요 합니다.
    1. ~ 60-65에 RNA 하이브리드의 용융 온도 조정 ° C 높은 언어 시퀀스 복잡 다는 것을 확인 하 고 (> 60%)으로 적합 한 온라인 도구39결정.
    2. 40 기본 로컬 정렬 검색 도구 사용 하 여 잠재적인 아소 크로스-교 잡에는 transcriptome 다른 mRNAs와에 대 한 검색. 뉴클레오티드 폭발, 빈 상자에 시퀀스를 삽입 선택 하 고 관심의 유기 체. 기본으로 나머지 매개 변수를 유지 하 고 폭발을 클릭 합니다.
      참고: 8-10 국세청의도 부분 연속 맞춤 간 교 잡 및이 mRNA의 복구를 발생할 수 있습니다.

2. 문화, UV 방사선 및 세포 세포 세포의 용 해

참고: 다음 절차는 설명 신진 효 모 S. cerevisiae, C. 선 충, 선 충 및 인간 미 발달 신장 세포 (HEK293). 그것은 명시적으로 아직 테스트 하지 않지만 그럼에도 불구 하 고, 뿐만 아니라, 다른 유기 체에 적용할 수 있습니다.

  1. S. cerevisiae
    1. 효 모 세포를 성장 (., BY4743 미분; 변형 MATa/α his3Δ1/his3Δ1 leu2Δ0/leu2Δ0 LYS2/lys2Δ0 met15Δ0/MET15 ura3Δ0/ura3Δ0 PFK2:TAP / PFK2) YPD 미디어의 500 ml에서 (1% 효 모 추출 물, 2% 펩, 2 %D-포도 당) 220 rpm에서 일정 한 동요와 30 ° C에서.
    2. 중간 로그 단계에서 세포를 수집 (600 nm (OD)600 에서 광학 밀도 ~ 0.6) 0.45 μ m 나일론 필터를 사용 하 여 여과 또는 실 온 (RT)에서 2 분 동안 3000 × g에서 원심 분리. 삭제 흐름 통해 또는 상쾌한, 각각.
    3. 셀 세 번 25 mL의 인산 염-버퍼링-염 분 (PBS) 0.45 μ m 나일론 필터를 사용 하 여 세척 또는 RT에서 2 분 동안 3000 × g에서 원심 분리 하 여 수집 하 고는 상쾌한 삭제. 최대한 빨리 부과 스트레스 RNA-단백질 상호 작용에 영향을 미칠 수로 세포를 수집 합니다.
    4. 25 ml PBS의 셀 resuspend 하 고 정지는 15 cm 배양 접시에에서 붓는 다. 얼음에 접시를 놓고, 뚜껑을 제거 하 고 셀 세 번 400 mJ cm-2 부드러운 혼합과 각 노출 주기 사이 얼음에 2 분 휴식 UV crosslinker에서 254 nm 자외선의 노출.
    5. 50 mL 튜브에 세포를 전송 및 4 ° c.에 3 분 동안 3000 × g에서 원심 분리 하 여 세포를 수집 삭제는 상쾌한 고 펠 릿을 유지.
      참고: 셀 스냅 액체 질소에서 냉동 고-80 ° c.에 저장 된 수 합니다.
    6. 냉장된 세포의 용 해 버퍼 A의 4 mL에 셀 resuspend (파운드-A; 100 mM Tris HCl, pH 7.5, 500mm LiCl, 10 mM EDTA, 1% 트라이 톤 X-100, 5mm DTT, 20 U ml-1 DNase I, 100 U ml-1 RNasin, EDTA 무료 프로 테아 제 억제 물 칵테일을 완료).
    7. 2 2 mL 튜브에 세포를 전송 합니다. 최대 추가 합니다. ⅔의 유리 구슬 냉장 볼륨과 4 ° c.에서 10 분 동안 30 Hz에서 조직 lyser의 세포를 중단
    8. 뜨거운 바늘으로 튜브의 하단에 구멍을 펀치와 30에 대 한 600 × g에서 원심 분리 하 여 신선한 1.5 mL 튜브에는 lysate 전송 s.
    9. 3 분 동안 3000 × g에서 4 ° C에서 3 개의 순차 centrifugations에 의해 lysate 5000 × g 그리고 10000 × g 5 분에 대 한 선택을 취소 합니다.
      참고: 추출 스냅인-액체 질소에서 냉동 고 수-80 ° c.에 저장
  2. C. 선 충
    1. 선 충 류 성장 매체 (NGM) 접시 (0.3 %NaCl, 1.7 %agar, 0.25% 펩, 1mm CaCl2, 5 µ g/mL 콜레스테롤, 1mm MgSO4, 25 mM KPO4 버퍼, pH 6.0) OP50 대장균 긴장 시드에 20 ° C에서 문화 브리스톨 N2 웜 41 .
    2. 각 접시에 M9 버퍼41 (0.3% KH24, 0.6% 나2HPO4, 0.5 %NaCl, 1 mM MgSO4)의 5 mL을 추가, resuspend 벌레를 15 mL 튜브에 벌레를 전송 접시를 동요 한다. 슬라이드에는 서 스 펜 션의 2 µ L를 놓고 정지에서 벌레는 현미경으로 계산 합니다. 다음 접시 벌레의 수를 계산 하려면 요소를 적용 합니다.
    3. 수집 ~ 120000 웜 (400 × g, 2 분, RT) 상 온에서 원심 분리 하 여 폐기는 상쾌한.
    4. 벌레 세 번 씻어. 따라서, M9 버퍼의 10 mL을 추가, 반전에 의해 혼합 및 실시간에 2 분 동안 400 × g에서 원심 분리 하 여 벌레를 수집
    5. 벌레를 M9 버퍼의 15 mL를 추가 하 고 실시간에 15 분 동안 회전 바퀴에
    6. NGM 접시 (접시 4000 ~ 웜)에 벌레를 전송 및 UV 빛에 노출 (254 nm) UV-crosslinker에서 300 엠 제이 cm-2 에서.
    7. 접시에 직접 M9 버퍼의 5 mL을 추가 하 고 버퍼에 벌레를 resuspend에 접시를 흔들어. 15 mL 튜브에는 피 펫과 서 스 펜 션을 전송 하 고 실시간에 2 분 동안 400 × g에서 원심 분리 하 여 벌레를 수집
    8. 세포의 용 해 버퍼 B의 2 mL에 벌레를 resuspend (파운드-B; 100 mM Tris HCl, pH 8.0, 150 m m NaCl, 1 mM EDTA, 0.75 %IGEPAL, 1mm DTT, 20 U mL-1 DNase I, 100 U mL-1 RNasin, EDTA 무료 프로 테아 제 억제 물 칵테일을 완료).
    9. 액체 질소로 채워진 박격포에 벌레 갈아. 실시간에 녹여 50 mL 튜브에 분말을 수집
      참고: 액체 질소 안전 절차 (예: 연기 후드와 안전 장갑)에 따라 처리 합니다.
    10. Lysate 10 분 14000 × g에서 원심 분리 하 여 지방 층 포함 한 하 고 이후에 명확히 전달 0.45 μ m 필터 주사기를 통해 lysate.
  3. 사람 배양된 세포
    참고: 다음 설명 기반 과도 transfection HEK293 세포 pGL3-CDKN1B-3 ' UTR 기자 플라스 미드 CDKN1B/27의 하류 반딧불 luciferase 유전자42의 3′UTR 표현 하.
    1. 문화 HEK293 세포 Dulbecco의 수정이 글의 중간 (DMEM)에 하 포도 당 25 m m 및 1 m m 나트륨 pyruvate, 포함 된 100 mL-1 페니실린, 100 µ g mL-1 스과 10% 태아 둔감 한 혈 청 (FBS), 보충 하 고 37 ° c에서 품 어는 습도 챔버 (인큐베이터) 포함 된 5% CO2.
    2. 표준 10cm 조직 문화에 씨 ~ 3 × 106 HEK293 세포 transfection는 전날 접시. hemocytometer 셀을 계산 합니다.
    3. 취재 원 유전자의 믹스 2 µ g (., pGL3-p27-3'UTR) transfection 시 약의 20 µ L와 70 %confluency (~ 7 × 106 셀)에 셀 transfect 고.
    4. 수확 하기 전에 셀 추가 48 h에 대 한 37 ° C에는 인큐베이터에 배치 합니다.
    5. 혈 청 학적인 피 펫과 매체를 제거 하 고 37 ° c.에 미리 예 열 하는 PBS의 10 mL로 두 번 셀을 신속 하 게 세척 혈 청 학적인 피 펫으로 PBS를 제거 합니다.
    6. 접시에 6 mL PBS의 추가 얼음에 놓고 다음 셀 UV 빛에 노출 (254 nm) UV crosslinker에 100 mJ cm-2 에서.
      참고: 접시 유지 되어야 한다 얼음에-자외선 노출 시.
    7. 셀 (총 10 ~7 셀) PBS에 15 mL 튜브에 떨어져 다쳤어요.
    8. 4 ° C에서 10 분 동안 250 × g에서 셀 아래로 회전 시키십시오 하 고는 피 펫과 상쾌한 제거.
      참고: 셀 펠 릿 스냅-액체 질소에서 냉동 고 사용까지-80 ° C에서 저장 될 수 있습니다.
    9. 미리 냉장된 세포의 용 해 버퍼의 2 mL에 셀 resuspend (파운드-A)에 대 한 아래로 pipetting으로 5-6 번, 얼음에 튜브를 유지 하면서.
    10. 얼음에 5 mL 튜브에는 피 펫과 lysate 전송.
    11. 제목 lysate 쥡니다 30와 10 μ m 진폭에서 20 s 파열의 구성의 3 라운드를 얼음에 기간 냉각의 s.
      참고: 쥡니다 세포와 파편 DNA의 세포의 용 해 완료로 좋습니다.
    12. 2 mL 튜브 및 4 ° c.에서 10 분 동안 15000 × g에서 원심 분리기는 lysate 전송 (= 추출) 상쾌한 수집 및 새로운 튜브에 전송. 추가 단백질 및 RNA 분석을 위한 분석 샘플 (5-10%)를 제거 합니다.
      참고:이 단계는 모든 나머지 세포 파편을 제거 하는 중요 하 고 반복 될 수 있습니다.

3. 첫 번째 단계: 많은 RNA 격리

  1. Oligo(dT)25의 1 mg equilibrate-결합 각 세포의 용 해 버퍼의 500 µ L에 자석 구슬.
  2. 결합 5 mg, 10 mg 또는 4 mg (단백질) S. cerevisiae, C. 선 충 또는 HEK293 추출, 각각, oligo(dT)25 의 1 밀리 그램-자석 구슬 결합. 믹서에 25 ° C에서 10 분 동안 적극적으로 샘플을 믹스.
    참고: 추출의 단백질 농도 소 혈 청 알 부 민 (BSA)를 사용 하 여 참조 표준으로 Bradford 분석 실험으로 확인할 수 있습니다. 샘플의 활기찬 동요 구슬의 침전을 방지 합니다. MRNA 격리의 특이성을 평가 하기 위해 제어 실험 polyadenylic 산 (pA)의 초과 (20 µ g)를 추가 하 여 병렬로 수행할 수 있습니다.
  3. 10 s를 제거 마그네틱 스탠드에 튜브를 놓고는 상쾌한. 복구 (단계 3.7)의 다음 라운드에 대 한 얼음에 상쾌한을 유지.
  4. 세척의 500 µ L A 버퍼 추가 (10 mM Tris HCl, pH 7.5, 600mm LiCl, 1 mM EDTA, 0.1% 트라이 톤 X-100) 구슬과 5 소용돌이에 s.
    참고: 워시 버퍼에 LiCl의 농도가 달라질 수 있습니다. 600 mM LiCl 좋지만 낮은 농도 (500 m m C. 선 충, HEK293 300 m m) 테스트도 했다.
  5. 자석으로 비즈를 수집 하 고 구슬 (WB, 10 mM Tris HCl, pH 7.5, 600mm LiCl, 1 mM EDTA)는 워시 버퍼 B의 500 µ L로 두 번 세척.
  6. 믹서에 10 mm Tris HCl, pH 7.5 연속 떨고 (1000 rpm)으로 2 분 동안 80 ° C에서 30 µ L에서 RNA을 elute. 즉시 튜브 마그네틱 스탠드에 놓고 10 후는 eluate 수집 미 저장 정화의 추가 라운드 구슬.
    참고: 낮은 온도에서 구슬에 mRNAs의 잠재적인 다시 바인딩 방지 하기 위해 가능한 한 빨리는 eluate를 수집 합니다.
  7. 3.3 단계에서 수집 된 상쾌한에 구슬 이전 단계에서 추가 하 고 반복 캡처, 세척 및 차입 mRNAs의 두 번 (단계 3.3-3.6). 반복된 라운드에서 있다 다음 결합 하 고-80 ° c.에 저장 될 수 있다

4. 두 번째 단계: 3'-Biotinylated' 2-Methoxy 수정 센스 RNA Oligonucleotides와 특정의 캡처 mRNAs

참고: ASOs의 적합성을 테스트 하기 위해 다음 절차는 총 RNAs 셀에서 격리를 수행할 수 있습니다.

  1. 30 µ L 바인딩의 1 mL에 자석 구슬 streptavidin 결합의 equilibrate와 버퍼 (B & W 버퍼, 10 mM Tris HCl, pH 7.5, 150 mM NaCl, 0.5 m EDTA, pH 8.0)을 씻어 1 시간에 대 한 회전에 0.1 mg mL-1대장균 이동 RNA (tRNA)을 포함 하 실시간
    1. 구슬 B & W 버퍼의 750 µ L로 세 번 세척.
    2. B & W 버퍼의 30 µ L에 구슬 resuspend 그리고 사용까지 얼음에 계속.
  2. 이전 많은 격리에서 총 단백질의 ~ 35 µ g을 희석 (참조 3) 1.5 mL 튜브에 B & W 버퍼의 100 µ L에서.
    참고: 총 RNA와 ASOs의 특이성을 테스트 하려면 추가 600 B & W 버퍼의 100 µ L 정제 총 RNA의 ng.
  3. 각각 아소의 200 pmol 추가 하 고 5 분 동안 70 ° C에서 품 어.
    참고: 높은 온도 아소의 어 닐 링을 촉진 하는 RNA 이차 구조를 해결 합니다.
  4. 장치에서 전체 열-블록을 제거 하 고 천천히 진정 10 분에 대 한 실시간에 그것을 배치.
  5. 4.1 단계에서 샘플 equilibrated streptavidin 결합 자석 구슬의 30 µ L를 추가 합니다.
  6. 믹서에 950 rpm에서 일정 한 동요와 25 ° C에서 30 분 동안 혼합물을 품 어.
    참고:이 좋습니다 구슬의 침전을 방지 하기 위해 튜브 마다 10 분 영화를.
  7. 튜브에 마그네틱 스탠드, 제거는 상쾌한 놓고 55 ° c.에 세 번으로 미리 데워 B & W 버퍼의 750 µ L 구슬 세척
    참고: 최적의 세척 온도 달라질 수 있습니다 약간 다르다/다른 ASOs 사이. 비 가교 된 총 RNA 사전 셀 추출 물으로 실험을 수행으로이 상태를 조정 하는 것이 좋습니다.
  8. 10 mm Tris HCl, pH 7.5 믹서. 에 950 rpm에서 일정 한 동요와 10 분 동안 90 ° C에서 20 µ L에서 RNA elute 마그네틱 스탠드에 튜브를 놓고는 eluate 즉시 수집 합니다.
    참고: 단백질 분석용 구슬에 1 × Laemmli 버퍼의 20 µ L을 추가 하 고 5 분 단백질은 immunoblot 분석 표준 실험실 프로토콜을 다음에서 모니터링에 대 한 95 ° C에서 품 어.

Representative Results

우리는 여행, 3 다른 유기 체37에서 바인딩된 단백질 그들의 특정 한 mRNAs를 잡으려고 불리는 아소 기반 RNA 격리 전략 개발. 본질적으로, RNA-단백질 복합물 가교 된에서 vivo에서 했다 254 nm, 및 많은 세포의 UV 방사선에 의해 RNAs는 상용 올리고 (dT) 결합 하는 자석 구슬, 복구 된 다음의 mRNA와 격리 했다 3'-biotinylated 2-0'-methoxy 수정 센스 RNA oligonucleotides (그림 1). 우리 따라서 전체 complementarity 여러 21-24 국세청 수정 ASOs 영역 선택 된 mRNAs에 효 모, 선 충 C. 및 인간, 디자인과 (뇌관 및 ASOs의 목록이 테이블에서에서 주어진 다 관심의 mRNA를 복구할의 적합성 테스트 1). 효율성과 개별 ASOs의 특이성 각 유기 체에서 분리 된 비 가교 된 총 RNA와 먼저 평가 했다. 이 실험에서 RNA ASOs streptavidin 활용 된 상자성 구슬에 결합 되었고 해당 유기 체에서 준비 하는 비 가교 된 총 RNA와 인 큐베이 팅. 구슬에서 캡처된 mRNAs의 출시 후 mRNA의 존재 뿐만 아니라 없는 제어 mRNAs는 반전 녹음 방송 (RT)에 의해 모니터링 대상-중 합 효소 연쇄 반응 (PCR)37. 우리는 두 개의 변수, 소금 농도 및 온도 워시 버퍼, 3 개의 다른 ASOs (그림 2A)와 함께 테스트 되었습니다 누 룩에서 PFK2 mRNA의 캡처의 효율에 중요 한 역할을 했다 것으로 나타났습니다. 복구 감소 25 m m 소금 (NaCl) 농도 낮추는 부정적인 모든 ASOs, 감지할 수 없는 수준 mRNA (PFK1)를 제어 하지만 그것은 또한 원하는 복구 감소 표적 mRNA PFK2 (입력의 10-15%). 반대로, 생리 적인 수준 (150 m m NaCl) 염 농도의 증가 PFK2 mRNAs의 복구와 아소 PFK2-2, PFK1 컨트롤의 초과 75%까지 증가 하 여 mRNA 적어도 5 (그림 2A). 추가 메모의 다른 ASOs mRNA의 중대 한 변이 대상 캡처 신진대사에서 보였다 생리 소금 농도, ASOs. 의 경험적 검증에 대 한 필요성을 강조 워시 버퍼의 온도 의존 mRNA 복구의 cep-1 C. 선 충과RPS20 mRNAs 각각 ASOs (표 1)를 사용 하 여 exemplified입니다. 우리는 최적의 세척 온도 50 ° C와 분명 관련이 없는 mRNAs와 mRNAs 대상 (그림 2B)의 효율적인 복구 낮은 배경에서 55 ° C 사이 했다 관찰 했다. 이 시점에서, 우리는 십자가-교 잡의 ASOs의 다른 mRNAs와 가능성을 강조 하고자 합니다. 예를 들어 DNM1 아소 DNM1 코딩 시퀀스 내에서 시퀀스를 완벽 하 게 보완 이지만 그것은 또한 부분적으로 ACT1 mRNA와 anneals. DNM1 ASOs 간 교 잡 (그림 2C)에 대 한 강한 성향을 보여주는 세척 온도 관계 없이 모두 mRNAs 복구. 마지막으로, 우리는 위의 설명된 테스트 사용 하 고 최적화 선택에서 각각 대상 mRNAs의 복구에 적합 했던 3 ASOs를 총 RNA S. cerevisiae, C. 선 충 및 인간의 세포 (그림 2D에서 격리 ).

적당 한 ASOs 생체 외에서 의 초기 선택 후 우리 셀 추출 물 자외선 가교 된 생물/셀 (그림 1)에서 얻은 여행을 수행. 특히, 우리는 3 개의 다른 유기 체에서 3 개의 다른 mRNAs의 복구 테스트: 효 모 S. cerevisiae, cep 1 C. 선 충, 선 충 및 기자에서에서 PFK2 mRNA mRNA (pGL3-CDKN1B-3'UTR) 3' UTR 베어링 인간 CDKN1B/p27 mRNA 순서 인간 HEK293 세포에서 과도 식 luciferase (루크) 기자에 게 융합. RNA 격리의 특이성을 제어 하려면 모니터링 하는 여러 관련 없는 mRNAs의 복구 하 고 우리는 펜 실바 니 아 셀 추출 물에 oligo(dT)25에 세포 mRNAs의 바인딩으로 경쟁의 과잉의 추가 의해 경쟁 실험 수행 는 첫 번째 단계 정화 단계 동안 구슬. 이전 비 가교 된 총 RNA 샘플 (그림 2), RT-PCR 확인 본 각 mRNAs의 농축 대상 mRNA 여행 동안, 여러 비 관련 제어 mRNAs 농축 되지 했다 반면 (그림 3A). 또한, 어느 mRNAs ASOs, 불특정 바인딩 방지 하는 적절 한 차단 절차를 나타내는 없이 구슬에 감지 했다. 이 줄에 무관/발진 ASOs 또한 사용할 수 있습니다 제어, 특정 mRNAs와 바운드 단백질의 유추 캡처 간 교 잡에 대 한 잠재적인 다음 고려 되어야 하는. 이후 최종 eluate에 단백질은 스테인드 polyacrylamide 젤 (데이터 표시 되지 않음)에 거의 구상 될 수, 이전에 알려진된 mRNA 상호 작용 단백질의 존재는 더 immunoblot 분석에 의해 평가 됩니다. S. cerevisiae, 리보솜 독립적인 방식으로12; PFK2 mRNA를 선택적으로 묶는에서 Pfk2p 포함 C. 선 충 GLD-1, 3 ' UTR cep 1 의 시퀀스는 정식 RBP mRNA 변환 규칙43; 그리고 허는 RBP mRNA 안정성 및 p27/CDKN1B mRNA44의 번역. 예상 대로,이 단백질의 모든 서쪽 오 점 분석 (그림 3B)에 의해 각각 mRNAs의 여행 있다에서 확인 되었다.

Figure 1
그림 1입니다. 여행의 도식 대표. 단백질은 RNA에 vivo에서 UV 방사선에 의해 가교 된. (밝은 녹색 상자) 첫 번째 단계에서 많은 RNA-단백질 복합물 oligo(dT)25 구슬 언바운드 단백질 제거 하려면 엄격한 세척 조건 적용 복구 됩니다. 두 번째 단계 (핑크 상자)에서 대상 mRNP는 뽑아-아웃 biotinylated 센스 RNA oligonucleotides와 streptavidin 구슬. 순화 mRNPs 다음 RT-PCR 및 immunoblot/질량 분석 (MS) RNAs 단백질 각각의 관심, mRNA와 상호 작용을 식별 하 여 분석 된다. 그림은 권한이 있는 이전 게시37 에서 수정 되었습니다. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 2
그림 2입니다. 비 가교 화 셀/유기 체를 사용 하 여 전체 RNA에서 선택 된 mRNAs의 절연 antisense RNA 캡처 프로브 수정. (A) 효 모 PFK2 mRNA ASOs와의 캡처 효율성에 소금 농도의 영향. 효 모 세포에서 총 RNA 표시 ASOs와 결합 되었고 55 ° c.에 지정 된 소금 (NaCl) 농도 포함 하는 버퍼와 세척 그린, 블루와 오렌지 라인 대표37RT-PCR 의해 결정으로 다른 ASOs PFK2 mRNA 복구: PFK2 1 , PFK2-2에는 3' UTR, CD에서 PFK2 4 anneal. PFK1 는 부정적인 mRNA를 제어. PCR 32 증폭 사이클 수행 하 고 앞에서 설명한37로 계량 했다. C. eleganscep-1 및 효 모 RPS20 아소의 (B) 일부 다른 세척 온도, 검정과 빨강 라인에 각각 표현에서 mRNAs 바인딩됩니다. C. eleganspgk-1 및 효 모 ACT1 비 대상 (제어) mRNAs는. 30과 32 PCR 주기는 각각 효 모와 선 충 C. mRNAs의 검출에 대 한 적용 했다. (C) DNM1 ACT1 mRNA와 (빨간) 시퀀스는 DNM1 mRNA로 잠재적인 간 교 잡에 아소의 교 잡의 도식 대표는 왼쪽에 표시 됩니다. 효 모 DNM1ACT1 mRNAs 구슬에서 eluted의 검출을 위한 RT-PCR 반응 (30 주기)에서 제품을 보여주는 agarose 젤 오른쪽에 표시 됩니다. 입력, 총 RNA; Sn, ASOs;를 가진 외피 후 상쾌한 E, 구슬에서 세척에서 있다 표시 온도 이전 차입 (40 ° C, 50 ° C와 60 ° C). 제어 실험 (Ctrl) 아소를 추가 하지 않고 동시에 수행 되었다. (D) Agarose 젤 (오른쪽) 효 모 S. cerevisiae, C. 선 충, 그리고 인간의 HEK293 세포 (H. sapiens)의 총 RNA에서 캡처한 mRNAs의 검출을 위한 RT-PCR 제품을 보여주는. 입력, 총 RNA; Sn, 표면에 뜨는; E, 구슬에서 있다입니다. PCR 효 모 mRNAs에 대 한 30 확대 주기, C. 선 충 mRNAs 32 사이클에 의해 수행 됐다 고 28 및 30 각각 인간의 tubulin p27 mRNAs를 주기. 그림은 권한이 있는 이전 게시37 에서 수정 되었습니다. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 3
그림 3입니다. 여행과 자외선 가교 된 셀에서 파생 된 추출 물에서 특정 mRNA 단백질 복합물의 캡처. (A) Agarose 젤 oligo(dT)와 S. cerevisiae, C. 선 충 그리고 인간 (H. sapiens) 셀 추출 물에서 나타난된 ASOs 캡처 시 RT-PCR와 (오른쪽) mRNAs의 검출에 대 한. 입력, 가교 화 셀/유기 체;에서 총 RNA Ctrl 키, 아소 없이 제어입니다. 많은, 많은 경쟁 RT-PCR은 35 증폭 사이클 설명된37에 대 한 p27, 32 주기 그리고 수행 29 tubulin위해 사이클. (B) 표시 된 항 체 (오른쪽)와 mRNA-바인딩 단백질의 Immunoblot 분석. 로드 된 분수는 다음과 같습니다: 0.1%, 2.5% 1% 효 모, 선 충 및 인간의 입력; 10%, 10%, 5% 효 모, 선 충 및 인간 oligo(dT) 차선; 그리고 모든 ASOs 차선 66%입니다. 분자 무게 (MW) kilodaltons (kDa)에 표시 됩니다. 그림 허가37와 게시입니다. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

뇌관 이름 시퀀스 대상 크기
Pfk2_Fwd GTGTTAAGGGTTCACATGTCG PFK2 S. cerevisiae 133 혈압
Pfk2_Rev CTTCCAACCAAATGGTCAGC PFK2 S. cerevisiae 133 혈압
Pfk1_Fwd GGTGATTCTCCAGGTATGAATG PFK1 S. cerevisiae 97 혈압
Pfk1_Rev CTTCGTAACCTTCGTAAACAGC PFK1 S. cerevisiae 97 혈압
Act1_Fwd GTCTGGATTGGTGGTTCTATC ACT1 S. cerevisiae 85 혈압
Act1_Rev GGACCACTTTCGTCGTATTC ACT1 S. cerevisiae 85 혈압
Dnm1_Fwd CTGTGTTCGATGCATCAGAC DNM1 S. cerevisiae 156 혈압
Dnm1_Rev CGCACTCCAATTCTTCTCTC DNM1 S. cerevisiae 156 혈압
Rps20_Fwd CGCTGAACAACACAACTTGG RPS20 S. cerevisiae 228 혈압
Rps20_Rev GGAAGCAACAACAACTTCGAC RPS20 S. cerevisiae 228 혈압
Cep1_Fwd CGATGAAGAGAAGTCGCTGT cep-1 C. 선 충 110 혈압
Cep1_Rev ATCTGGGAACTTTTGCTTCG cep-1 C. 선 충 110 혈압
Pgk1_Fwd GCGATATTTATGTCAATGATGCTTTC pgk-1 C. 선 충 74 혈압
Pgk1_Rev TGAGTGCTCGACTCCAACCA pgk-1 C. 선 충 74 혈압
Mpk1_Fwd TGCTCAGTAATCGGCCATTG mpk-1 C. 선 충 74 혈압
Mpk1_Rev TCCAACAACTGCCAAAATCAAA mpk-1 C. 선 충 74 혈압
p27_Fwd TTTAAAAATACATATCGCTGACTTCATGG p27 헤 사피엔스 212 혈압
p27_Rev CAAAGTTTATGTGCTACATAAAAGGTAAAAA p27 헤 사피엔스 212 혈압
Luc_Fwd AATGGCTCATATCGCTCCTGGAT Luciferase P. pγralis 117 혈압
Luc_Rev TGGACGATGGCCTTGATCTTGTCT Luciferase P. pγralis 117 혈압
Β-TUBULIN_Fwd CTGAACCACCTTGTCTCAGC Β-TUBULIN 헤 사피엔스 136 혈압
Β-TUBULIN_Rev AGCCAGGCATAAAGAAATGG Β-TUBULIN 헤 사피엔스 136 혈압
PFK2-1 아소 AAUAGAAAGUGUAAUAAAAGGUCAU 3' UTR PFK2 S. cerevisiae -
PFK2-2 아소 GUUUCAUGGGGUAGUACUUGU 3' UTR PFK2 S. cerevisiae -
PFK2-4 아소 CUUGAAGAGGAGCGUUCAUA ORF PFK2 S. cerevisiae -
DNM1 아소 UCGGUCAGUGGAGGUUCAGCGUUU ORF DNM1 S. cerevisiae -
RPS20 아소 GUCGGUAAUAGCCUUCUCAUUCUUG ORF RPS20 S. cerevisiae -
cep-1 아소 GUGAGAAAUGCGGUGCUUUGAAA 3' UTR cep 1 C. 선 충 -
p27 아소 UCAUACCCCGCUCCACGUCAGUU 3' UTR p27 헤 사피엔스 -

표 1입니다. Oligonucleotide 시퀀스. PCR 뇌관 및 ASOs 확대 후이 일, 뇌관 순서, 유전자 대상 및 예상된 조각 크기에 사용의 목록입니다.

Discussion

여행 특정 mRNAs에 vivo에서 생 화 확 적인 수단에 바인딩된 단백질의 분석을 허용 한다. 우리 다른 생물/세포에서 mRNA 목표와 특정 RBPs의 상호 작용을 확인 하기 위해 메서드를 사용 하는 동안 여행 또한 많은 RNAs, 세포질 긴 ncRNAs 등의 연구에 적용할 수 있습니다. 또한, MS 또는 RNA 시퀀싱 바인딩된 단백질 RNAs의 체계적인 분석은 업 스케일링 절차의 얻을 수 있습니다. 이와 관련, 우리의 예비 데이터 효 모 문화의 1 L와 인간의 HEK293 세포의 100 백만 이상 잘 표현한 mRNAs에 대 한 신뢰할 수 있는 MS 데이터를 얻기 위해 (되지 않은 결과) 충분 한 시작 물자를 제공할 수 있는 것을 나타냅니다.

254에서 UV 빛을 가진 세포의 방사선 조사를 포함 하는 설명된 여행 프로토콜 nm crosslink RNA-단백질 상호 작용. 정화 하는 동안 엄격한 세척 조건 구현 수 있습니다. 그럼에도 불구 하 고, 명시적으로 테스트, 가교는 선택 사항이 며 active RNPs 또한 생리 버퍼가 복구할 수 있습니다 주의 하 길. 그러나,이 경우 lysates의 목표가 RNA 단백질 또는 RNAs의 잠재적인 다시 배열 해야 될 고려. 반대로, 만약 UV 또는 다른 가교 절차 적용 (, 포름알데히드), RNA의 무결성 평가 되어야 한다로 RNA 저하 mRNPs의 저하 회복으로 이어질 수 있습니다. 또한, 자외선 가교 오히려 비효율적인 (~ 5%) 이며 이중 가닥 RNA와 상호 작용 하는 단백질에 대 한 심지어 덜 그렇게 있는 RBPs12의 특정 클래스의 검색에 대 한 바이어스를 소개 수 있습니다. 마지막으로, UV 방사선 또한 데이터 해석45,46에 대 한 간주 되어야 하는 단백질-단백질, 단백질-DNA crosslinks을 유도할 수 있다. 따라서, 포름알데히드, 예를 들어, 대체 가교 절차 또한 mRNAs에 더 큰 단백질 어셈블리를 캡처하는 데 특히 관심의 수 있습니다.

여행의 하나의 주요 기능은 특정 RNAs, 선택도 증가 및 감소 공동 오염 물질을 정화의 확률 아소 기반 정화 절차 2 단계입니다. 예를 들어, 하나의 관심사 biotin-바인딩 단백질의 공동 정화 이어질 수 있는 세포 추출 물에 직접 추가 하는 biotinylated ASOs 관련이 있습니다. 이 여행에서 covalently 결합 된 oligo-(dT)25 자석 구슬를 사용 하 여 많은 RNAs의 엄격한 정화 조건 RNA-단백질 위하여 캡처 할 수 있는 정화의 첫 라운드를 구현 하 여 피할입니다. 또한, 많은 RNA 선택 리보솜 RNAs tRNAs, 등 매우 풍부한 ncRNAs 제거 하 고 따라서 샘플 및 간 교 잡 및 오염에 대 한 잠재적인 출처의 복잡성을 감소 시킨다. 두 번째 단계에서 특정 mRNAs biotinylated로 복구 되 고 지역에 mRNA 표적에 anneal ASOs를 수정. 또는, 수정된 ASOs 수 또한 직접 covalently에 첨부는 아민-링커를 통해 자석 구슬 biotin 바인딩 단백질을 잡으려고 성향 감소. 그러나, 우리의 경험, streptavidin 구슬의 추가 이전 ASOs는 많은 RNA 분수의 인큐베이션 복구 mRNPs 아소 결합 구슬의 직접적인 추가 보다 더 효율적으로. 가능 하 게, 무료 oligos는 접착 고정된 oligos에 비해 구조화 된 RNA에 시퀀스에 더 나은 접근을 선호 하 고 있습니다. 따라서, ASOs의 샘플 인큐베이션 전에 구슬의 공유 결합 RNA 대상의 복구를 위해 유해할 수 하 고 경험을 테스트 될 수 있다.

아소 기반 방법으로 하나의 단점은 일부 대상 mRNAs의 비효율적인 복구입니다. 따라서이 좋습니다 anneal 여러 ASOs의 평가 대 본의 다른 지역에. 특히, 3'-UTR에서 시퀀스 anneal 2-3 ASOs 또는 관심의 mRNA의 CD 디자인을 좋습니다. 각 아소 각각 mRNA 대상의 복구에 대 한 다른 효율성을 전시 수 있습니다 하 고 경험적으로 되어야 합니다 (그림 2A, B, 데이터 표시 되지 않음)을 테스트. 끝에, 우리는 발견 ASOs 3' Utr에 어 닐 링 더 수행 CD를 단련 하는 것 들에 비해. 이것은 리보솜 CD 내에서 효율적인 하이브리드를 방해 수 있습니다 반면 리보솜, 번역의 부재로 인해 Utr에 사이트를 바인딩 증가 접근성 때문일 수 있었다. 우리 또한 경험이 풍부한 비 표적 mRNAs에서 증가 오염으로 이어질 수 및 풀 다운 효율 감소 여러 ASOs의 조합. 어떤 경우에, 선택한 oligos의 선택도 경쟁 실험에 의해 통제 될 수 있다 (., 경쟁 oligos의 추가).

더 우려 없는 RNAs와 잠재적인 간 교 잡에 관한 다른 mRNAs와 그도 부분 교 잡 관찰로 이어질 수 있습니다 그 mRNA (그림 2C)의 복구. 설계 ASOs의 적합성 평가, 따라서 좋습니다 초기 체 외에 테스트 총 RNAs 소금 농도 및 버퍼의 세척 온도 최적화를 수행. 우리의 손에서 150 m m를 포함 하는 버퍼에서 결합 하는 streptavidin 자석 구슬의 세척 55 ° C에서 NaCl 수행, 하지만 각 설계 아소에 대 한 조건의 독립 테스트 것이 좋습니다. 주목할 만한, 우리 모든 ASOs (2D 그림) 에서 체 외 실험에서 선택 했다 캡처 가교 된 셀 추출 물 (그림 3)에서 각각 mRNA 표적에 대 한 적절 한 추가에서 의 유효성 substantiating 발견 체 외 테스트. MRNA 캡처에 대 한 적합 한 ASOs, 설계 외 추가 요소 선택도에 영향을 줄 수 있습니다. 따라서, 구슬 유형 사양에 따라 BSA 및 tRNA와 포괄적인 차단 절차 구슬에 난다 바인딩을 방지할 수 있습니다. 더 단백질의 불특정 흡수를 줄이기 위해,이 좋습니다 Lo 바인딩 튜브를 사용 하 여를 샘플의 낮은 금액으로 작업 하는 경우에 특히.

일반적으로, 여행 수 ASOs와 RNAs를 잡으려고 이전 설립된 접근을 보완 하 고 있다. 예를 들어, 비 코딩 RNA Xist 의 긴 (90-메 르) biotinylated DNA oligonucleotides 전체 사본 를 포함 하는 배열을 사용 하 여 200-800 백만 자외선 가교 된 세포에서 파생 된 핵 추출 물에서 바인딩된 단백질 격리 했다 34,35. 그러나, 선택한 바둑판식 배열 접근 없는 RNAs과 간 교 잡에 대 한 중대 한 잠재력에 비추어 문제가 될 수 있다 그리고 특정 사본, 를 선택 하는 데 사용할 수 없습니다., 양자 택일로 접합 형태. 최근, 잠긴된 핵 산 (LNA) 특별히 또는 DNA 아소 mixmers covalently 세포 자유로운 추출 물;에서 생체 외에서 사본 또는 높은 표현된 리보솜 RNAs를 복구 하는 자기 수 지에 붙어 있었다 그러나, 그것은 vivo에서 형성 된 mRNA 단백질 단지36의 복구를 위해 시험 되었다. RBPs와 ncRNA post-transcriptional 유전자 제어의 증가 인식에 비추어 우리를 믿고 여행을 구성과 RNP 단지 세포내 환경 단서와 미치는 영향에 따라 세포 내에서 역학 조사 하는 유용한 방법 건강과 질병.

Disclosures

저자는 공개 없다.

Acknowledgments

우리는 박사 조나단 홀과 마우로 치머만 (ETH 취리히) PFK2cep 1 ASOs, p27/CDKN1B ASOs, 및 박사 라팔 Ciosk (프리드리히 Miescher 연구소 생물 의학 연구의 디자인에 대 한 박사 Maikel Wouters의 합성에 대 한 감사 바젤) 안티-GLD-1 항 체에 대 한. 이 작품은 생명 공학 및 생물 과학 연구 위원회 (BB/K009303/1)와 왕 사회 울프 연구 공로 수상 (WM170036) A.P.G.에 의해 지원 되었다

Materials

Name Company Catalog Number Comments
MaxQ 5000 Large Incubated and Refrigerated Orbital Shaker Thermo Fisher Scientific SHKE5000-8CE Floor shaker to grow yeast cells
BBD 6220 Thermo Fisher Scientific CO2 incubator to grow human cells
Sonicator Soniprep150 MSE MSS150.CX4.5 Sonicator/cell disruptor. Used to shear DNA in human cell lysates
Stratalinker 1800 Stratagene Stratalinker to expose cells to UV light at 254 nm
Tissue Lyser Qiagen RETSCH MM200 Device to mechanically disrupt yeast cells
Refrigerated Centrifuge Eppendorf 5810R Centrifuge to spin down cells, lysates
Shaking incubator, Thriller Peqlab Thermoshaker for 1.5 mL tubes
Glass beads 0.5mm Stratech Scientific Limited 11079105 Lysis of yeast cells
Nylon Filter, 0.41 μm Millipore NY4104700 Collection of yeast cells
Millex-HA Filter, 0.45 µm EMD Millipore SLHA02510 Filter to clear nematode lysate
Eppendorf LoBind microcentrifuge tubes Protein 1.5 mL Sigma-Aldrich 22431081 Minimise protein loss
2 mL microfuge tube Ambion AM12425 Yeast extract preparation and other applications
5 mL tube Thermo Fisher Scientific 129A Collection of HEK293 cell lysate
15 mL tube Sarstedt 62.547.254 Collection C. elegans
50 mL plastic tube Sarstedt 62.554.502 Collection yeast cells
DMEM, high glucose, pyruvate Thermo Fisher Scientific 41966 Media for culturing HEK293 cells
Penicillin-Streptomycin Sigma-Aldrich P4333 Used to supplement cell culture media to control bacterial contamination
Fetal Bovine Serum (FBS) Sigma-Aldrich F7524 Used to supplement cell culture media
Lipofectamine 2000 Thermo Fisher Scientific 11668027 Transfection reagent
RQ1 RNase-Free DNase Promega M6101 DNAse I to degrade DNA from cell lysate
RNasin Plus RNase Inhibitor Promega N2611 RNase inhibitor to avoid RNA degradation
cOmplete, Mini, EDTA-free Protease Inhibitor Cocktail Roche 11836170001 Protease inhibitor cocktail to avoid protein degradation
Dynabeads Oligo (dT)25 Thermo Fisher Scientific 61011 Magnetic beads required for the first step of mRNA-protein complex purification
Dynabeads M-280 Streptavidin Thermo Fisher Scientific 11205D Magnetic beads required for the second step of mRNA-protein complex purification
E. coli tRNA Sigma-Aldrich 10109550001 transfer RNA from E. coli used for blocking streptavidin beads and avoid unsepecific interactions
Quick Start Bradford 1x Dye Reagent BioRad 5000205 To determine protein concentration within lysates, using BSA as reference
Bovine Serum Albumin Sigma A7906-100G Used to perform the standard curve that will be used as reference for protein concentration determination
mouse anti-Act1 MP Biomedicals 869100 Antibody for detection of yeast actin in Western blot (1:2,500)
mouse anti-Act1 Sigma A1978 Antibody for detection of human actin in Western blot (1:2,000)
mouse anti-HuR Santa Cruz sc-5261 Antibody for detection of HuR in Western blot (1:500)
mouse anti–CYC-1 Invitrogen 456100 Antibody for detection of Cyc-1 in Western blot (1:1,000)
peroxidase anti-peroxidase soluble complex Sigma P1291 Detection of Pfk2:TAP in Western blot (1:5,000)
HRP-conjugated sheep anti-mouse IgG Amersham NXA931 HRP-coupled secondary antibody

DOWNLOAD MATERIALS LIST

References

  1. Mitchell, S. F., Parker, R. Principles and properties of eukaryotic mRNPs. Molecular Cell. 54, (4), 547-558 (2014).
  2. Iadevaia, V., Gerber, A. P. Combinatorial Control of mRNA Fates by RNA-Binding Proteins and Non-Coding RNAs. Biomolecules. 5, (4), 2207-2222 (2015).
  3. McHugh, C. A., Russell, P., Guttman, M. Methods for comprehensive experimental identification of RNA-protein interactions. Genome Biology. 15, (1), 203 (2014).
  4. Matia-González, A. M., Gerber, A. P. Ch. 14. Fungal RNA Biology. Sesma, A., von der Haar, T. Springer. 347-370 (2014).
  5. Tsvetanova, N. G., Klass, D. M., Salzman, J., Brown, P. O. Proteome-wide search reveals unexpected RNA-binding proteins in Saccharomyces cerevisiae. PLoS One. 5, (9), (2010).
  6. Castello, A., et al. Insights into RNA biology from an atlas of mammalian mRNA-binding proteins. Cell. 149, (6), 1393-1406 (2012).
  7. Baltz, A. G., et al. The mRNA-bound proteome and its global occupancy profile on protein-coding transcripts. Molecular Cell. 46, (5), 674-690 (2012).
  8. Castello, A., et al. System-wide identification of RNA-binding proteins by interactome capture. Nature Protocols. 8, (3), 491-500 (2013).
  9. Liao, Y., et al. The Cardiomyocyte RNA-Binding Proteome: Links to Intermediary Metabolism and Heart Disease. Cell Reports. 16, (5), 1456-1469 (2016).
  10. Liepelt, A., et al. Identification of RNA-binding Proteins in Macrophages by Interactome Capture. Molecular Cell Proteomics. 15, (8), 2699-2714 (2016).
  11. Conrad, T., et al. Serial interactome capture of the human cell nucleus. Nature Communications. 7, 11212 (2016).
  12. Matia-Gonzalez, A. M., Laing, E. E., Gerber, A. P. Conserved mRNA-binding proteomes in eukaryotic organisms. Nature Structural and Molecular Biology. 22, (12), 1027-1033 (2015).
  13. Mitchell, S. F., Jain, S., She, M., Parker, R. Global analysis of yeast mRNPs. Nature Structural and Molecular Biology. 20, (1), 127-133 (2013).
  14. Beckmann, B. M., et al. The RNA-binding proteomes from yeast to man harbour conserved enigmRBPs. Nature Communications. 6, 10127 (2015).
  15. Wessels, H. H., et al. The mRNA-bound proteome of the early fly embryo. Genome Research. 26, (7), 1000-1009 (2016).
  16. Sysoev, V. O., et al. Global changes of the RNA-bound proteome during the maternal-to-zygotic transition in Drosophila. Nature Communications. 7, 12128 (2016).
  17. Despic, V., et al. Dynamic RNA-protein interactions underlie the zebrafish maternal-to-zygotic transition. Genome Research. 27, (7), 1184-1194 (2017).
  18. Zhang, Z., et al. UV crosslinked mRNA-binding proteins captured from leaf mesophyll protoplasts. Plant Methods. 12, 42 (2016).
  19. Reichel, M., et al. In Planta Determination of the mRNA-Binding Proteome of Arabidopsis Etiolated Seedlings. Plant Cell. 28, (10), 2435-2452 (2016).
  20. Koster, T., Marondedze, C., Meyer, K., Staiger, D. RNA-Binding Proteins Revisited - The Emerging Arabidopsis mRNA Interactome. Trends Plant Sciences. 22, (6), 512-526 (2017).
  21. Hamasaki, K., Killian, J., Cho, J., Rando, R. R. Minimal RNA constructs that specifically bind aminoglycoside antibiotics with high affinities. Biochemistry. 37, (2), 656-663 (1998).
  22. Bachler, M., Schroeder, R., von Ahsen, U. StreptoTag: a novel method for the isolation of RNA-binding proteins. RNA. 5, (11), 1509-1516 (1999).
  23. Vazquez-Pianzola, P., Urlaub, H., Rivera-Pomar, R. Proteomic analysis of reaper 5' untranslated region-interacting factors isolated by tobramycin affinity-selection reveals a role for La antigen in reaper mRNA translation. Proteomics. 5, (6), 1645-1655 (2005).
  24. Hartmuth, K., Vornlocher, H. P., Luhrmann, R. Tobramycin affinity tag purification of spliceosomes. Methods Molecular Biology. 257, 47-64 (2004).
  25. Beach, D. L., Keene, J. D. Ribotrap : targeted purification of RNA-specific RNPs from cell lysates through immunoaffinity precipitation to identify regulatory proteins and RNAs. Methods Molecular Biology. 419, 69-91 (2008).
  26. Slobodin, B., Gerst, J. E. A novel mRNA affinity purification technique for the identification of interacting proteins and transcripts in ribonucleoprotein complexes. RNA. 16, (11), 2277-2290 (2010).
  27. Slobodin, B., Gerst, J. E. RaPID: an aptamer-based mRNA affinity purification technique for the identification of RNA and protein factors present in ribonucleoprotein complexes. Methods Molecular Biology. 714, 387-406 (2011).
  28. Yoon, J. H., Gorospe, M. Identification of mRNA-Interacting Factors by MS2-TRAP (MS2-Tagged RNA Affinity Purification). Methods Molecular Biology. 1421, 15-22 (2016).
  29. Leppek, K., Stoecklin, G. An optimized streptavidin-binding RNA aptamer for purification of ribonucleoprotein complexes identifies novel ARE-binding proteins. Nucleic Acids Research. 42, (2), 13 (2014).
  30. Blencowe, B. J., Sproat, B. S., Ryder, U., Barabino, S., Lamond, A. I. Antisense probing of the human U4/U6 snRNP with biotinylated 2'-OMe RNA oligonucleotides. Cell. 59, (3), 531-539 (1989).
  31. Lingner, J., Cech, T. R. Purification of telomerase from Euplotes aediculatus: requirement of a primer 3' overhang. Proceedings of the National Academy of Sciences U S A. 93, (20), 10712-10717 (1996).
  32. Upadhyay, A., Dixit, U., Manvar, D., Chaturvedi, N., Pandey, V. N. Affinity capture and identification of host cell factors associated with hepatitis C virus (+) strand subgenomic RNA. Molecular Cell Proteomics. 12, (6), 1539-1552 (2013).
  33. Imig, J., et al. miR-CLIP capture of a miRNA targetome uncovers a lincRNA H19-miR-106a interaction. Nature Chemical Biology. 11, (2), 107-114 (2015).
  34. Chu, C., et al. Systematic discovery of Xist RNA binding proteins. Cell. 161, (2), 404-416 (2015).
  35. McHugh, C. A., et al. The Xist lncRNA interacts directly with SHARP to silence transcription through HDAC3. Nature. 521, (7551), 232-236 (2015).
  36. Rogell, B., et al. Specific RNP capture with antisense LNA/DNA mixmers. RNA. 23, (8), 1290-1302 (2017).
  37. Matia-Gonzalez, A. M., Iadevaia, V., Gerber, A. P. A versatile tandem RNA isolation procedure to capture in vivo formed mRNA-protein complexes. Methods. 93-100 (2017).
  38. Gruber, A. R., Lorenz, R., Bernhart, S. H., Neubock, R., Hofacker, I. L. The Vienna RNA websuite. Nucleic Acids Research. 36, (Web Server issue), Available from: http://rna.tbi.univie.ac.at/cgi-bin/RNAWebSuite/RNAfold.cgi W70-W74 (2008).
  39. Kalendar, R., Khassenov, B., Ramankulov, Y., Samuilova, O., Ivanov, K. I. FastPCR: An in silico tool for fast primer and probe design and advanced sequence analysis. Genomics. 109, (3-4), Available from: http://primerdigital.com/tools/PrimerAnalyser.html 312-319 (2017).
  40. Altschul, S. F., Gish, W., Miller, W., Myers, E. W., Lipman, D. J. Basic local alignment search tool. Journal of Molecular Biology. 215, (3), 403-410 (1990).
  41. Stiernagle, T. Maintenance of C. elegans. WormBook. 1-11 (2006).
  42. Kedde, M., et al. A Pumilio-induced RNA structure switch in p27-3' UTR controls miR-221 and miR-222 accessibility. Nature Cell Biology. 12, (10), 1014-1020 (2010).
  43. Schumacher, B., et al. Translational repression of C. elegans p53 by GLD-1 regulates DNA damage-induced apoptosis. Cell. 120, (3), 357-368 (2005).
  44. Ziegeler, G., et al. Embryonic lethal abnormal vision-like HuR-dependent mRNA stability regulates post-transcriptional expression of cyclin-dependent kinase inhibitor p27Kip1. Journal of Biological Chemistry. 285, (20), 15408-15419 (2010).
  45. Itri, F., et al. Femtosecond UV-laser pulses to unveil protein-protein interactions in living cells. Cellular and Molecular Life Sciences. 73, (3), 637-648 (2016).
  46. Zhang, L., Zhang, K., Prandl, R., Schoffl, F. Detecting DNA-binding of proteins in vivo by UV-crosslinking and immunoprecipitation. Biochemical and Biophysical Research Communications. 322, (3), 705-711 (2004).
진 핵 세포 mRNA 단백질 복합물을 복구 하는 Oligonucleotide 기반 협동 RNA 격리 절차
Play Video
PDF DOI

Cite this Article

Iadevaia, V., Matia-González, A. M., Gerber, A. P. An Oligonucleotide-based Tandem RNA Isolation Procedure to Recover Eukaryotic mRNA-Protein Complexes. J. Vis. Exp. (138), e58223, doi:10.3791/58223 (2018).More

Iadevaia, V., Matia-González, A. M., Gerber, A. P. An Oligonucleotide-based Tandem RNA Isolation Procedure to Recover Eukaryotic mRNA-Protein Complexes. J. Vis. Exp. (138), e58223, doi:10.3791/58223 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter