Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biochemistry

Un procedimiento de aislamiento de RNA tándem basada en oligonucleótidos recuperar complejos eucariotas ARNm-proteína

doi: 10.3791/58223 Published: August 18, 2018
* These authors contributed equally

Summary

Se describe un procedimiento de aislamiento de RNA tándem (viaje) para la recuperación de complejos proteicos de ARNm endógeno formado. Específicamente, complejos RNA-proteína son reticulado en vivo, cofia RNAs son aislados de los extractos con los granos oligo(dT) y particular mRNAs son capturados con oligonucleótidos antisentido de RNA modificados. Proteínas a mRNAs son detectadas por el análisis de immunoblot.

Abstract

Proteínas de unión a RNA (restrictivas) juegan papeles claves en el control postranscripcional de la expresión génica. Por lo tanto, caracterización bioquímica de los complejos de mRNA en proteínas es esencial para entender Reglamento mRNA inferida por interacción de proteínas o ARN no codificante. Adjunto, describimos un procedimiento de aislamiento del RNA tándem (viaje) que permite la purificación de complejos de proteína ARNm endógeno formado de extractos celulares. El protocolo de dos pasos consiste en el aislamiento de cofia mRNAs con granos oligo(dT) antisentido y posterior captura de un mRNA de interés con biotinilado 3' 2'-O-metilados RNA oligonucleótidos antisentido, que luego pueden ser aislado con Abalorios de estreptavidina. VIAJE se utilizó para recuperarse en vivo complejos de mRNA-ribonucleoproteína (mRNP) reticulado de levaduras, nematodos y las células humanas para su posterior análisis de ARN y proteína. Así, el viaje es un enfoque versátil que puede adaptarse a todo tipo de cofia RNAs a través de los organismos para estudiar la dinámica entrega de mRNPs impuesta por señales intracelulares o ambientales.

Introduction

Regulación génica post-transcripcional es conducido a través de las interacciones entre proteínas RNA-que atan (restrictivas), no-codificación RNAs (ncRNAs) y mRNAs, que dirigen el proceso, localización, traducción y decaimiento de cada transcripción dentro de las células1 , 2. la identificación de las prácticas comerciales restrictivas y ncRNA interactuando con particular mRNAs, estableciendo lo que se conoce como complejos/partículas de ribonucleoproteína (RNPs), por lo tanto es clave para entender el destino de mRNAs y gene expresión. Enfoques complementarios se realizan para la caracterización bioquímica de RNP complejos3,4: mientras que el enfoque "centrado en la proteína" se basa en la purificación de prácticas comerciales restrictivas específicas, el enfoque "Centrado en el RNA" implica la aislamiento de subpoblaciones o RNAs individuales y posterior análisis de interacción de proteínas o ARN. Recientemente, un enfoque centrado en el RNA para la identificación del repertorio de las prácticas comerciales restrictivas interactuando con cofia (poly(A)) RNAs5 se ha vuelto cada vez más popular mediante la incorporación de un paso de reticulación luz (UV) ULTRAVIOLETA para estabilizar proteína-RNA previo de las interacciones el aislamiento de los mRNAs, que amplió considerablemente el catálogo de prácticas comerciales restrictivas en las células humanas6,7,8,9,10,11, Elegans de Caenorhabditis 12, saccharomyces cerevisiae12,13,14y otros organismos15,16,17,18, 19,20. Sin embargo, el mapeo de proteínas y/o ncRNAs montado en transcripciones particular es todavía un gran desafío. Con este fin, actualmente se utilizan dos enfoques principales: por un lado, RNA aptámeros etiquetas están fusionados al RNA de interés para permitir la purificación de la afinidad. Así, los aptámeros de RNA se unen con alta afinidad a antibióticos aminoglucósidos como la tobramicina y la estreptomicina21,22,23,24, o a proteínas, como la proteína de la capa de los del R17/MS2 bacteriófago o bacteriana estreptavidina S125,26,27,28,29. Aunque este enfoque fue demostrado para ser relativamente robusto y versátil, requiere clonación al diseño del ARN bajo investigación y así no se puede utilizar para capturar mRNAs natural. Por otro lado, oligonucleótidos antisentido (ASOs) fueron utilizados al principio para la recuperación y caracterización de altamente expresada nativo RNPs30,31 y RNAs virales32. Más recientemente, ASOs se aplicaron para capturar tiempo no codificación RNAs33,34,35 y en vitro formado mRNPs36. Un factor limitante importante con los enfoques centrados en el RNA es el número de copias del ARN de interés, haciendo más problemática la recuperación de los mRNAs expresado bajo. Esta limitación puede ser superada por la ampliación de la reacción; sin embargo, esto puede potencialmente conducir a incrementar el fondo.

Adjunto, describimos nuestro recientemente desarrollado basado en ASO tándem procedimiento de aislamiento de RNA (viaje) para aislar complejos de ARNm-proteína nativa con alta selectividad37 (figura 1). El protocolo consiste en dos pasos secuenciales de purificación basada en ASO, es decir, el aislamiento de los mRNAs de poly(A) con oligo(dT) disponible en el mercado junto a granos seguidos por la captura de los mRNAs específicos utilizando específicamente diseñado biotinilado corto 2'-metoxi ASOs de ARN. Este procedimiento de dos pasos ayuda a eliminar proteínas contaminantes y agrega posibilidades de ajuste y optimización. En este caso, viaje fue aplicado en las mRNAs de levaduras, nematodos, y las células humanas para confirmar en vivo forman complejos de mRNA en proteínas.

Protocol

1. diseño de oligonucleótidos antisentido (ASOs)

  1. Analizar la estructura secundaria del mRNA o un fragmento utilizando sus herramientas en línea disponibles38. Por lo tanto, introduzca la secuencia de nucleótidos (nt) en el cuadro vacío. En el cuadro de opciones básicas, seleccione el mínimo de energía libre (MFE) y función de partición y evitar pares de bases aisladas. En el cuadro de opciones de salida, seleccione trama de la estructura secundaria de ARN interactivo y por último, haga clic en el botón continuar . Un nueva ventana pop-up que muestra la estructura secundaria del ARNm de interés.
  2. Seleccione al menos tres diferentes 21-24 nts largas secuencias en el ARNm de interés, preferentemente en regiones que carecen de estructuras secundarias detectables (por ej., en los bucles no estructurados) y en 3' no traducidas regiones (UTR).
    Nota: Se ha observado que ASOs a secuencias en las regiones 3' no traducidas (UTR) de recocido realizaron mejor. Una posibilidad es que los ribosomas a la secuencia de codificación (CDS) de vez en cuando pueden obstruir el recocido de ASOs. Recocido a 5' UTRs de ASOs no fueron probados.
    1. Seleccione las regiones con una proporción de guanidina/citosina cerca del 50% y carecer de tándem de nucleótidos se repite para evitar la potencial formación de horquillas para el pelo o uno mismo-recocido.
  3. Manual diseño 2'-metoxi modificado oligonucleótidos de RNA con una molécula de biotina en los 3', totalmente complementarios a las regiones seleccionadas (paso 1.2) dentro de la deseada blanco mRNA.
    Nota: modificaciones de la 2'-metoxi procesar el RNA resistente a RNasas celular y aumenta el duplex temperatura, que permite el lavado riguroso de fusión. La molécula de biotina es necesaria para la captura de ASOs con estreptavidina.
    1. Ajustar la temperatura de fusión de los híbridos de ARN ~ 60-65 ° C y asegúrese de que tiene una complejidad de la secuencia lingüística alta (> 60%) según lo determinado con adecuadas herramientas en línea39.
    2. Utilice la herramienta básica de búsqueda de alineamiento Local40 para buscar potenciales ASO Cruz-hibridación con otros mRNAs en el transcriptoma. Seleccione Ráfaga de nucleótido, insertar las secuencias en la caja vacía y el organismo de interés. Mantener los parámetros restantes como defecto y haga clic en BLAST.
      Nota: Alineación continua incluso parcial de 8-10 nts puede conducir a Cruz-hibridación y la recuperación de este ARNm.

2. cultura, radiación ultravioleta y la célula la célula Lysis

Nota: En el siguiente, el procedimiento se describe para florecimiento levadura S. cerevisiae, nematodos C. elegansy células de riñón embrionario humano (HEK293). Sin embargo, puede ser adaptado a otros organismos, aunque no fue expresamente probado todavía.

  1. S. cerevisiae
    1. Crecer las células de levadura (e.g., cepa BY4743 derivados; MATa/α his3Δ1/his3Δ1 leu2Δ0/leu2Δ0 LYS2/lys2Δ0 met15Δ0/MET15 ura3Δ0/ura3Δ0 PFK2:TAP / PFK2) en 500 mL de medio YPD (Extracto de levadura 1%, 2% peptona, 2% D-glucosa) a 30 ° C con agitación constante a 220 rpm.
    2. Recoger las células en fase logarítmica media (densidad óptica a 600 nm (OD)600 ~ 0.6) por filtración mediante filtros de nylon de 0,45 μm o por centrifugación a 3.000 x g durante 2 min a temperatura ambiente (RT). Deseche el flujo a través o el sobrenadante, respectivamente.
    3. Lavar las células 3 veces con 25 mL de salino fosfato tamponado (PBS) utilizando el filtro de nylon de 0.45 μm o recoger por centrifugación a 3.000 x g durante 2 min a temperatura ambiente y descarte el sobrenadante. Recoger las células lo más rápidamente posible el estrés impuesto podría tener un impacto en las interacciones RNA-proteína.
    4. Resuspender las células en 25 mL de PBS y luego Vierta la suspensión en una placa de Petri de 15 cm. Coloque el plato en hielo, retire la tapa y exponer las células tres veces con 400 mJ cm-2 de la luz UV de 254 nm en un crosslinker UV con pausas de 2 min en hielo entre cada ciclo de exposición con mezcla apacible.
    5. Transferir las células a un tubo de 50 mL y recoger las células por centrifugación a 3.000 x g durante 3 min a 4 ° C. Deseche el sobrenadante y mantener el pellet.
      Nota: Las células pueden ser complemento congelado en nitrógeno líquido y se almacenaron a-80 ° C.
    6. Resuspender las células en 4 mL de tampón de lisis frío A (LB-A; 100 mM Tris-HCl, pH 7,5, 500 mM LiCl, 10 mM EDTA, 1% Tritón X-100, 5 mM DTT, 20 U ml-1 DNasa, 100 U ml-1 RNasin, completo Cóctel de inhibidor de la proteasa sin EDTA).
    7. Transferencia de las células en dos tubos de 2 mL. Añadir max. ⅔ volúmenes de enfriado de los granos de cristal y romper las células en un lyser tejido a 30 Hz durante 10 min a 4 ° C.
    8. Hacer un agujero en la parte inferior del tubo con una aguja caliente y transferir el lisado a un nuevo tubo 1,5 mL por centrifugación a 600 × g durante 30 s.
    9. Claro el lisado por tres centrifugados secuenciales a 4 ° C a 3.000 x g durante 3 min, luego g × 5.000 y 10.000 × g por 5 min.
      Nota: Extractos pueden ser complemento congelado en nitrógeno líquido y almacenados a-80 ° C.
  2. C. elegans
    1. Gusanos de Bristol N2 cultura a 20 ° C en placas de medio de crecimiento de nematodos (NGM) (0,3% NaCl, 1.7% de agar, peptona al 0.25%, 1 mM CaCl2, colesterol de 5 μg/mL, 1 mM de MgSO4, 25 mM KPO4 de tampón, pH 6.0) con la cepa OP50 Escherichia coli 41 .
    2. Añadir 5 mL de buffer M941 (0.3% KH2PO4, 0.6% Na2HPO4, 0,5% de NaCl, 1 mM de MgSO4) para cada placa, agitar la placa para resuspender los gusanos y los gusanos se transfieren a un tubo de 15 mL. Colocar 2 μl de la suspensión en un portaobjetos y cuenta los gusanos en la suspensión con un microscopio. Luego aplicar el factor para calcular el número de gusanos por placa.
    3. Recoger ~ 120.000 lombrices por centrifugación a temperatura ambiente (400 × g, 2 min, RT) y descarte el sobrenadante.
    4. Lavar los gusanos tres veces. Por lo tanto, añadir 10 mL de buffer M9, mezclar por inversión y recoger los gusanos por centrifugación a 400 x g durante 2 min a TA.
    5. Añadir 15 mL de buffer M9 para los gusanos y coloque en una rueda rotativa durante 15 min a TA.
    6. Transferencia de los gusanos a las placas de la NGM (~ 4.000 gusanos por placa) y exponer a la luz UV (254 nm) en 300 mJ cm-2 en un crosslinker UV.
    7. Añadir 5 mL de buffer M9 directamente a la placa y agitar la placa para resuspender los gusanos en el búfer. Transferir la suspensión con una pipeta en un tubo de 15 mL y recoger los gusanos por centrifugación a 400 x g durante 2 min a TA.
    8. Resuspender los gusanos en 2 mL de tampón de lisis B (LB-B; 100 mM Tris-HCl, pH 8,0, 150 mM NaCl, 1 mM EDTA, 0,75% IGEPAL, 1 mM TDT, 20 U mL-1 DNasa, 100 U mL-1 RNasin, completo Cóctel de inhibidor de la proteasa sin EDTA).
    9. Moler los gusanos en un mortero con nitrógeno líquido. Recoger el polvo en un tubo de 50 mL y deshielo a TA.
      Nota: Nitrógeno líquido debe manejarse según los procedimientos de seguridad (por ejemplo, humos campana y seguridad guantes)
    10. Claro el lisado, incluyendo la capa de grasa por centrifugación a 14.000 × g por 10 min y posteriormente pasar el clarificado lisado a través de un filtro de 0.45 μm con una jeringa.
  3. Células humanas cultivadas
    Nota: La siguiente descripción se basa en transitorios de la transfección de células HEK293 pGL3-CDKN1B-3 ' plásmido reportero UTR que expresa el 3′UTR de CDKN1B/27 aguas abajo de la firefly luciferase gen42.
    1. Células HEK293 en cultivo en medio modificado Eagle de Dulbecco (DMEM) conteniendo 25 mM de glucosa y piruvato de sodio 1 mM, complementados con 100 U mL-1 de penicilina estreptomicina de 100 μg mL-1 y 10% suero bovino fetal (FBS) e incube a 37 ° C en un cámara humidificado (incubadora) que contiene 5% CO2.
    2. Semillas ~ 3 × 106 HEK293 células en un cultivo de tejidos estándar 10 cm plato el día antes de la transfección. Contar las células con un hemocitómetro.
    3. Mezcle 2 μg del gen reportero (e.g., pGL3-p27-3'UTR) con 20 μl de reactivo de transfección y transfectar las células en la confluencia de 70% (~ 7 × 106 células).
    4. Colocar las células en una incubadora a 37 ° C durante más de 48 h antes de la cosecha.
    5. Retire el medio con una pipeta serológica y rápidamente lavan las células dos veces con 10 mL de PBS previamente calentado a 37 ° C. Quitar PBS con una pipeta serológica.
    6. Añadir 6 mL de PBS en el plato, coloque en hielo y luego exponer las células a la luz UV (254 nm) a 100 mJ cm-2 en un crosslinker UV.
      Nota: La placa debe ser mantenida en hielo durante la exposición de luz UV.
    7. Raspar las células (en total ~ 107 células) en PBS y transfiéralo a un tubo de 15 mL.
    8. Desactivación de las celdas de 250 × g por 10 min a 4 ° C y luego retirar el sobrenadante con una pipeta.
      Nota: El precipitado de células puede ser complemento congelado en nitrógeno líquido y almacenado a-80 ° C hasta su uso.
    9. Resuspender las células en 2 mL de tampón de lisis previamente enfriada (LB-A) transfiriendo hacia arriba y hacia abajo para 5 - 6 veces, manteniendo el tubo en hielo.
    10. Transferir el lisado con una pipeta a un tubo de 5 mL colocado en hielo.
    11. Tema el lisado a tres rondas de sonicación, que consiste en ráfagas de s 20 en 10 μm amplitud con 30 s de enfriamiento períodos en el hielo.
      Nota: Se recomienda sonicación como completa lisis de células y fragmentos de la DNA.
    12. Transferir el lisado a tubos de 2 mL y centrifugar a 15.000 × g por 10 min a 4 ° C. Recoger el sobrenadante (extracto =) y transfiéralo a un tubo nuevo. Retire una muestra analítica (5-10%) más proteína y análisis de ARN.
      Nota: Este paso es fundamental para eliminar cualquier residuo de células restantes y se puede repetir.

3. primer paso: Poly(A) RNA aislamiento

  1. Alcancen 1 mg de oligo(dT)25-juntado granos magnéticos en 500 μl del buffer de lisis respectivo.
  2. Combinar 5 mg, 10 mg o 4 mg (proteína) de S. cerevisiae, C. elegans o extractos HEK293, respectivamente, con 1 mg de oligo(dT)25 -juntado granos magnéticos. Mezclar las muestras vigorosamente durante 10 min a 25 ° C en un mezclador.
    Nota: Las concentraciones de proteínas de extractos se pueden determinar con análisis de Bradford con albúmina de suero bovino (BSA) como estándar de referencia. Vigoroso de muestras evita la sedimentación de los granos. Para evaluar la especificidad del aislamiento del mRNA, un experimento de control se puede realizar en paralelo mediante la adición de un exceso (20 μg) de ácidos poliadenílico (pA).
  3. Colocar los tubos en un soporte magnético para 10 s y eliminar el sobrenadante. Guarde el sobrenadante en el hielo para rondas posteriores de recuperación (paso 3.7).
  4. Añadir 500 μl de lavado Tampón A (10 mM Tris-HCl, pH 7,5, 600 mM LiCl, 1 mM EDTA, 0,1% Tritón X-100) a los granos y vortex durante 5 s.
    Nota: Puede variar la concentración de LiCl en la tampones de lavado. 600 mM LiCl se recomienda pero concentraciones más bajas también fueron probadas (500 mM para C. elegans, de 300 mM para HEK293).
  5. Recolectar los granos con un imán y lavar los granos dos veces con 500 μl de tampón de lavado B (WB; 10 mM Tris-HCl, pH 7,5, 600 mM LiCl, 1 mM EDTA).
  6. Eluir el RNA en 30 μl de 10 mM Tris-HCl, pH 7,5 a 80 ° C por 2 min con agitación continua (1.000 rpm) en un mezclador. Inmediatamente Coloque el tubo en el soporte magnético y recoger el eluido después de 10 s. guardar los granos para rondas adicionales de purificación.
    Nota: Recolectar el efluente lo antes posible para evitar que potenciales reconsolidación de los mRNAs de los granos a temperaturas más bajas.
  7. Añadir los granos en el paso anterior para el sobrenadante recogido en el paso 3.3 y repetir la captura, lavado y elución de mRNAs dos veces (pasos 3.3-3.6). Los eluatos de reiteradas rondas se combinan y pueden ser almacenados a-80 ° C.

4. segundo paso: captura de específico mRNAs con oligonucleótidos de ARN antisentido modificado biotinilado 3' 2'-metoxi

Nota: Para probar la idoneidad de ASOs, puede realizarse el siguiente procedimiento con ARN total aislado de las células.

  1. Alcancen 30 μl de estreptavidina acoplado granos magnéticos en 1 mL de atascamiento y lavado buffer (tampón B & W, 10 mM Tris-HCl, pH 7,5, 150 mM NaCl, 0.5 mM EDTA, pH 8,0) conteniendo 0,1 mg mL-1Escherichia coli ARN de transferencia (tRNA) en un agitador durante 1 h a RT.
    1. Lavar los granos tres veces con 750 μl de tampón de B & W.
    2. Suspender las cuentas en 30 μl de tampón B & W y no en hielo hasta su uso.
  2. Diluir ~ 35 μg de la proteína total del aislamiento de poly(A) anterior (ver 3) en 100 μl de buffer B & W en un tubo de 1,5 mL.
    Nota: Para probar la especificidad de ASOs con ARN total, añadir 600 ng de RNA total purificado a 100 μl de buffer de B & W.
  3. Añadir 200 pmol de la respectiva ASO e incubar a 70 ° C durante 5 minutos.
    Nota: La temperatura elevada resuelve estructuras secundarias en el ARN facilitando el recocido de la ASO.
  4. Retire todo el bloque de calor del dispositivo y coloque a temperatura ambiente durante 10 minutos que se enfríe lentamente.
  5. Añadir 30 μl de granos magnéticos estreptavidina acoplado equilibrados del paso 4.1 a la muestra.
  6. Incubar la mezcla durante 30 min a 25 ° C con agitación constante a 950 rpm en un mezclador.
    Nota: Se recomienda para quitar los tubos cada 10 minutos para evitar la sedimentación de los granos.
  7. Colocar los tubos en el soporte magnético, quite el sobrenadante y lavar los granos tres veces con 750 μl de tampón B & W precalentado a 55 ° C.
    Nota: La temperatura óptima ligeramente diferir/varían entre diferentes ASOs. Se recomienda ajustar esta condición con total previo RNA no reticulado, realizar el experimento con extractos celulares.
  8. Eluir el RNA en 20 μl de 10 mM Tris-HCl, pH 7,5 a 90 ° C por 10 min con agitación constante a 950 rpm en un mezclador. Coloque los tubos en el soporte magnético y recoja inmediatamente el efluente.
    Nota: Para el análisis de proteínas, añadir 20 μl de tampón de Laemmli × 1 a las cuentas e incubar a 95 ° C por 5 min proteínas son monitoreadas por el análisis de immunoblot siguiendo protocolos estándar de laboratorio.

Representative Results

Hemos desarrollado una estrategia de aislamiento de RNA base de ASO, denominada viaje para capturar mRNAs particular con sus proteínas dependientes de tres organismos diferentes37. En esencia, complejos RNA-proteína fueron reticulado en vivo por la irradiación UV de células a 254 nm y poly(A) RNAs fueron recuperados con los granos magnéticos acoplados disponibles comercialmente oligo (dT), a continuación, el ARNm de interés fue aislado con biotinilado 3' 2-0'-metoxi había modificado oligonucleótidos de RNA antisentido (figura 1). Por lo tanto diseñamos varios ASOs de nts modificado 21-24 con plena complementariedad a las regiones en los mRNAs seleccionados de levadura, C. elegans y humanos y probada su idoneidad para recuperar el ARNm de interés (lista de iniciadores y ASOs se da en tabla 1). la eficiencia y especificidad de los ASOs primero fueron evaluadas con no-reticulado ARN total aislado del organismo respectivo. En estos experimentos, ASOs de ARN se junto a bolas paramagnéticas conjugado estreptavidina y se incubaron con ARN total no reticulado, preparado por el organismo correspondiente. Después de la liberación de capturados mRNAs de los granos, la presencia de mRNA objetivos de control, así como sin relación mRNAs fue supervisado por transcripción inversa (RT)-polimerasa de reacción en cadena (PCR)37. Nos dimos cuenta de dos variables, la concentración de sal y temperatura del lavado buffers, desempeñado un papel crítico en la eficiencia de la captura de PFK2 mRNA de la levadura que fue probada con tres diferentes ASOs (figura 2A). Bajar la concentración de sal (NaCl) a 25 mM reduce la recuperación de la negativa de control mRNA (PFK1) a niveles no detectables con los ASOs, pero también redujo la recuperación de la blanco mRNA PFK2 (10-15% de la entrada). Por el contrario, un aumento de las concentraciones de sal a niveles fisiológicos (150 mM NaCl) aumentó la recuperación de los mRNAs de la PFK2 hasta un 75% con la PFK2 ASO-2, superior a la del control PFK1 mRNA por al menos 5-fold (figura 2A). De más nota, ASOs diferentes mostraron gran variación de mRNA eficacias de captura del objetivo en concentraciones fisiológicas de sal, haciendo hincapié en la necesidad de validación empírica de ASOs. La dependencia de la recuperación del mRNA de la temperatura de la solución de lavado se ejemplifica para C. elegans cep-1 y levadura RPS20 mRNAs, utilizando ASOs respectivos (tabla 1). Observamos que la temperatura óptima es de 50 ° C a 55 ° C, como evidente de lo bajo fondo con mRNAs sin relación y la recuperación eficiente de mRNAs blanco (figura 2B). En este punto, queremos subrayar la posibilidad de la Cruz-hibridación de ASOs con otros mRNAs. Por ejemplo, la ASO DNM1 es totalmente complementario a una secuencia dentro de la DNM1 secuencia de codificación, pero también parcialmente recuece con ACT1 mRNA. ASOs DNM1 había recuperado ambos mRNAs independientemente de la temperatura de lavado, con fuerte propensión a la Cruz-hibridación (figura 2). Por último, hemos utilizado las pruebas descritas arriba y optimizaciones para seleccionar tres ASOs que eran convenientes para la recuperación del destino respectivos mRNAs de un total de RNA aislado de S. cerevisiae, C. elegans y células humanas (Figura 2D ).

Después de selección inicial de conveniente ASOs in vitro, se realizó el viaje con extractos de células obtenidos de organismos reticulado UV/las células (figura 1). Concretamente, hemos probado la recuperación de tres mRNAs diferentes de tres organismos diferentes: PFK2 mRNA de la levadura S. cerevisiae, cep-1 desde el nematodo C. elegans y reportero del mRNA (pGL3-CDKN1B-3'UTR) teniendo los 3' UTR secuencia de mRNA CDKN1B/p27 humana fusionada a un reportero de luciferasa (luc) para la expresión transitoria en células HEK293 humanas. Para controlar la especificidad del aislamiento de RNA, supervisamos la recuperación de varios mRNAs no relacionados, y se realizaron experimentos de competición por la adición de un exceso de pA a los extractos de la célula, que compite con el enlace de los mRNAs celulares a oligo(dT)25 granos durante el primer paso de purificación. Según lo anteriormente visto con muestras de RNA total no reticulado (figura 2), RT-PCR confirmó el enriquecimiento de los mRNAs respectivos blanco mRNA durante el viaje, considerando que no se enriquecieron varios mRNAs no relacionadas con el control (Figura 3A). Por otra parte, ninguno de los dos mRNAs fueron detectados en cuentas sin ASOs, indicando procedimientos apropiados de bloqueo que evita el atascamiento no específico. En esta línea, ASOs sin relación/revueltos pueden también utilizarse como control, aunque el potencial de hibridación de cruz con ciertos mRNAs y la captura inferida de proteínas dependientes entonces debe tenerse en cuenta. Puesto que las proteínas en el efluente final podrían ser apenas visualizadas en geles de poliacrilamida teñido de plata (datos no mostrados), la presencia de conocido ARNm proteínas obran recíprocamente más fue evaluada mediante el análisis de immunoblot. Esto incluye Pfk2p de S. cerevisiae, que se une selectivamente a la PFK2 mRNA en el ribosoma manera independiente12; C. elegans GLD-1, una RBP canónica que se une al 3' secuencias UTR de cep-1 mRNA para regulación traduccional43; y HuR, una RBP que regula la estabilidad del ARNm y traducción de mRNA de p27/CDKN1B 44. Como era de esperarse, todas estas proteínas fueron identificadas en los eluatos de viaje de los mRNAs respectivos por análisis de Western Blot (figura 3B).

Figure 1
Figura 1. Representación esquemática de viaje. Las proteínas son reticulado a RNA en vivo por la irradiación UV. En el primer paso (caja de luz verde), complejos poly(A) RNA-proteína se recuperan con oligo(dT)25 granos aplicando condiciones estrictas de lavado para eliminar las proteínas no Unidas. En el segundo paso (caja rosa), el mRNP objetivo es extraer con oligonucleótidos de RNA antisentido biotinilado y perlas de estreptavidina. Luego se analizan las mRNPs purificadas por RT-PCR y el inmunoblot/espectrometría de masa (MS) para identificar RNAs y proteínas interactúan con el ARNm de interés, respectivamente. La figura fue modificada de la anterior publicación37 con permiso. Haga clic aquí para ver una versión más grande de esta figura.

Figure 2
Figura 2. Aislamiento de las mRNAs del RNA total de células/organismos de no-reticulado con modificado antisense RNA puntas de prueba de captura de. (A) impacto de las concentraciones de la sal en la eficiencia de captura de la levadura PFK2 mRNA con ASOs. ARN total de las células de levadura fue combinado con las ASOs indicados y lavar con tampón que contiene la especificado concentración de sal (NaCl) a 55 ° C. Verde, azules y naranjas líneas representan PFK2 recuperación de mRNA con ASOs diferentes según lo determinado por RT-PCR37: recuecen la PFK2-1 y PFK2 -2 en el 3' UTR, PFK2-4 en los CD. PFK1 es un negativo control de mRNA. PCR fue realizada con 32 ciclos de amplificación y cuantificado como se describió anteriormente37. (B) fracción de C. eleganscep-1 y levadura RPS20 ASO limitado mRNAs en temperaturas diferentes, representadas en líneas rojas y negras, respectivamente. C. eleganspgk-1 y levadura ACT1 son mRNAs no objetivo (control). se aplicaron 30 y 32 ciclos PCR para la detección de levaduras y de mRNAs de C. elegans , respectivamente. (C) representación esquemática de la hibridación de DNM1 ASO (rojo) con secuencias en el mRNA DNM1 así como potencial de hibridación de cruz con ACT1 mRNA se muestra a la izquierda. Un gel de agarosa mostrando los productos de las reacciones de RT-PCR (30 ciclos) para la detección de levaduras DNM1 y ACT1 mRNAs eluida de granos se muestra a la derecha. Entrada, ARN total; SN, sobrenadante después de la incubación con ASOs; E, eluatos de granos a indican elución previo de temperaturas (40 ° C, 50 ° C y 60 ° C). Se realizó un experimento de control (Ctrl) en paralelo sin añadir ASO. (D) gel de agarosa mostrando los productos de RT-PCR para la detección de los mRNAs capturado (derecha) del RNA total de levadura S. cerevisiae, C. elegansy las células HEK293 humanas (H. sapiens). Entrada, ARN total; SN, sobrenadante; E, eluidos de los granos. PCR fue realizada por 30 ciclos de amplificación para levadura mRNAs, 32 ciclos de mRNAs de C. elegans , y 28 y 30 ciclos humanos tubulina p27 mRNAs, respectivamente. La figura fue modificada de la anterior publicación37 con permiso. Haga clic aquí para ver una versión más grande de esta figura.

Figure 3
Figura 3. Captura de complejos de ARNm-proteína específica de extractos derivados de células de reticulado UV con viaje. Geles de agarosa (A) para la detección de los mRNAs (derecha) con RT-PCR después de captura con oligo(dT) y ASOs indicados de S. cerevisiae, C. elegans y extractos de células de humano (H. sapiens). Entrada, RNA total de células/organismos de reticulado; Ctrl, control sin ASO. Poly(A), la competencia con poly(A). RT-PCR se realizó como descrito37 con 35 ciclos de amplificación para LUC, 32 ciclos de p27, y 29 ciclos de tubulina. (B) el análisis de Immunoblot de proteínas mRNA-limite con anticuerpos indicados (derecha). Fracciones de carga son los siguientes: 0.1%, 2.5% y 1% de levadura, insumos humanos y nematodos; 10%, 10% y 5% para levaduras, nematodos y humanos oligo(dT) carriles; y el 66% de todos los carriles de ASOs. Pesos moleculares (MW) se indican en kilodaltons (kDa). Figura republicada con permiso37. Haga clic aquí para ver una versión más grande de esta figura.

Nombre de la cartilla Secuencia de Blanco Tamaño
Pfk2_Fwd GTGTTAAGGGTTCACATGTCG PFK2 S. cerevisiae 133 bp
Pfk2_Rev CTTCCAACCAAATGGTCAGC PFK2 S. cerevisiae 133 bp
Pfk1_Fwd GGTGATTCTCCAGGTATGAATG PFK1 S. cerevisiae 97 bp
Pfk1_Rev CTTCGTAACCTTCGTAAACAGC PFK1 S. cerevisiae 97 bp
Act1_Fwd GTCTGGATTGGTGGTTCTATC ACT1 S. cerevisiae 85 bp
Act1_Rev GGACCACTTTCGTCGTATTC ACT1 S. cerevisiae 85 bp
Dnm1_Fwd CTGTGTTCGATGCATCAGAC DNM1 S. cerevisiae 156 bp
Dnm1_Rev CGCACTCCAATTCTTCTCTC DNM1 S. cerevisiae 156 bp
Rps20_Fwd CGCTGAACAACACAACTTGG RPS20 S. cerevisiae 228 bp
Rps20_Rev GGAAGCAACAACAACTTCGAC RPS20 S. cerevisiae 228 bp
Cep1_Fwd CGATGAAGAGAAGTCGCTGT CEP-1 C. elegans 110 bp
Cep1_Rev ATCTGGGAACTTTTGCTTCG CEP-1 C. elegans 110 bp
Pgk1_Fwd GCGATATTTATGTCAATGATGCTTTC PGK-1 C. elegans 74 bp
Pgk1_Rev TGAGTGCTCGACTCCAACCA PGK-1 C. elegans 74 bp
Mpk1_Fwd TGCTCAGTAATCGGCCATTG MPK-1 C. elegans 74 bp
Mpk1_Rev TCCAACAACTGCCAAAATCAAA MPK-1 C. elegans 74 bp
p27_Fwd TTTAAAAATACATATCGCTGACTTCATGG P27 H. sapiens 212 bp
p27_Rev CAAAGTTTATGTGCTACATAAAAGGTAAAAA P27 H. sapiens 212 bp
Luc_Fwd AATGGCTCATATCGCTCCTGGAT Luciferase pγralis p. 117 bp
Luc_Rev TGGACGATGGCCTTGATCTTGTCT Luciferase pγralis p. 117 bp
Β-TUBULIN_Fwd CTGAACCACCTTGTCTCAGC Β-tubulina H. sapiens 136 bp
Β-TUBULIN_Rev AGCCAGGCATAAAGAAATGG Β-tubulina H. sapiens 136 bp
PFK2-1 ASO AAUAGAAAGUGUAAUAAAAGGUCAU 3' UTR PFK2 S. cerevisiae -
PFK2-2 ASO GUUUCAUGGGGUAGUACUUGU 3' UTR PFK2 S. cerevisiae -
PFK2-4 ASO CUUGAAGAGGAGCGUUCAUA ORF PFK2 S. cerevisiae -
DNM1 ASO UCGGUCAGUGGAGGUUCAGCGUUU ORF DNM1 S. cerevisiae -
RPS20 ASO GUCGGUAAUAGCCUUCUCAUUCUUG ORF RPS20 S. cerevisiae -
CEP-1 ASO GUGAGAAAUGCGGUGCUUUGAAA 3' UTR cep-1 C. elegans -
P27 ASO UCAUACCCCGCUCCACGUCAGUU 3' UTR p27 H. sapiens -

Tabla 1. Las secuencias del oligonucleótido. Lista de iniciadores PCR y ASOs utilizados en este trabajo, secuencia cartilla, objetivo de genes y tamaño del fragmento esperado después de la amplificación.

Discussion

VIAJE permite el análisis de proteínas a mRNAs específicos en vivo con medios bioquímicos. Si bien hemos utilizado el método para validar la interacción de prácticas comerciales restrictivas particulares con objetivos de mRNA de células de organismos distintas, viaje también podría ser aplicable al estudio de otros tipos de poly(A) RNAs, como ncRNAs largos citoplásmico. Además, análisis sistemático de encuadernado proteínas o ARNs con secuencias MS o ARN podría lograrse por una expansión del procedimiento. En este sentido, nuestros datos preliminares indican que 1 L de cultivos de levadura y por lo menos 100 millones de células HEK293 humanas podrían proporcionar suficiente materia prima obtener datos confiables de MS para mRNAs bien expresado (resultados inéditos).

El protocolo de viaje descrito incluye la irradiación de células con luz ultravioleta a 254 nm a las interacciones RNA-proteína de la reticulación. Esto permite la aplicación de condiciones estrictas de lavado durante la purificación. Sin embargo, aunque no explícitamente probado, nos gustaría reticulación es opcional y RNPs activadas también pueden ser recuperados con tampones fisiológicos. Sin embargo, en este caso, la entrega potencial de proteínas y ARN en el destino del RNA en lisados debe tenerse en cuenta. Por el contrario, si la UV u otros procedimientos de reticulación son aplicados (p. ej., formaldehído), la integridad del ARN debe ser evaluada como degradación de RNA podría llevar a la menor recuperación de mRNPs. Además, reticulación UV es bastante ineficiente (~ 5%) y menos aún para las proteínas que interactúan con el ARN de doble hebra, que puede introducir sesgos para la detección de ciertos tipos de prácticas comerciales restrictivas12. Por último, la radiación UV también puede inducir reticulaciones proteína-proteína y proteína-ADN que deben ser considerados para la interpretación de datos45,46. Por lo tanto, los procedimientos de cura alternativas, por ejemplo con formaldehído, también podrían ser de particular interés para capturar a grandes conjuntos de proteínas en mRNAs.

Una característica clave del viaje es el procedimiento de purificación basada en ASO recuperar RNAs particular, aumentando así la selectividad y disminuyendo la probabilidad de purificación Co contaminantes de dos etapas. Por ejemplo, una preocupación se refiere a la adición de ASOs biotinilado directamente a extractos celulares, que podrían conducir a la purificación de proteínas de unión a biotina. VIAJE de forma deliberada mediante la implementación de una primera ronda de la purificación de RNAs de poly(A) usando oligo-(dT) covalente acoplamiento25 bolas magnéticas, que permite condiciones de purificación estrictos como hecho para captura del interactoma de RNA-proteína. Además, poly(A) RNA selección elimina los ncRNAs muy abundante, como el ARN ribosómico y tRNAs y por lo tanto reduce la complejidad de la muestra y fuentes potenciales de Cruz-hibridación y contaminación. En el segundo paso, mRNAs particular se recuperan con biotinilado y modificado ASOs que hibridan con las regiones en las blancos del mRNA. Alternativamente, ASOs modificadas podrían también directamente covalente conectarse bolas magnéticas a través de una amina-linker, reducir la propensión a la captura de proteínas de unión de biotina. Sin embargo, en nuestra experiencia, la incubación de la fracción del RNA del poly(A) con ASOs antes de la adición de granos de la estreptavidina había recuperado mRNPs más eficientemente que la adición directa de cuentas ASO-juntado. Posiblemente, oligos gratis son cinéticamente favorecidas con mejor acceso a las secuencias de RNA estructurado en comparación con los oligos inmovilizados. Por lo tanto, el acoplamiento covalente de ASOs para granos antes de la incubación con la muestra podría ser perjudicial para la recuperación de la blanco de RNA y tiene que comprobarse empíricamente.

Una desventaja con métodos ASO base es ineficiente recuperación de algunos mRNAs de destino. Por lo tanto recomendamos la evaluación de varios ASOs que recuecen a diferentes regiones de la transcripción. En concreto, sugerimos el diseño de 2-3 ASOs que hibridan con las secuencias en el 3'-UTR o los CDS del ARNm de interés. Cada ASO puede exhibir una eficiencia diferente para la recuperación de la meta ARNm respectivos y deben ser empíricamente probados (figura 2A, B, datos no mostrados). Al final, encontramos que ASOs recocido a 3' UTRs se desempeñaron mejor en comparación con los de recocido en CDS. Esto podría ser debido a la mayor accesibilidad de los sitios en el genoma de unión debido a la ausencia de traducción en los ribosomas, mientras que los ribosomas pueden obstruir eficiente hibridación dentro de CD. También experimentamos que combinación de ASOs varios podría conducir a la contaminación creciente de abundante distintos mRNAs y reducción de la eficacia del desplegable. En cualquier caso, la selectividad de los oligos solicitadas puede ser controlada por los experimentos de competencia (e.g., adición de oligos que compiten).

Otra preocupación se refiere al potencial Cruz-hibridación con RNAs no relacionados, como observamos incluso parcial hibridación con otros mRNAs puede conducir a la recuperación de ese mRNA (figura 2). Para evaluar la idoneidad de los ASOs diseñadas, que por lo tanto recomendamos realizar inicial en vitro con ARN total para optimizar las concentraciones de la sal y la temperatura de lavado de buffers. En nuestras manos, lavado de granos magnéticos estreptavidina acoplado en tampones conteniendo 150 mM NaCl a 55 ° C realizado mejor, pero se recomiendan pruebas independientes de las condiciones para cada ASO diseñado. Notable, se encontró que todos ASOs seleccionadas de experimentos in vitro (Figura 2D) se apropiado para capturar el respectivo objetivo de mRNA de extractos celulares de reticulado (figura 3), más que la validez de en Vitro pruebas. Además de diseño de ASOs adecuados para captura de ARNm, factores adicionales podrían impactar en selectividad. Por lo tanto, procedimientos de bloqueo completo con BSA o tRNA según las especificaciones del tipo de grano pueden prevenir la Unión inespecífica a granos. Para reducir la absorción inespecífica de las proteínas, también recomendamos el uso de tubos de atar Lo, especialmente cuando se trabaja con cantidades bajas de muestras.

Generalmente, viaje puede complementar enfoques previamente establecidos para capturar RNAs con ASOs. Por ejemplo, el RNA no codificante Xist fue aislado con proteínas dependientes de extractos nucleares derivados de células de reticulado UV 200 millones mediante el uso de una matriz de largo (90-mer) biotinilado ADN oligonucleótidos que cubría la transcripción entera 34,35. Sin embargo, el enfoque de mosaico elegido podría ser problemático a la luz el gran potencial de Cruz-hibridación con RNAs sin relación, y no puede utilizarse para seleccionar transcripción específico, por ejemplo., alternativamente empalmados formas. Recientemente, específicamente ácido nucleico bloqueado (LNA) o ADN ASO mixmers fueron Unidos covalentemente a una resina magnética para recuperarse en vitro transcripción o RNAs ribosomales altamente expresadas de extractos libres de células; sin embargo, no fue probado para la recuperación de en vivo forman ARNm-proteína complejos36. Teniendo en cuenta el creciente reconocimiento del control postranscripcional del gen por prácticas comerciales restrictivas y ncRNA, creemos que el viaje es un método útil para investigar la composición y dinámica de los complejos de RNP dentro de las células a estímulos intracelulares y ambientales y su impacto en salud y enfermedad.

Disclosures

Los autores no tienen nada que revelar.

Acknowledgments

Estamos agradecidos con el Dr. Jonathan Hall y Mauro Zimmermann (ETH Zurich) para la síntesis de PFK2 y cep-1 ASOs, Dr. Maikel Wouters para el diseño de ASOs p27/CDKN1B y Dr. Rafal Ciosk (Friedrich Miescher Institute para la investigación biomédica, Basilea) para anticuerpos anti-GLD-1. Este trabajo fue apoyado por la biotecnología y Consejo de investigación de ciencias biológicas (BB/K009303/1) y un Real Sociedad Wolfson Research Premio al mérito (WM170036) a A.P.G.

Materials

Name Company Catalog Number Comments
MaxQ 5000 Large Incubated and Refrigerated Orbital Shaker Thermo Fisher Scientific SHKE5000-8CE Floor shaker to grow yeast cells
BBD 6220 Thermo Fisher Scientific CO2 incubator to grow human cells
Sonicator Soniprep150 MSE MSS150.CX4.5 Sonicator/cell disruptor. Used to shear DNA in human cell lysates
Stratalinker 1800 Stratagene Stratalinker to expose cells to UV light at 254 nm
Tissue Lyser Qiagen RETSCH MM200 Device to mechanically disrupt yeast cells
Refrigerated Centrifuge Eppendorf 5810R Centrifuge to spin down cells, lysates
Shaking incubator, Thriller Peqlab Thermoshaker for 1.5 mL tubes
Glass beads 0.5mm Stratech Scientific Limited 11079105 Lysis of yeast cells
Nylon Filter, 0.41 μm Millipore NY4104700 Collection of yeast cells
Millex-HA Filter, 0.45 µm EMD Millipore SLHA02510 Filter to clear nematode lysate
Eppendorf LoBind microcentrifuge tubes Protein 1.5 mL Sigma-Aldrich 22431081 Minimise protein loss
2 mL microfuge tube Ambion AM12425 Yeast extract preparation and other applications
5 mL tube Thermo Fisher Scientific 129A Collection of HEK293 cell lysate
15 mL tube Sarstedt 62.547.254 Collection C. elegans
50 mL plastic tube Sarstedt 62.554.502 Collection yeast cells
DMEM, high glucose, pyruvate Thermo Fisher Scientific 41966 Media for culturing HEK293 cells
Penicillin-Streptomycin Sigma-Aldrich P4333 Used to supplement cell culture media to control bacterial contamination
Fetal Bovine Serum (FBS) Sigma-Aldrich F7524 Used to supplement cell culture media
Lipofectamine 2000 Thermo Fisher Scientific 11668027 Transfection reagent
RQ1 RNase-Free DNase Promega M6101 DNAse I to degrade DNA from cell lysate
RNasin Plus RNase Inhibitor Promega N2611 RNase inhibitor to avoid RNA degradation
cOmplete, Mini, EDTA-free Protease Inhibitor Cocktail Roche 11836170001 Protease inhibitor cocktail to avoid protein degradation
Dynabeads Oligo (dT)25 Thermo Fisher Scientific 61011 Magnetic beads required for the first step of mRNA-protein complex purification
Dynabeads M-280 Streptavidin Thermo Fisher Scientific 11205D Magnetic beads required for the second step of mRNA-protein complex purification
E. coli tRNA Sigma-Aldrich 10109550001 transfer RNA from E. coli used for blocking streptavidin beads and avoid unsepecific interactions
Quick Start Bradford 1x Dye Reagent BioRad 5000205 To determine protein concentration within lysates, using BSA as reference
Bovine Serum Albumin Sigma A7906-100G Used to perform the standard curve that will be used as reference for protein concentration determination
mouse anti-Act1 MP Biomedicals 869100 Antibody for detection of yeast actin in Western blot (1:2,500)
mouse anti-Act1 Sigma A1978 Antibody for detection of human actin in Western blot (1:2,000)
mouse anti-HuR Santa Cruz sc-5261 Antibody for detection of HuR in Western blot (1:500)
mouse anti–CYC-1 Invitrogen 456100 Antibody for detection of Cyc-1 in Western blot (1:1,000)
peroxidase anti-peroxidase soluble complex Sigma P1291 Detection of Pfk2:TAP in Western blot (1:5,000)
HRP-conjugated sheep anti-mouse IgG Amersham NXA931 HRP-coupled secondary antibody

DOWNLOAD MATERIALS LIST

References

  1. Mitchell, S. F., Parker, R. Principles and properties of eukaryotic mRNPs. Molecular Cell. 54, (4), 547-558 (2014).
  2. Iadevaia, V., Gerber, A. P. Combinatorial Control of mRNA Fates by RNA-Binding Proteins and Non-Coding RNAs. Biomolecules. 5, (4), 2207-2222 (2015).
  3. McHugh, C. A., Russell, P., Guttman, M. Methods for comprehensive experimental identification of RNA-protein interactions. Genome Biology. 15, (1), 203 (2014).
  4. Matia-González, A. M., Gerber, A. P. Ch. 14. Fungal RNA Biology. Sesma, A., von der Haar, T. Springer. 347-370 (2014).
  5. Tsvetanova, N. G., Klass, D. M., Salzman, J., Brown, P. O. Proteome-wide search reveals unexpected RNA-binding proteins in Saccharomyces cerevisiae. PLoS One. 5, (9), (2010).
  6. Castello, A., et al. Insights into RNA biology from an atlas of mammalian mRNA-binding proteins. Cell. 149, (6), 1393-1406 (2012).
  7. Baltz, A. G., et al. The mRNA-bound proteome and its global occupancy profile on protein-coding transcripts. Molecular Cell. 46, (5), 674-690 (2012).
  8. Castello, A., et al. System-wide identification of RNA-binding proteins by interactome capture. Nature Protocols. 8, (3), 491-500 (2013).
  9. Liao, Y., et al. The Cardiomyocyte RNA-Binding Proteome: Links to Intermediary Metabolism and Heart Disease. Cell Reports. 16, (5), 1456-1469 (2016).
  10. Liepelt, A., et al. Identification of RNA-binding Proteins in Macrophages by Interactome Capture. Molecular Cell Proteomics. 15, (8), 2699-2714 (2016).
  11. Conrad, T., et al. Serial interactome capture of the human cell nucleus. Nature Communications. 7, 11212 (2016).
  12. Matia-Gonzalez, A. M., Laing, E. E., Gerber, A. P. Conserved mRNA-binding proteomes in eukaryotic organisms. Nature Structural and Molecular Biology. 22, (12), 1027-1033 (2015).
  13. Mitchell, S. F., Jain, S., She, M., Parker, R. Global analysis of yeast mRNPs. Nature Structural and Molecular Biology. 20, (1), 127-133 (2013).
  14. Beckmann, B. M., et al. The RNA-binding proteomes from yeast to man harbour conserved enigmRBPs. Nature Communications. 6, 10127 (2015).
  15. Wessels, H. H., et al. The mRNA-bound proteome of the early fly embryo. Genome Research. 26, (7), 1000-1009 (2016).
  16. Sysoev, V. O., et al. Global changes of the RNA-bound proteome during the maternal-to-zygotic transition in Drosophila. Nature Communications. 7, 12128 (2016).
  17. Despic, V., et al. Dynamic RNA-protein interactions underlie the zebrafish maternal-to-zygotic transition. Genome Research. 27, (7), 1184-1194 (2017).
  18. Zhang, Z., et al. UV crosslinked mRNA-binding proteins captured from leaf mesophyll protoplasts. Plant Methods. 12, 42 (2016).
  19. Reichel, M., et al. In Planta Determination of the mRNA-Binding Proteome of Arabidopsis Etiolated Seedlings. Plant Cell. 28, (10), 2435-2452 (2016).
  20. Koster, T., Marondedze, C., Meyer, K., Staiger, D. RNA-Binding Proteins Revisited - The Emerging Arabidopsis mRNA Interactome. Trends Plant Sciences. 22, (6), 512-526 (2017).
  21. Hamasaki, K., Killian, J., Cho, J., Rando, R. R. Minimal RNA constructs that specifically bind aminoglycoside antibiotics with high affinities. Biochemistry. 37, (2), 656-663 (1998).
  22. Bachler, M., Schroeder, R., von Ahsen, U. StreptoTag: a novel method for the isolation of RNA-binding proteins. RNA. 5, (11), 1509-1516 (1999).
  23. Vazquez-Pianzola, P., Urlaub, H., Rivera-Pomar, R. Proteomic analysis of reaper 5' untranslated region-interacting factors isolated by tobramycin affinity-selection reveals a role for La antigen in reaper mRNA translation. Proteomics. 5, (6), 1645-1655 (2005).
  24. Hartmuth, K., Vornlocher, H. P., Luhrmann, R. Tobramycin affinity tag purification of spliceosomes. Methods Molecular Biology. 257, 47-64 (2004).
  25. Beach, D. L., Keene, J. D. Ribotrap : targeted purification of RNA-specific RNPs from cell lysates through immunoaffinity precipitation to identify regulatory proteins and RNAs. Methods Molecular Biology. 419, 69-91 (2008).
  26. Slobodin, B., Gerst, J. E. A novel mRNA affinity purification technique for the identification of interacting proteins and transcripts in ribonucleoprotein complexes. RNA. 16, (11), 2277-2290 (2010).
  27. Slobodin, B., Gerst, J. E. RaPID: an aptamer-based mRNA affinity purification technique for the identification of RNA and protein factors present in ribonucleoprotein complexes. Methods Molecular Biology. 714, 387-406 (2011).
  28. Yoon, J. H., Gorospe, M. Identification of mRNA-Interacting Factors by MS2-TRAP (MS2-Tagged RNA Affinity Purification). Methods Molecular Biology. 1421, 15-22 (2016).
  29. Leppek, K., Stoecklin, G. An optimized streptavidin-binding RNA aptamer for purification of ribonucleoprotein complexes identifies novel ARE-binding proteins. Nucleic Acids Research. 42, (2), 13 (2014).
  30. Blencowe, B. J., Sproat, B. S., Ryder, U., Barabino, S., Lamond, A. I. Antisense probing of the human U4/U6 snRNP with biotinylated 2'-OMe RNA oligonucleotides. Cell. 59, (3), 531-539 (1989).
  31. Lingner, J., Cech, T. R. Purification of telomerase from Euplotes aediculatus: requirement of a primer 3' overhang. Proceedings of the National Academy of Sciences U S A. 93, (20), 10712-10717 (1996).
  32. Upadhyay, A., Dixit, U., Manvar, D., Chaturvedi, N., Pandey, V. N. Affinity capture and identification of host cell factors associated with hepatitis C virus (+) strand subgenomic RNA. Molecular Cell Proteomics. 12, (6), 1539-1552 (2013).
  33. Imig, J., et al. miR-CLIP capture of a miRNA targetome uncovers a lincRNA H19-miR-106a interaction. Nature Chemical Biology. 11, (2), 107-114 (2015).
  34. Chu, C., et al. Systematic discovery of Xist RNA binding proteins. Cell. 161, (2), 404-416 (2015).
  35. McHugh, C. A., et al. The Xist lncRNA interacts directly with SHARP to silence transcription through HDAC3. Nature. 521, (7551), 232-236 (2015).
  36. Rogell, B., et al. Specific RNP capture with antisense LNA/DNA mixmers. RNA. 23, (8), 1290-1302 (2017).
  37. Matia-Gonzalez, A. M., Iadevaia, V., Gerber, A. P. A versatile tandem RNA isolation procedure to capture in vivo formed mRNA-protein complexes. Methods. 93-100 (2017).
  38. Gruber, A. R., Lorenz, R., Bernhart, S. H., Neubock, R., Hofacker, I. L. The Vienna RNA websuite. Nucleic Acids Research. 36, (Web Server issue), Available from: http://rna.tbi.univie.ac.at/cgi-bin/RNAWebSuite/RNAfold.cgi W70-W74 (2008).
  39. Kalendar, R., Khassenov, B., Ramankulov, Y., Samuilova, O., Ivanov, K. I. FastPCR: An in silico tool for fast primer and probe design and advanced sequence analysis. Genomics. 109, (3-4), Available from: http://primerdigital.com/tools/PrimerAnalyser.html 312-319 (2017).
  40. Altschul, S. F., Gish, W., Miller, W., Myers, E. W., Lipman, D. J. Basic local alignment search tool. Journal of Molecular Biology. 215, (3), 403-410 (1990).
  41. Stiernagle, T. Maintenance of C. elegans. WormBook. 1-11 (2006).
  42. Kedde, M., et al. A Pumilio-induced RNA structure switch in p27-3' UTR controls miR-221 and miR-222 accessibility. Nature Cell Biology. 12, (10), 1014-1020 (2010).
  43. Schumacher, B., et al. Translational repression of C. elegans p53 by GLD-1 regulates DNA damage-induced apoptosis. Cell. 120, (3), 357-368 (2005).
  44. Ziegeler, G., et al. Embryonic lethal abnormal vision-like HuR-dependent mRNA stability regulates post-transcriptional expression of cyclin-dependent kinase inhibitor p27Kip1. Journal of Biological Chemistry. 285, (20), 15408-15419 (2010).
  45. Itri, F., et al. Femtosecond UV-laser pulses to unveil protein-protein interactions in living cells. Cellular and Molecular Life Sciences. 73, (3), 637-648 (2016).
  46. Zhang, L., Zhang, K., Prandl, R., Schoffl, F. Detecting DNA-binding of proteins in vivo by UV-crosslinking and immunoprecipitation. Biochemical and Biophysical Research Communications. 322, (3), 705-711 (2004).
Un procedimiento de aislamiento de RNA tándem basada en oligonucleótidos recuperar complejos eucariotas ARNm-proteína
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Iadevaia, V., Matia-González, A. M., Gerber, A. P. An Oligonucleotide-based Tandem RNA Isolation Procedure to Recover Eukaryotic mRNA-Protein Complexes. J. Vis. Exp. (138), e58223, doi:10.3791/58223 (2018).More

Iadevaia, V., Matia-González, A. M., Gerber, A. P. An Oligonucleotide-based Tandem RNA Isolation Procedure to Recover Eukaryotic mRNA-Protein Complexes. J. Vis. Exp. (138), e58223, doi:10.3791/58223 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter