Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biochemistry

En oligonukleotid-baserade Tandem RNA isolering förfarande att återställa eukaryota mRNA-proteinkomplex

doi: 10.3791/58223 Published: August 18, 2018
* These authors contributed equally

Summary

En tandem RNA isolering (resa) för återvinning av endogent bildade mRNA-proteinkomplex beskrivs. Specifikt, RNA-proteinkomplex är tvärbundna i vivo, polyadenylated RNAs isoleras från extrakt med oligo(dT) pärlor och särskilt mRNA fångas med modifierade RNA antisense oligonukleotider. Proteiner som bunden till mRNA upptäcks av immunoblot analys.

Abstract

RNA-bindande proteiner (RBPs) spelar viktiga roller för post-transcriptional kontroll av genuttryck. Biokemisk karakterisering av mRNA-proteinkomplex är därför nödvändig för att förstå mRNA förordning slutsatsen av samverkande proteiner eller icke-kodande RNAs. Häri, beskriver vi ett tandem RNA isolering förfarande (resa) som möjliggör rening av endogent bildade mRNA-proteinkomplex från cellulära extrakt. Två-stegs protokollet innebär isolering av polyadenylated mRNA med antisense oligo(dT) pärlor och efterföljande fånga en mRNA av intresse med 3'-biotinylerade 2'-O-metylerat antisense-RNA oligonukleotider, som sedan kan isoleras med streptividin pärlor. RESAN var används för att återställa i vivo tvärbundna mRNA-ribonukleoprotein (mRNP) komplex från jäst, nematoder och mänskliga celler för ytterligare RNA och protein analys. Således, resa är en mångsidig strategi som kan anpassas till alla typer av polyadenylated RNAs över organismer att studera dynamiska omflyttningen av mRNPs som införts av intracellulära eller miljömässiga Biljardköer.

Introduction

Post-transcriptional genreglering drivs genom samspelet mellan RNA-bindande proteiner (RBPs), icke-kodande RNAs (ncRNAs) och mRNA, som direkt bearbetning, lokalisering, översättning och förfalla av varje avskrift inom celler1 , 2. identifiering av RBPs och ncRNA interagerar med viss mRNA, fastställa vad som kallas ribonukleoprotein komplex och partiklar (RNPs), är därför nyckeln till att förstå ödet av mRNA och gen uttryck kontroll. Kompletterande strategier genomförs för biokemisk karakterisering av RNP komplex3,4: medan den ”protein-centrerad” tillvägagångssättet bygger på rening av specifika RBPs, metoden ”RNA-centrerad” innebär den isolering av subpopulationer eller enskilda RNAs och efterföljande analys av samverkande proteiner eller RNAs. Nyligen, en RNA-centric metod för identifiering av RBP repertoaren interagerar med polyadenylated (poly(A)) RNAs5 har blivit allt populärare genom att införliva ett ultraviolett (UV) ljus crosslinking steg för att stabilisera protein-RNA interaktioner före isolering av mRNA, som dramatiskt utökade katalogen av RBPs mänskliga celler6,7,8,9,10,11, Caenorhabditis elegans 12, saccharomyces cerevisiae12,13,14och andra organismer15,16,17,18, 19,20. Kartläggning av proteiner eller ncRNAs monterade på viss avskrifter är dock fortfarande en stor utmaning. För detta ändamål används för närvarande två huvudsakliga metoder: dels, RNA aptamer taggar är smält till RNA av intresse att möjliggöra affinitet rening. Därmed, binder de RNA aptamers med hög affinitet aminoglykosidantibiotika inklusive tobramycin och streptomycin21,22,23,24eller proteiner, såsom proteinet coat från den R17/MS2 bacteriophage eller bakteriell streptividin S125,26,27,28,29. Även om denna strategi visade sig vara relativt robust och mångsidig, det kräver kloning att designa RNA under utredning, och således inte kan användas för att fånga naturliga mRNA. Däremot, antisense oligonukleotider (ASOs) användes tidigt för återhämtning och karakterisering av starkt uttryckt infödda RNPs30,31 och viral RNAs32. Mer nyligen, ASOs tillämpades för att fånga länge icke kodande RNAs33,34,35 och in vitro- bildade mRNPs36. En stor begränsande faktor med alla RNA centrerad tillvägagångssätt är kopia antalet RNA av intresse, att göra återhämtningen av låg-uttryckta mRNA mer problematiska. Denna begränsning kan övervinnas genom uppskalning biverkningen. emellertid, detta kan potentiellt leda till ökande bakgrunden.

Häri, beskriver vi vår nyutvecklade ASO-baserade tandem RNA isolering förfarande (resa) att isolera infödda mRNA-proteinkomplex med hög selektivitet37 (figur 1),. Protokollet innebär två sekventiella ASO-baserade reningssteg, nämligen isoleringen av poly(A) mRNA med kommersiellt tillgängliga oligo(dT) tillsammans pärlor följt av upptagning av specifika mRNA använder specifikt designade kort biotinylerade 2'-metoxi RNA ASOs. Detta tvåstegsförfarande hjälper till att eliminera kontaminerande proteiner och ger möjligheter för justering och optimering. I detta fall resa tillämpades på valda mRNA från jäst, nematoder, och mänskliga celler att bekräfta i vivo bildade mRNA-proteinkomplex.

Protocol

1. design Antisense oligonukleotider (ASOs)

  1. Analysera det sekundära strukturerar mRNA eller ett fragment därav använder tillgängliga onlineverktyg38. Därför ange av nukleotidsekvensen (nt) i rutan tom. Välj minsta fri energi (MFE) och partition funktion och undvika isolerade baspari rutan grundläggande alternativ. I rutan utdata alternativ Välj interaktiv RNA sekundärt strukturera tomt och klicka slutligen på knappen Fortsätt . Ett nytt fönster kommer popup-fönster som visar det sekundära strukturerar av mRNA av intresse.
  2. Välj minst tre olika 21-24 nts långa sekvenser inom mRNA av intresse, företrädesvis i regioner som saknar påvisbar sekundära strukturer (t.ex., i ostrukturerade loopar) och i 3' translaterade regioner (UTR).
    Obs: Det har observerats att ASOs glödgning till sekvenser i translaterade 3' regioner (UTR) presterade bäst. En möjlighet är att ribosomer bundna till den kodande sekvensen (CDS) ibland kan hindra glödgning av ASOs. ASOs glödgning till 5' utr testades inte.
    1. Välj regionerna med förhållandet guanidin/cytosin nära 50% och saknar nukleotid tandem upprepas för att undvika potentiella bildandet av hårnålar eller själv glödgning.
  3. Design 2'-metoxi modifierat manuellt RNA oligonukleotider bär en biotin biexponentiellt på 3na ', fullt komplement till de utvalda regionerna (steg 1.2) inom önskad rikta mRNA.
    Obs: 2-metoxi ändringar återge de RNA resistenta till cellulära RNaser och ökar duplex smälttemperatur, vilket möjliggör stränga tvätt. Den biotin biexponentiellt krävs för att fånga ASOs med streptividin.
    1. Justera smälttemperatur av RNA hybrider till ~ 60-65 ° C och säkerställa att den har en hög språklig sekvens-komplexitet (> 60%) som bestämts med lämplig onlineverktyg39.
    2. Använd Basic Local Alignment Search Tool40 för att söka efter potentiella ASO cross-hybridisering med andra mRNA i transkriptom. Välj Nucleotide BLAST, infoga sekvenser i den tomma rutan och välj organismen av intresse. Håll återstående parametrar som standard och klicka BLAST.
      Obs: Även partiell kontinuerlig anpassning av 8-10 nts kan leda till cross-hybridisering och återvinning av denna mRNA.

2. cell kultur, UV-bestrålning och Cell Lysis

Obs: I följande beskrivs förfarandet för spirande jäst S. cerevisiae, nematoder C. elegansoch mänskliga embryonala njurceller (HEK293). Det kan dock anpassas till andra organismer samt, även om det inte uttryckligen har testats ännu.

  1. S. cerevisiae
    1. Växa jästceller (t.ex., stam BY4743 derivat; MATa/α his3Δ1/his3Δ1 leu2Δ0/leu2Δ0 LYS2/lys2Δ0 met15Δ0/MET15 ura3Δ0/ura3Δ0 PFK2:TAP / PFK2) i 500 mL YPD media (1% jästextrakt, 2% pepton, 2% D-glukos) vid 30 ° C under ständig skakning vid 220 rpm.
    2. Samla in cellerna på mitten av stocken fas (optisk densitet vid 600 nm (OD)600 ~ 0,6) genom filtrering med 0,45 µm nylon filter eller genom centrifugering vid 3000 × g i 2 min i rumstemperatur (RT). Kassera genomflöde eller supernatanten, respektive.
    3. Tvätta cellerna tre gånger med 25 mL av fosfat-buffrat-saltlösning (PBS) med filtret 0,45 µm nylon eller samla genom centrifugering vid 3000 × g i 2 min på RT och kasta bort supernatanten. Samla in cellerna så snabbt som möjligt som påtvingade stress kan ha en inverkan på RNA-protein interaktioner.
    4. Resuspendera cellerna i 25 mL PBS och sedan Häll suspensionen i en 15 cm petriskål. Placera skålen på is, ta bort locket och exponera cellerna tre gånger med 400 mJ cm-2 254 nm UV ljus i en UV-crosslinker med 2 minuters pauser på isen mellan varje exponering cykel med mild blandning.
    5. Överföra cellerna till en 50 mL tub och samla cellerna genom centrifugering vid 3000 × g i 3 min vid 4 ° C. Avlägsna supernatanten och hålla pelleten.
      Obs: Celler kan vara snapin fryst i flytande kväve och lagras vid-80 ° C.
    6. Att resuspendera cellerna i 4 mL kylt lyseringsbuffert A (LB-A 100 mm Tris-HCl, pH 7.5, 500 mM LiCl, 10 mM EDTA, 1% Triton x-100, 5 mM DTT, 20 U ml-1 DNAS jag, 100 U ml-1 RNasin, slutföra EDTA-fria proteashämmare cocktail).
    7. Över cellerna till två 2 mL rör. Lägg till max. ⅔ volymer av kylda glaspärlor och störa cellerna i en vävnad lyser vid 30 Hz under 10 minuter vid 4 ° C.
    8. Slå ett hål i botten av röret med en het nål och överföra den lysate till en fräsch 1,5 mL tub genom centrifugering vid 600 × g i 30 s.
    9. Avmarkera den lysate av tre sekventiella centrifugations vid 4 ° C vid 3 000 × g i 3 min, sedan 5 000 × g och 10 000 × g i 5 min varje.
      Obs: Extrakt kan snapin-frysta i flytande kväve och lagras vid-80 ° C.
  2. C. elegans
    1. Kultur Bristol N2 maskar vid 20 ° C på Nematoden tillväxt Medium (NGM) tallrikar (0.3% NaCl, 1,7% agar, 0,25% pepton, 1 mM CaCl2, 5 µg/mL kolesterol, 1 mM MgSO4, 25 mM KPO4 buffert, pH 6,0) seedade med OP50 Escherichia coli stam 41 .
    2. Tillsätt 5 mL av M9 buffert41 (0,3% KH2PO4, 0,6% Na2HPO4, 0,5% NaCl, 1 mM MgSO4) till varje platta, skaka plattan för att resuspendera maskar och överföra maskar till en 15 mL tub. Placera 2 µL av suspensionen i en bild och räkna maskar i suspensionen med ett mikroskop. Applicera sedan faktorn för att beräkna antalet maskar per tallrik.
    3. Samla in ~ 120.000 maskar genom centrifugering vid rumstemperatur (400 × g, 2 min, RT) och Kassera supernatanten.
    4. Tvätta maskar tre gånger. Därför, tillsätt 10 mL av M9 buffert, blanda genom inversion och samla maskar genom centrifugering vid 400 × g i 2 min på RT.
    5. Tillsätt 15 mL M9 buffert till maskar och placera på ett roterande hjul för 15 min på RT.
    6. Överföra maskar till NGM plattor (~ 4.000 maskar per tallrik) och utsättas för UV-ljus (254 nm) på 300 mJ cm-2 i en UV-crosslinker.
    7. Tillsätt 5 mL av M9 buffert direkt till plattan och skaka plattan för att resuspendera maskar i bufferten. Överför med pipett till en 15 mL tub och samla maskar genom centrifugering vid 400 × g i 2 min på RT.
    8. Återsuspendera maskar i 2 mL lyseringsbuffert B (LB-B; 100 mM Tris-HCl, pH 8,0, 150 mM NaCl, 1 mM EDTA, 0,75% IGEPAL, 1 mM DTT, 20 U mL-1 DNAS jag, 100 U mL-1 RNasin, slutföra EDTA-fria proteashämmare cocktail).
    9. Mala maskar i en mortel fylld med flytande kväve. Samla in pulvret i en 50 mL tub och Tina på RT.
      Obs: Flytande kväve måste hanteras enligt säkerhetsrutiner (t.ex. rök huva och säkerhet handskar)
    10. Rensa den lysate inklusive fett lager genom centrifugering vid 14.000 × g i 10 min och därefter passera den klargj橬一j lysate genom ett 0,45 μm filter med en spruta.
  3. Mänskliga odlade celler
    Obs: Följande beskrivning utgår övergående transfection av HEK293 celler med pGL3-CDKN1B-3'UTR reporter plasmiden som uttrycker 3′UTR CDKN1B/27 nedströms till firefly luciferas gen42.
    1. Kultur HEK293 celler i Dulbeccos modifierade örnens Medium (DMEM) som innehåller glukos 25 mM och 1 mM natrium pyruvat, kompletterat med 100 U mL-1 penicillin, 100 µg mL-1 streptomycin och 10% fetalt bovint serum (FBS) och inkubera vid 37 ° C i en befuktade kammare (inkubator) som innehåller 5% CO2.
    2. Utsäde ~ 3 × 106 HEK293 celler i en standard 10 cm vävnadsodling maträtt dagen innan transfection. Räkna cellerna med en hemocytometer.
    3. Blanda 2 µg av reporter genen (t.ex., pGL3-M27-3'UTR) med 20 µL av transfection reagens och transfect cellerna på 70% konfluens (~ 7 × 106 celler).
    4. Placera cellerna i en inkubator vid 37 ° C för ytterligare 48 h före skörd.
    5. Ta bort mediet med serologiska pipett och snabbt tvätta cellerna två gånger med 10 mL PBS pre värmas vid 37 ° C. Ta bort PBS med serologiska pipett.
    6. Tillsätt 6 mL PBS till skålen, placera på isen och sedan utsätta celler till UV-ljus (254 nm) på 100 mJ cm-2 i en UV-crosslinker.
      Obs: Plattan måste hållas på is under UV-ljus exponering.
    7. Skrapa bort cellerna (i totala ~ 107 celler) i PBS och överföring till en 15 mL tub.
    8. Snurra ner cellerna vid 250 × g i 10 minuter vid 4 ° C och ta bort supernatanten med en pipett.
      Obs: Cellpelleten kan snapin-frysta i flytande kväve och lagras vid-80 ° C fram till användning.
    9. Resuspendera cellerna i 2 mL före kylda lyseringsbuffert (LB-A) av pipettering upp och ner för 5 - 6 gånger, samtidigt hålla röret på is.
    10. Överföra den lysate med en pipett till en 5 mL tub placeras på is.
    11. Utsätta den lysate till tre rundor av ultraljudsbehandling bestående av 20 s skurar på 10 μm amplitud med 30 s av kylning perioder på is.
      Obs: Ultraljudsbehandling rekommenderas eftersom den är klar lys av celler och fragment DNA.
    12. Överföra den lysate till 2 mL rör och centrifugera vid 15.000 × g under 10 minuter vid 4 ° C. Samla in supernatanten (= extrakt) och överföring till en ny tub. Ta bort ett analysprov (5-10%) för ytterligare protein och RNA analys.
      Obs: Detta steg är avgörande för att ta bort alla återstående cellfragment och kan upprepas.

3. första steget: Poly(A) RNA isolering

  1. Temperera 1 mg oligo(dT)25-kombination magnetiska pärlor i 500 µL av den respektive lyseringsbuffert.
  2. Kombinera 5 mg, 10 mg eller 4 mg (protein) S. cerevisiae, C. elegans eller HEK293 extrakt, respektive, med 1 mg oligo(dT)25 -kombination magnetiska pärlor. Blanda proverna kraftigt i 10 minuter vid 25 ° C i en mixer.
    Obs: Protein koncentrationerna av extrakt kan bestämmas med Bradford analys med bovint serumalbumin (BSA) som en referensstandard. Kraftig skakning av prover förebygger sedimentering av pärlor. Utvärdera specificiteten av mRNA isolering, kan en kontroll experiment utföras parallellt genom att lägga till ett överskott (20 µg) av polyadenylic syror (pA).
  3. Placera rören på en magnetisk stå för 10 s och ta bort supernatanten. Förvara supernatanten på is för efterföljande satsningsrundor återhämtning (steg 3,7).
  4. Tillsätt 500 µL av wash buffer A (10 mM Tris-HCl, pH 7.5, 600 mM LiCl, 1 mM EDTA, 0,1% Triton x-100) till pärlor och virvel för 5 s.
    Obs: Koncentrationen av LiCl i tvätta buffertar kan variera. 600 mM LiCl rekommenderas men lägre koncentrationer testades också (500 mM för C. elegans, 300 mM för HEK293).
  5. Samla pärlor med en magnet och tvätta sedan pärlorna två gånger med 500 µL tvättlösning B (WB; 10 mM Tris-HCl, pH 7.5, 600 mM LiCl, 1 mM EDTA).
  6. Eluera RNA i 30 µL 10 mM Tris-HCl, pH 7.5 vid 80 ° C i 2 min under ständig skakning (1000 rpm) i en mixer. Omedelbart placera röret i den magnetisk stå och samla eluatet efter 10 s. Spara pärlorna för ytterligare rundor av rening.
    Obs: Samla eluatet så snabbt som möjligt för att förhindra potentiella rebinding av mRNA till pärlorna vid lägre temperaturer.
  7. Lägga till pärlorna från föregående steg i supernatanten samlas in vid steg 3.3 och upprepa avskiljning, tvättning och eluering av mRNA två gånger (steg 3,3-3,6). Eluat från upprepade omgångar kombineras sedan och kan lagras vid-80 ° C.

4. steg: fånga av specifika mRNA med 3'-biotinylerade 2-metoxi ändrad Antisense-RNA oligonukleotider

Obs: För att testa lämpligheten hos ASOs, följande procedur kan utföras med totala RNAs isolerade från celler.

  1. Temperera 30 µL av streptividin-kopplade magnetiska pärlor i 1 mL av bindande och tvätta buffert (B & W buffert; 10 mM Tris-HCl, pH 7.5, 150 mM NaCl, 0,5 mM EDTA, pH 8,0) som innehåller 0,1 mg mL-1Escherichia coli överföring RNA (tRNA) på en rotator för 1 h på RT.
    1. Tvätta pärlorna tre gånger med 750 µL av B & W buffert.
    2. Återsuspendera pärlor i 30 µL av B & W buffert och hålla på is fram till användning.
  2. Späd ~ 35 µg totalt protein från den tidigare poly(A) isoleringen (se 3) i 100 µL av B & W buffert i en 1,5 mL tub.
    Obs: För att testa specificitet ASOs med total-RNA, lägga till 600 ng av renat total-RNA till 100 µL av B & W buffert.
  3. Tillsätt 200 pmol av respektive ASO och inkubera vid 70 ° C i 5 min.
    Obs: Den förhöjda temperaturen löser sekundära strukturer i RNA underlätta glödgning av ASO.
  4. Ta bort hela värme-blocket från enheten och placera den på RT för 10 min att svalna långsamt.
  5. Tillsätt 30 µL skakade streptividin-kopplade magnetiska pärlor från steg 4.1 i provet.
  6. Inkubera blandningen för 30 min vid 25 ° C under ständig skakning på 950 rpm i en mixer.
    Obs: Det rekommenderas att snärta rören varje 10 min för att förhindra sedimentering av pärlor.
  7. Placera rören i magnetiska montern, avlägsna supernatanten och tvätta pärlorna tre gånger med 750 µL av pre värmde B & W buffert vid 55 ° C.
    Obs: Den optimala tvätt-temperaturen något skilja sig/variera mellan olika ASOs. Det rekommenderas att justera detta tillstånd med icke-tvärbunden totala RNA tidigare utför experimentet med cell extrakt.
  8. Eluera RNA i 20 µL av 10 mM Tris-HCl, pH 7.5 vid 90 ° C i 10 min under ständig skakning på 950 rpm i en mixer. Placera rören i magnetiska stativet och omedelbart samla eluatet.
    Obs: För proteinanalys, tillsätt 20 µL av 1 × Laemmli buffert till pärlorna och inkubera vid 95 ° C för 5 min. proteiner övervakas av immunoblot analys efter standard laboratorium protokoll.

Representative Results

Vi utvecklade en strategi för ASO-baserade RNA isolering, kallas resa, för att fånga särskilda mRNA med deras bundna proteiner från tre olika organismer37. I huvudsak RNA-proteinkomplex var tvärbundna i vivo av UV-bestrålning av celler vid 254 nm och poly(A) RNAs återfanns med kommersiellt tillgängliga oligo (dT) tillsammans-magnetiska pärlor, då mRNA av intresse var isolerade med 3'-biotinylerade 2-0-metoxi modified antisense RNA oligonukleotider (figur 1). Vi därför utformat flera 21-24 nts modified ASOs med full-komplementaritet till regioner i de valda mRNA från jäst, C. elegans och mänskliga, och testat deras lämplighet för att återställa mRNA sevärdheter (en lista över primers och ASOs ges i tabell 1). effektivitet och specificitet av enskilda ASOs utvärderades först med icke-tvärbunden total-RNA isoleras från respektive organismen. I dessa experiment, var RNA ASOs kopplat till streptividin-konjugerad paramagnetiska pärlor och inkuberas med icke-tvärbunden total-RNA beredd från motsvarande organismen. Efter utgivningen av fångade mRNA från pärlorna, förekomsten av mRNA mål såväl som icke-närstående kontroll mRNA övervakades av omvänd Transkription (RT)-polymeras-kedjereaktion (PCR)37. Vi märkte att två variabler, salthalt och temperatur på tvätta buffertar, spelade viktiga roller i effektiviteten i tillfångatagandet av PFK2 mRNA från jäst som testades med tre olika ASOs (figur 2A). Sänka salt (NaCl) koncentrationen till 25 mM minskade återhämtningen av negationen kontrollen mRNA (PFK1) till icke-detekterbara halter med alla ASOs, men det minskade också återvinning av önskad rikta mRNA PFK2 (10-15% av tillförda). Däremot en ökning av de salt koncentrationerna till fysiologiska nivåer (150 mM NaCl) ökad återvinning av PFK2 mRNA upp till 75% med ASO PFK2-2, överstiger kontrollen PFK1 mRNA av minst 5 gånger (figur 2A). Ytterligare notera visade de olika ASOs stor variation av mRNA target capture efficacies vid fysiologiska salt-koncentrationer, betonar behovet av empiriska valideringen av ASOs. Beroendet av mRNA återhämtning på temperaturen tvättlösning exemplifieras för C. elegans cep-1 och jäst RPS20 mRNA, använder respektive ASOs (tabell 1). Vi observerade att optimal wash temperaturen var mellan 50 ° C och 55 ° C, som framgår av låg bakgrunden med orelaterade mRNA och effektiv återvinning av mRNA mål (figur 2B). Vid denna punkt, vill vi understryka möjligheten att cross-hybridisering av ASOs med andra mRNA. Exempelvis DNM1 ASO är fullt komplement till en sekvens inom den DNM1 kodande sekvens, men det också delvis anneals med ÄRV1 mRNA. DNM1 ASOs återvinnas både mRNA oavsett disktemperaturen, visar stark benägenhet för cross-hybridisering (figur 2 c). Slutligen har vi använt ovan beskrivna provningarna och optimeringar välja tre ASOs som var lämpliga för återvinning av respektive mål mRNA från totalt RNA isoleras från S. cerevisiae, C. elegans och mänskliga celler (figur 2D ).

Efter första urval av lämpliga ASOs in vitro utfört vi resa med cell extrakt erhållits från UV-tvärbunden organismer och celler (figur 1). Specifikt, vi testade tre olika mRNA från tre olika organismer återhämtning: PFK2 mRNA från jästen S. cerevisiae, cep-1 från den nematoder C. elegans, och en reporter mRNA (pGL3-CDKN1B-3'UTR) bär den 3' UTR sekvens av mänskliga CDKN1B/M27 mRNA smält till en luciferas (luc) reporter för övergående uttryck i mänskliga HEK293 celler. För att styra specificitet RNA isolering, vi övervakas återvinning av flera orelaterade mRNA, och vi utförde experiment för konkurrens genom tillsats av ett överskott av pA att cell extrakt, som konkurrerar med bindningen av cellulära mRNA till oligo(dT)25 pärlor under det första steget för rening. Som tidigare sett med icke-tvärbunden totala RNA prover (figur 2), RT-PCR bekräftade anrikningen av den respektive mRNA rikta mRNA under resa, medan flera icke-relaterade kontroll mRNA inte berikades (figur 3A). Dessutom upptäcktes varken mRNA på pärlor utan ASOs, som anger lämpliga blockerande förfaranden som undvika ospecifik bindning. På denna rad, kan orelaterade/äggröra ASOs också användas som kontroll, även om potentialen för cross-hybridisering med vissa mRNA och antagna tillfångatagandet av bundna proteiner måste då beaktas. Eftersom proteiner i slutliga eluatet kunde knappast visualiseras på silver-färgade polyakrylamidgeler (inga data anges), utvärderades ytterligare förekomsten av tidigare kända mRNA samverkande proteiner av immunoblot analys. Detta inkluderar Pfk2p från S. cerevisiae, som binder selektivt till PFK2 mRNA i en ribosom oberoende sätt12. C. elegans GLD-1, en kanonisk RBP som binder till 3' UTR sekvenser av cep-1 mRNA för translationell förordning43; och HuR, en RBP som reglerar mRNA-stabilitet och översättning av M27/CDKN1B mRNA44. Som väntat identifierades alla dessa proteiner i de resa eluat av respektive mRNA genom Western Blot analys (figur 3B).

Figure 1
Figur 1. Schematisk framställning av TRIP. Proteiner är tvärbundna till RNA i vivo av UV-bestrålning. I det första steget (ljus gröna rutan) återställs poly(A) RNA-protein komplex med oligo(dT)25 pärlor tillämpa stränga tvätt villkor för att avlägsna obundna proteiner. I det andra steget (rosa box), det målet mRNP är utdragna med biotinylerade antisense-RNA oligonukleotider och streptividin pärlor. De renade mRNPs analyseras sedan av RT-PCR och immunoblot-masspektrometri (MS) för att identifiera RNAs och proteiner interagerar med mRNA sevärdheter, respektive. Siffran ändrades från föregående publikation37 med tillstånd. Klicka här för att se en större version av denna siffra.

Figure 2
Figur 2. Isolering av valda mRNA från total-RNA av icke-tvärbundna celler/organismer med modified antisense RNA fånga sonder. (A) påverkan av salt koncentrationerna på fånga effektiviteten av jästen PFK2 mRNA med ASOs. Total RNA från jästceller var kombinerat med de angivna ASOs och tvättas med buffert som innehåller den angivna salt (NaCl) koncentrationen vid 55 ° C. Grön, blå och orange linjerna representerar PFK2 mRNA återhämtning med olika ASOs som bestäms av RT-PCR37: PFK2-1 och PFK2 -2 glödga i den 3' UTR, PFK2-4 i CDS. PFK1 är en negativ kontroll mRNA. PCR utfördes med 32 förstärkning cykler och kvantifieras som tidigare beskrivits37. (B) bråkdel av C. eleganscep-1 och jäst RPS20 ASO bunden mRNA vid olika tvätt temperaturer, representerade i svarta och röda linjerna, respektive. C. eleganspgk-1 och jäst ÄRV1 är icke-målorganismer (kontroll) mRNA. 30 och 32 PCR cykler tillämpades för detektion av jäst och C. elegans mRNA, respektive. (C) Schematisk framställning av hybridisering av DNM1 ASO (röd) med sekvenser i den DNM1 mRNA samt potentiella cross-hybridisering med ÄRV1 mRNA visas till vänster. En agarosgel visar produkter från RT-PCR-reaktioner (30 cykler) för detektion av jäst DNM1 och ÄRV1 mRNA elueras från pärlor visas till höger. Ingång, total-RNA; SN, supernatanten efter inkubation med ASOs; E, eluat från pärlor som tvättas på angivna temperaturer tidigare eluering (40 ° C, 50 ° C och 60 ° C). En control (Ctrl) utfördes parallellt utan att lägga till ASO. (D) agaros gel visar RT-PCR-produkter för detektion av mRNA (höger) erövrat från total-RNA av jäst S. cerevisiae, C. elegansoch mänskliga HEK293 celler (H. sapiens). Ingång, total-RNA; SN, supernatanten; E, eluat från pärlorna. PCR utfördes av 30 förstärkning cykler för jäst mRNA, 32 cykler för C. elegans mRNA och 28 och 30 cykler för mänskliga tubulin och M27 mRNA, respektive. Siffran ändrades från föregående publikation37 med tillstånd. Klicka här för att se en större version av denna siffra.

Figure 3
Figur 3. Fångst av specifika mRNA-proteinkomplex från extrakt härrör från UV tvärbundna celler med resa. (A) agaros gel för detektion av mRNA (höger) med RT-PCR vid capture med oligo(dT) och indikerade ASOs från S. cerevisiae, C. elegans och mänskliga (H. sapiens) cell extrakt. Ingång, total-RNA från tvärbundna celler/organismer. CTRL, kontroll utan ASO. Poly(A), konkurrens med poly(A). RT-PCR utfördes som beskrivs37 med 35 förstärkning cykler för LUC, 32 cykler för M27, och 29 cykler för tubulin. (B) Immunoblot-analys av mRNA-bundna proteiner med angivna antikroppar (höger). Laddade fraktioner är följande: 0,1%, 2,5% och 1% för jäst, nematoder och mänskliga ingångar; 10%, 10% och 5% för jäst, nematoder och mänskliga oligo(dT) körfält, och 66% för alla ASOs körfält. Molekylvikt (MW) anges i kilodaltons (kDa). Bilden publiceras med tillåtelse37. Klicka här för att se en större version av denna siffra.

Primer namn Sekvens Mål Storlek
Pfk2_Fwd GTGTTAAGGGTTCACATGTCG PFK2 S. cerevisiae 133 bp
Pfk2_Rev CTTCCAACCAAATGGTCAGC PFK2 S. cerevisiae 133 bp
Pfk1_Fwd GGTGATTCTCCAGGTATGAATG PFK1 S. cerevisiae 97 bp
Pfk1_Rev CTTCGTAACCTTCGTAAACAGC PFK1 S. cerevisiae 97 bp
Act1_Fwd GTCTGGATTGGTGGTTCTATC ÄRV1 S. cerevisiae 85 bp
Act1_Rev GGACCACTTTCGTCGTATTC ÄRV1 S. cerevisiae 85 bp
Dnm1_Fwd CTGTGTTCGATGCATCAGAC DNM1 S. cerevisiae 156 bp
Dnm1_Rev CGCACTCCAATTCTTCTCTC DNM1 S. cerevisiae 156 bp
Rps20_Fwd CGCTGAACAACACAACTTGG RPS20 S. cerevisiae 228 bp
Rps20_Rev GGAAGCAACAACAACTTCGAC RPS20 S. cerevisiae 228 bp
Cep1_Fwd CGATGAAGAGAAGTCGCTGT CEP-1 C. elegans 110 bp
Cep1_Rev ATCTGGGAACTTTTGCTTCG CEP-1 C. elegans 110 bp
Pgk1_Fwd GCGATATTTATGTCAATGATGCTTTC PGK-1 C. elegans 74 bp
Pgk1_Rev TGAGTGCTCGACTCCAACCA PGK-1 C. elegans 74 bp
Mpk1_Fwd TGCTCAGTAATCGGCCATTG MPK-1 C. elegans 74 bp
Mpk1_Rev TCCAACAACTGCCAAAATCAAA MPK-1 C. elegans 74 bp
p27_Fwd TTTAAAAATACATATCGCTGACTTCATGG M27 H. sapiens 212 bp
p27_Rev CAAAGTTTATGTGCTACATAAAAGGTAAAAA M27 H. sapiens 212 bp
Luc_Fwd AATGGCTCATATCGCTCCTGGAT Luciferas P. pγralis 117 bp
Luc_Rev TGGACGATGGCCTTGATCTTGTCT Luciferas P. pγralis 117 bp
Β-TUBULIN_Fwd CTGAACCACCTTGTCTCAGC Β-TUBULIN H. sapiens 136 bp
Β-TUBULIN_Rev AGCCAGGCATAAAGAAATGG Β-TUBULIN H. sapiens 136 bp
PFK2-1 ASO AAUAGAAAGUGUAAUAAAAGGUCAU 3' UTR PFK2 S. cerevisiae -
PFK2-2 ASO GUUUCAUGGGGUAGUACUUGU 3' UTR PFK2 S. cerevisiae -
PFK2-4 ASO CUUGAAGAGGAGCGUUCAUA ORF PFK2 S. cerevisiae -
DNM1 ASO UCGGUCAGUGGAGGUUCAGCGUUU ORF DNM1 S. cerevisiae -
RPS20 ASO GUCGGUAAUAGCCUUCUCAUUCUUG ORF RPS20 S. cerevisiae -
CEP-1 ASO GUGAGAAAUGCGGUGCUUUGAAA 3' UTR cep-1 C. elegans -
M27 ASO UCAUACCCCGCUCCACGUCAGUU 3' UTR M27 H. sapiens -

Tabell 1. Oligonukleotid sekvenser. Lista över PCR primers och ASOs används i detta arbete, primer sekvens, gen mål och förväntade fragment storlek efter förstärkning.

Discussion

RESA tillåter analys av proteiner bunden till specifika mRNA i vivo med biokemiska metoder. Medan vi har använt metoden för att validera särskilt RBPs interaktion med mRNA mål från olika organismer/celler, kan resa också vara tillämplig att studera andra typer av poly(A) RNAs, såsom cytoplasmiska lång ncRNAs. Systematisk analys av bundna proteiner eller RNAs med MS eller RNA-sekvensering kan dessutom uppnås en upp-skalning av förfarandet. I detta avseende indikerar våra preliminära data att 1 L av jäst kulturer och minst 100 miljoner av mänskliga HEK293 celler skulle kunna ge tillräcklig utgångsmaterial för att erhålla tillförlitliga MS data för väl uttryckta mRNA (opublicerade resultat).

Protokollet beskrivs resa inkluderar bestrålning av celler med UV-ljus vid 254 nm till crosslink RNA-protein interaktioner. Detta möjliggör genomförandet av stränga tvätta villkor under reningen. Även inte uttryckligen testas, vill vi dock notera att crosslinking är valfritt och aktiva RNPs kan också återvinnas med fysiologiska buffertar. Dock i detta fall bör potentiella omflyttningen av proteiner och eller RNAs på målet RNA i lysates beaktas. Omvänt, om UV eller andra crosslinking förfaranden tillämpas (t.ex., formaldehyd), integriteten hos RNA bör utvärderas som RNA nedbrytning kan leda till minskade mRNPs. Dessutom UV-crosslinking är ganska ineffektiva (~ 5%) och ännu mindre för proteiner interagerar med dubbelsträngat RNA, som kunde införa bias för detektion av vissa klasser av RBPs12. Slutligen, UV-bestrålning kan också inducera protein-protein och protein-DNA antipyridinantikropp som bör övervägas för data tolkning45,46. Därför kan alternativa crosslinking förfaranden, till exempel med formaldehyd, också vara av särskilt intresse att fånga större protein aggregat på mRNA.

En viktig del av resan är den två-stegs ASO-baserade rening förfarande att återvinna särskilt RNAs, därigenom öka selektiviteten och minskar sannolikheten för samtidig renande föroreningar. Exempelvis avser ett bekymmer att lägga biotinylerade ASOs direkt till cell extrakt, vilket kan leda till samtidig rening av biotin-bindande proteiner. Detta är kringgås i resa genom att genomföra en första omgång av rening av poly(A) RNAs använder kovalent kopplat oligo-(dT)25 magnetiska pärlor, vilket möjliggör stränga rening villkor som gjort för RNA-protein interactome fånga. Dessutom poly(A) RNA urval tar bort mycket rikliga ncRNAs, såsom ribosomalt RNA och tRNAs, och därför minskar komplexiteten i provet och potentiella källor för cross-hybridisering och kontaminering. I det andra steget, särskilt mRNA återvinns med biotinylerade och modifierade ASOs som glödga med regioner på mRNA mål. Alternativt, modifierade ASOs kunde också direkt kovalent bifogas magnetiska pärlor via en amine-linker, minska benägenheten att fånga biotin bindande proteiner. Men vår erfarenhet inkubering av poly(A) RNA andelen med ASOs före tillsats av streptividin pärlor återhämtade sig mRNPs mer effektivt än direkta tillsats av ASO-kopplade pärlor. Möjligen, gratis oligos kinetiskt gynnas bättre tillgång till sekvenser i strukturerade RNA jämfört med immobiliserade oligos. Därför kovalent kopplingen av ASOs till pärlor innan inkubering med provet kan vara skadliga för återvinning av RNA målet och har testas empiriskt.

En nackdel med ASO baserade metoder är ineffektiv uppbörd av vissa mål mRNA. Vi rekommenderar därför utvärdering av flera ASOs som glödga till olika regioner i avskriften. Specifikt, föreslår vi att utformningen av 2-3 ASOs som glödga med sekvenser i den 3'-UTR eller CDS av mRNA av intresse. Varje ASO kan uppvisa en annan effektivitet för återvinning av respektive mRNA målet och bör vara empiriskt testade (figur 2A, B, data som inte visas). I slutet hittade vi att ASOs glödgning till de 3' utr presterade bättre jämfört med de glödgning till CD-skivor. Detta kan bero på ökad tillgänglighet av bindande platser i utr på grund av avsaknad av översätta ribosomer, medan ribosomer kan hindra effektiv hybridisering inom CD-skivor. Vi upplevde också att kombinationen av flera ASOs kan leda till ökad förorening från rikliga målarter mRNA och minskad nedrullningsbara effektivitet. I alla fall den valda oligos selektivitet kan styras av konkurrensen experiment (t.ex., tillägg av konkurrerande oligos).

Ytterligare bekymmer gäller potentiella cross-hybridisering med orelaterade RNAs, som vi har påpekat att även partiell hybridisering med andra mRNA kan leda till återkrav av det mRNA (figur 2 c). För att bedöma lämpligheten hos de designade ASOs, därför rekommenderar vi utför inledande in vitro- tester med totala RNAs att optimera salt koncentrationerna och tvättemperatur buffertar. I våra händer, tvättning av streptividin-kopplade magnetiska pärlor i buffertar som innehåller 150 mM NaCl vid 55 ° C presterade bäst, men vi rekommenderar oberoende tester av villkoren för varje utformad ASO. Anmärkningsvärd, Vi hittade att alla ASOs valt från in vitro försök (figur 2D) var lämpliga för att fånga respektive mRNA målet från tvärbundna cell extrakt (figur 3), ytterligare styrker giltigheten av i vitro testning. Förutom att utforma lämpliga ASOs för mRNA capture, skulle kunna ytterligare faktorer inverka på selektivitet. Omfattande blockerande förfaranden med BSA och/eller tRNA enligt bead typ specifikationerna kan därför förhindra ospecifik bindning till pärlor. För att ytterligare minska ospecifika upptaget av proteiner, rekommenderar vi också användningen av Lo-bind rör, speciellt när man arbetar med låga mängder prover.

Allmänt, resa kan komplettera tidigare etablerade metoder för att fånga RNAs med ASOs. Till exempel, var den icke-kodande RNA Xist isolerade med bundna proteiner från kärntekniska extrakt härrör från 200-800 miljoner UV tvärbundna celler med hjälp av en matris med lång (90-mer) biotinylerade DNA oligonukleotider som täckte hela avskriften 34,35. Men metoden valt kakel kan bli problematiskt mot bakgrund av den stora potentialen för cross-hybridisering med orelaterade RNAs, och det kan inte användas för att markera specifika avskrift, t.ex., alternativt skarvas former. Nyligen, utformade särskilt låst nukleinsyra (LNA) eller DNA ASO mixmers fästes kovalent till en magnetisk harts återställa in vitro- avskrift eller starkt uttryckt ribosomalt RNA från cellfria extrakt; Det testades dock inte för återhämtning i vivo bildade mRNA-protein komplex36. Mot bakgrund av ökad erkännande av post-transcriptional gen kontroll av RBPs och ncRNA anser vi att resa är en användbar metod att undersöka sammansättning och dynamiken i RNP komplex inom celler vid intracellulära och miljömässiga cues och dess inverkan vid hälsa och sjukdom.

Disclosures

Författarna har något att avslöja.

Acknowledgments

Vi är tacksamma att Dr Jonathan Hall och Mauro Zimmermann (ETH Zurich) för syntesen av PFK2 och cep-1 ASOs, Dr Maikel Wouters för utformningen av M27/CDKN1B ASOs och Dr Rafal Ciosk (Friedrich Miescher Institutet för biomedicinsk forskning, Basel) för anti-GLD-1 antikroppar. Detta arbete stöddes av bioteknik och biologiska Sciences Research Council (BB/K009303/1) och en Royal Society Wolfson forskning Merit Award (WM170036) till A.P.G.

Materials

Name Company Catalog Number Comments
MaxQ 5000 Large Incubated and Refrigerated Orbital Shaker Thermo Fisher Scientific SHKE5000-8CE Floor shaker to grow yeast cells
BBD 6220 Thermo Fisher Scientific CO2 incubator to grow human cells
Sonicator Soniprep150 MSE MSS150.CX4.5 Sonicator/cell disruptor. Used to shear DNA in human cell lysates
Stratalinker 1800 Stratagene Stratalinker to expose cells to UV light at 254 nm
Tissue Lyser Qiagen RETSCH MM200 Device to mechanically disrupt yeast cells
Refrigerated Centrifuge Eppendorf 5810R Centrifuge to spin down cells, lysates
Shaking incubator, Thriller Peqlab Thermoshaker for 1.5 mL tubes
Glass beads 0.5mm Stratech Scientific Limited 11079105 Lysis of yeast cells
Nylon Filter, 0.41 μm Millipore NY4104700 Collection of yeast cells
Millex-HA Filter, 0.45 µm EMD Millipore SLHA02510 Filter to clear nematode lysate
Eppendorf LoBind microcentrifuge tubes Protein 1.5 mL Sigma-Aldrich 22431081 Minimise protein loss
2 mL microfuge tube Ambion AM12425 Yeast extract preparation and other applications
5 mL tube Thermo Fisher Scientific 129A Collection of HEK293 cell lysate
15 mL tube Sarstedt 62.547.254 Collection C. elegans
50 mL plastic tube Sarstedt 62.554.502 Collection yeast cells
DMEM, high glucose, pyruvate Thermo Fisher Scientific 41966 Media for culturing HEK293 cells
Penicillin-Streptomycin Sigma-Aldrich P4333 Used to supplement cell culture media to control bacterial contamination
Fetal Bovine Serum (FBS) Sigma-Aldrich F7524 Used to supplement cell culture media
Lipofectamine 2000 Thermo Fisher Scientific 11668027 Transfection reagent
RQ1 RNase-Free DNase Promega M6101 DNAse I to degrade DNA from cell lysate
RNasin Plus RNase Inhibitor Promega N2611 RNase inhibitor to avoid RNA degradation
cOmplete, Mini, EDTA-free Protease Inhibitor Cocktail Roche 11836170001 Protease inhibitor cocktail to avoid protein degradation
Dynabeads Oligo (dT)25 Thermo Fisher Scientific 61011 Magnetic beads required for the first step of mRNA-protein complex purification
Dynabeads M-280 Streptavidin Thermo Fisher Scientific 11205D Magnetic beads required for the second step of mRNA-protein complex purification
E. coli tRNA Sigma-Aldrich 10109550001 transfer RNA from E. coli used for blocking streptavidin beads and avoid unsepecific interactions
Quick Start Bradford 1x Dye Reagent BioRad 5000205 To determine protein concentration within lysates, using BSA as reference
Bovine Serum Albumin Sigma A7906-100G Used to perform the standard curve that will be used as reference for protein concentration determination
mouse anti-Act1 MP Biomedicals 869100 Antibody for detection of yeast actin in Western blot (1:2,500)
mouse anti-Act1 Sigma A1978 Antibody for detection of human actin in Western blot (1:2,000)
mouse anti-HuR Santa Cruz sc-5261 Antibody for detection of HuR in Western blot (1:500)
mouse anti–CYC-1 Invitrogen 456100 Antibody for detection of Cyc-1 in Western blot (1:1,000)
peroxidase anti-peroxidase soluble complex Sigma P1291 Detection of Pfk2:TAP in Western blot (1:5,000)
HRP-conjugated sheep anti-mouse IgG Amersham NXA931 HRP-coupled secondary antibody

DOWNLOAD MATERIALS LIST

References

  1. Mitchell, S. F., Parker, R. Principles and properties of eukaryotic mRNPs. Molecular Cell. 54, (4), 547-558 (2014).
  2. Iadevaia, V., Gerber, A. P. Combinatorial Control of mRNA Fates by RNA-Binding Proteins and Non-Coding RNAs. Biomolecules. 5, (4), 2207-2222 (2015).
  3. McHugh, C. A., Russell, P., Guttman, M. Methods for comprehensive experimental identification of RNA-protein interactions. Genome Biology. 15, (1), 203 (2014).
  4. Matia-González, A. M., Gerber, A. P. Ch. 14. Fungal RNA Biology. Sesma, A., von der Haar, T. Springer. 347-370 (2014).
  5. Tsvetanova, N. G., Klass, D. M., Salzman, J., Brown, P. O. Proteome-wide search reveals unexpected RNA-binding proteins in Saccharomyces cerevisiae. PLoS One. 5, (9), (2010).
  6. Castello, A., et al. Insights into RNA biology from an atlas of mammalian mRNA-binding proteins. Cell. 149, (6), 1393-1406 (2012).
  7. Baltz, A. G., et al. The mRNA-bound proteome and its global occupancy profile on protein-coding transcripts. Molecular Cell. 46, (5), 674-690 (2012).
  8. Castello, A., et al. System-wide identification of RNA-binding proteins by interactome capture. Nature Protocols. 8, (3), 491-500 (2013).
  9. Liao, Y., et al. The Cardiomyocyte RNA-Binding Proteome: Links to Intermediary Metabolism and Heart Disease. Cell Reports. 16, (5), 1456-1469 (2016).
  10. Liepelt, A., et al. Identification of RNA-binding Proteins in Macrophages by Interactome Capture. Molecular Cell Proteomics. 15, (8), 2699-2714 (2016).
  11. Conrad, T., et al. Serial interactome capture of the human cell nucleus. Nature Communications. 7, 11212 (2016).
  12. Matia-Gonzalez, A. M., Laing, E. E., Gerber, A. P. Conserved mRNA-binding proteomes in eukaryotic organisms. Nature Structural and Molecular Biology. 22, (12), 1027-1033 (2015).
  13. Mitchell, S. F., Jain, S., She, M., Parker, R. Global analysis of yeast mRNPs. Nature Structural and Molecular Biology. 20, (1), 127-133 (2013).
  14. Beckmann, B. M., et al. The RNA-binding proteomes from yeast to man harbour conserved enigmRBPs. Nature Communications. 6, 10127 (2015).
  15. Wessels, H. H., et al. The mRNA-bound proteome of the early fly embryo. Genome Research. 26, (7), 1000-1009 (2016).
  16. Sysoev, V. O., et al. Global changes of the RNA-bound proteome during the maternal-to-zygotic transition in Drosophila. Nature Communications. 7, 12128 (2016).
  17. Despic, V., et al. Dynamic RNA-protein interactions underlie the zebrafish maternal-to-zygotic transition. Genome Research. 27, (7), 1184-1194 (2017).
  18. Zhang, Z., et al. UV crosslinked mRNA-binding proteins captured from leaf mesophyll protoplasts. Plant Methods. 12, 42 (2016).
  19. Reichel, M., et al. In Planta Determination of the mRNA-Binding Proteome of Arabidopsis Etiolated Seedlings. Plant Cell. 28, (10), 2435-2452 (2016).
  20. Koster, T., Marondedze, C., Meyer, K., Staiger, D. RNA-Binding Proteins Revisited - The Emerging Arabidopsis mRNA Interactome. Trends Plant Sciences. 22, (6), 512-526 (2017).
  21. Hamasaki, K., Killian, J., Cho, J., Rando, R. R. Minimal RNA constructs that specifically bind aminoglycoside antibiotics with high affinities. Biochemistry. 37, (2), 656-663 (1998).
  22. Bachler, M., Schroeder, R., von Ahsen, U. StreptoTag: a novel method for the isolation of RNA-binding proteins. RNA. 5, (11), 1509-1516 (1999).
  23. Vazquez-Pianzola, P., Urlaub, H., Rivera-Pomar, R. Proteomic analysis of reaper 5' untranslated region-interacting factors isolated by tobramycin affinity-selection reveals a role for La antigen in reaper mRNA translation. Proteomics. 5, (6), 1645-1655 (2005).
  24. Hartmuth, K., Vornlocher, H. P., Luhrmann, R. Tobramycin affinity tag purification of spliceosomes. Methods Molecular Biology. 257, 47-64 (2004).
  25. Beach, D. L., Keene, J. D. Ribotrap : targeted purification of RNA-specific RNPs from cell lysates through immunoaffinity precipitation to identify regulatory proteins and RNAs. Methods Molecular Biology. 419, 69-91 (2008).
  26. Slobodin, B., Gerst, J. E. A novel mRNA affinity purification technique for the identification of interacting proteins and transcripts in ribonucleoprotein complexes. RNA. 16, (11), 2277-2290 (2010).
  27. Slobodin, B., Gerst, J. E. RaPID: an aptamer-based mRNA affinity purification technique for the identification of RNA and protein factors present in ribonucleoprotein complexes. Methods Molecular Biology. 714, 387-406 (2011).
  28. Yoon, J. H., Gorospe, M. Identification of mRNA-Interacting Factors by MS2-TRAP (MS2-Tagged RNA Affinity Purification). Methods Molecular Biology. 1421, 15-22 (2016).
  29. Leppek, K., Stoecklin, G. An optimized streptavidin-binding RNA aptamer for purification of ribonucleoprotein complexes identifies novel ARE-binding proteins. Nucleic Acids Research. 42, (2), 13 (2014).
  30. Blencowe, B. J., Sproat, B. S., Ryder, U., Barabino, S., Lamond, A. I. Antisense probing of the human U4/U6 snRNP with biotinylated 2'-OMe RNA oligonucleotides. Cell. 59, (3), 531-539 (1989).
  31. Lingner, J., Cech, T. R. Purification of telomerase from Euplotes aediculatus: requirement of a primer 3' overhang. Proceedings of the National Academy of Sciences U S A. 93, (20), 10712-10717 (1996).
  32. Upadhyay, A., Dixit, U., Manvar, D., Chaturvedi, N., Pandey, V. N. Affinity capture and identification of host cell factors associated with hepatitis C virus (+) strand subgenomic RNA. Molecular Cell Proteomics. 12, (6), 1539-1552 (2013).
  33. Imig, J., et al. miR-CLIP capture of a miRNA targetome uncovers a lincRNA H19-miR-106a interaction. Nature Chemical Biology. 11, (2), 107-114 (2015).
  34. Chu, C., et al. Systematic discovery of Xist RNA binding proteins. Cell. 161, (2), 404-416 (2015).
  35. McHugh, C. A., et al. The Xist lncRNA interacts directly with SHARP to silence transcription through HDAC3. Nature. 521, (7551), 232-236 (2015).
  36. Rogell, B., et al. Specific RNP capture with antisense LNA/DNA mixmers. RNA. 23, (8), 1290-1302 (2017).
  37. Matia-Gonzalez, A. M., Iadevaia, V., Gerber, A. P. A versatile tandem RNA isolation procedure to capture in vivo formed mRNA-protein complexes. Methods. 93-100 (2017).
  38. Gruber, A. R., Lorenz, R., Bernhart, S. H., Neubock, R., Hofacker, I. L. The Vienna RNA websuite. Nucleic Acids Research. 36, (Web Server issue), Available from: http://rna.tbi.univie.ac.at/cgi-bin/RNAWebSuite/RNAfold.cgi W70-W74 (2008).
  39. Kalendar, R., Khassenov, B., Ramankulov, Y., Samuilova, O., Ivanov, K. I. FastPCR: An in silico tool for fast primer and probe design and advanced sequence analysis. Genomics. 109, (3-4), Available from: http://primerdigital.com/tools/PrimerAnalyser.html 312-319 (2017).
  40. Altschul, S. F., Gish, W., Miller, W., Myers, E. W., Lipman, D. J. Basic local alignment search tool. Journal of Molecular Biology. 215, (3), 403-410 (1990).
  41. Stiernagle, T. Maintenance of C. elegans. WormBook. 1-11 (2006).
  42. Kedde, M., et al. A Pumilio-induced RNA structure switch in p27-3' UTR controls miR-221 and miR-222 accessibility. Nature Cell Biology. 12, (10), 1014-1020 (2010).
  43. Schumacher, B., et al. Translational repression of C. elegans p53 by GLD-1 regulates DNA damage-induced apoptosis. Cell. 120, (3), 357-368 (2005).
  44. Ziegeler, G., et al. Embryonic lethal abnormal vision-like HuR-dependent mRNA stability regulates post-transcriptional expression of cyclin-dependent kinase inhibitor p27Kip1. Journal of Biological Chemistry. 285, (20), 15408-15419 (2010).
  45. Itri, F., et al. Femtosecond UV-laser pulses to unveil protein-protein interactions in living cells. Cellular and Molecular Life Sciences. 73, (3), 637-648 (2016).
  46. Zhang, L., Zhang, K., Prandl, R., Schoffl, F. Detecting DNA-binding of proteins in vivo by UV-crosslinking and immunoprecipitation. Biochemical and Biophysical Research Communications. 322, (3), 705-711 (2004).
En oligonukleotid-baserade Tandem RNA isolering förfarande att återställa eukaryota mRNA-proteinkomplex
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Iadevaia, V., Matia-González, A. M., Gerber, A. P. An Oligonucleotide-based Tandem RNA Isolation Procedure to Recover Eukaryotic mRNA-Protein Complexes. J. Vis. Exp. (138), e58223, doi:10.3791/58223 (2018).More

Iadevaia, V., Matia-González, A. M., Gerber, A. P. An Oligonucleotide-based Tandem RNA Isolation Procedure to Recover Eukaryotic mRNA-Protein Complexes. J. Vis. Exp. (138), e58223, doi:10.3791/58223 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter