Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Immunology and Infection

Arboviren Infektionen als Screening-Tools für die Identifizierung von viralen Immunmodulatoren und Host antiviralen Faktoren

doi: 10.3791/58244 Published: September 13, 2018

Summary

Hier präsentieren wir Ihnen die Protokolle, um 1) Virus-codierte Immunmodulatoren zu identifizieren, die Förderung von Arboviren Replikation und (2) Eukaryotische Host Faktoren, die Arboviren Replikation zu beschränken. Diese Fluoreszenz und Lumineszenz-basierten Methoden können Forscher schnell quantitative Ablesung von Arboviren Replikation in einfachen Tests mit geringen Signal-Rausch-Verhältnis zu erhalten.

Abstract

RNA - Interferenz und Genom Bearbeitung-basierten screening-Plattformen haben weit verbreitet, Host Zelle Faktoren identifizieren, die Replikation des Virus zu beschränken. Jedoch sind diese Bildschirme in der Regel in Zellen durchgeführt, die natürlich permissive auf die virale Erreger untersucht werden. Daher kann die robuste Replikation von Viren bei Kontrolle den Dynamikbereich der beiden Bildschirme beschränken. Darüber hinaus können diese Bildschirme möglicherweise nicht zelluläre Abwehr Wege leicht zu identifizieren, die Replikation des Virus zu beschränken, wenn das Virus gut angepasst, um den Host und in der Lage, die Bekämpfung der antiviralen Abwehr ist. In diesem Artikel beschreiben wir ein neues Paradigma für die Erkundung von Virus-Wirt Interaktionen durch den Einsatz von Bildschirmen, die Mitte auf natürlich abortive Infektionen durch Arboviren z. B. vesikuläre Stomatitis Virus (VSV). Trotz der Möglichkeit des VSV, in einer Vielzahl von Dipteren Insekten und Säugetieren Hosts zu replizieren erfährt VSV eine Post-Eintrag, abortive Infektion in einer Vielzahl von Zelllinien aus Lepidoptera Insekten, wie z. B. der Schwammspinner (Lymantria dispar). Jedoch können diese abortiven VSV-Infektionen "gerettet werden" beim Wirt Zelle antiviralen Abwehr beeinträchtigt werden. Wir beschreiben, wie VSV Codierung bequem Reporter-Gene und restriktive L. Dispar Stämme Zelllinien können kombiniert werden, um Setup-Bildschirme, Host Faktoren beteiligt Arboviren Einschränkung zu identifizieren. Darüber hinaus zeigen wir auch die Nützlichkeit dieser Screening-Tools bei der Identifizierung von Viral codierten Faktoren, die VSV-Replikation während Coinfection oder durch ektopische Expression, einschließlich derer von Säugetieren Viren kodiert zu retten. Die natürliche Einschränkung der VSV-Replikation in L. Dispar Zellen bietet ein hohes Signal-Rausch-Verhältnis beim screening für die Bedingungen, die Förderung der VSV Rettung, so dass die Verwendung von simpel Lumineszenz und Fluoreszenz-basierende Assays zu überwachen die Änderungen in der VSV-Replikation. Diese Methoden sind wertvoll für das Zusammenspiel zwischen Host antivirale Reaktionen und viral immune Evasion Faktoren zu verstehen.

Introduction

Die Fähigkeit eines Virus, produktiv in einem bestimmten Host replizieren wird teilweise durch die Verfügbarkeit von Host Cell Faktoren geregelt, die virale Eintrag und Replikation1unterstützen. Virus-Wirtsspektrums kann auch durch die Kapazität eines Virus zu zellulären antiviralen Abwehr Zähler diktiert werden, die virale Replikation2,3sonst behindern würde. Es ist das Ergebnis dieser komplexen Virus-Wirt Interaktionen, die letztlich entscheiden, ob ein Virus in der Lage, seinen Lebenszyklus in einem bestimmten Host zu vervollständigen. Angesichts der potenziell pathogenen Folgen für den Host, wenn virale Replikation erfolgt, ist es wichtig, um unser Verständnis der wichtigsten Virus-Wirt Interaktionen zu fördern, das Zünglein an der Waage zwischen erfolglosen und produktive können experimentelle Strategien zu entwickeln Infektionen. Aufklärung der molekularen Merkmale der Virus-Wirt Zusammenspiel werden maßgeblich an der Entwicklung neuer und alternativer antivirale therapeutischer Strategien.

Mit dem Aufkommen der RNA-Interferenz (RNAi)4,5 und Genom-editing-Tools (zB., CRISPR-Cas9, Zink-finger-Nukleasen, TALENs)6,7, geworden es experimentell möglich, Ändern der Ausdruck der zellulären Faktoren auf genomweite skaliert und erkunden Sie die Auswirkungen dieser Veränderungen auf die Virusreplikation. In der Tat, wurden zahlreiche RNAi und Genom-Bearbeitung-basierte Bildschirme in Wirbellosen und Wirbeltieren Host Zelltypen durchgeführt, die neue Facetten von Virus-Wirt Interaktionen8,9,10, enthüllt haben 11 , 12. diese Bildschirme beschäftigen in der Regel Viren Reporter, wie Glühwürmchen Luciferase (LUC) oder fluoreszierende Proteine kodieren (zB., GLP, DsRed), vorsehen, dass bequeme Mittel zur Bewertung der quantitativ virale Genexpression als einer Anzeige für die Virusreplikation9,12. Diese Strategie erlaubt Forschern, Host Faktoren zu identifizieren, die entweder zu fördern oder Virusreplikation antagonisieren ausweislich erhöht oder verringert, bzw., in virale Reporter9,12 Signale. Allerdings wurden in der überwiegenden Mehrheit der Fälle diese Bildschirme durchgeführt mit Viren, die gut angepasst, um den Host-Zelle-Typ sind, in denen sie untersucht werden. Während diese Strategie wichtig für das Verständnis der coevolutionary Beziehungen zwischen viraler Krankheitserreger und ihre natürlichen Wirte sein kann, stellt es grundsätzliche Bedenken in Bezug auf ihre Verwendung in Aufdeckung Host antiviralen Faktoren dar. In diesen Fällen eine Erweiterung in Virus Reporter signal auf RNAi Zuschlag gesucht wird oder die Inaktivierung eines zellulären Faktors, die normalerweise Virusreplikation behindert. Zuerst, wenn ein Virus bereits kräftig in der Wirtszelle untersucht unter Kontrolle Bedingungen zu replizieren, möglicherweise der dynamische Bereich des Bildschirms (d.h., die Fähigkeit zur Unterscheidung zwischen Hintergrund und verbesserte virale Reporter Signale) beschränkt. Zweitens ist dieses Problem noch durch die Situationen verschärft, in denen das Virus ist gut angepasst an die Wirtszelle und effektiv bei der Bekämpfung von Host Verteidigung Bahnen, die auf dem Bildschirm abgezielt werden.

Aufgrund der oben genannten Bedenken hinsichtlich traditioneller Virus-Wirt-Interaktion screening-Verfahren entwickelten wir ein neues Paradigma für das Studium von Virus-Wirt Interaktionen, die natürlich abortiven Arboviren Infektionen in Lepidoptera Insektenzellen ausnutzen. Diese Strategie ergibt sich aus einer Beobachtung, dass die gut untersuchten menschlichen Arboviren, VSV, eine abortive Infektion in Zellen aus der Schwammspinner (L. dispar)13 erfährt. VSV ist natürlich durch Dipteren Insekten (z.B. Sandfliegen) an Säugetieren Hosts übertragen und wurde experimentell gezeigt, dass eine Vielzahl von Wirbellosen zu infizieren und Wirbeltiere Gastgeber in Zell-Kultur und in-Vivo-14. 11-kb negativen Sinn einsträngige RNA-Genom der VSV kodiert fünf Subgenomic mRNAs, die jeweils in Proteine übersetzt werden, aus denen das behüllte Virion besteht. Allerdings haben VSV reverse genetische Systeme für die Erstellung von Replikation zuständigen Stämme LUC oder fluoreszierende Proteine, zusätzlich zu den fünf natürlichen VSV gen Produkte15,16,17-Codierung erlaubt. Weil diese Reporter Proteine der VSV Virion nicht integriert sind, bieten sie eine bequeme Auslesen für VSV-gen-Expression, die Post-Eintrag auftritt. VSV-Stämme, die GFP oder LUC-Codierung verwenden, haben wir zuvor gezeigt, dass VSV Genexpression bei der Einreise von LD652 Zellen stark eingeschränkt ist, VSV-Titer nicht von 72 Stunden nach der Infektion (Hpi) erhöhen. Im Gegensatz dazu führt Coinfection LD652 Zellen mit VSV und der Säugetier-Poxvirus, Vaccinia Virus (VACV), zu logarithmischen VSV Genexpression und Titer von diesem Zeitpunkt. VACV erfährt frühen Genexpression, DNA-Replikation und späten Genexpression in LD652 Zelle Infektionen, aber der VACV Replikationszyklus ist letztlich gescheiterten aufgrund unvollständiger Virion Morphogenese18. Der große ~ 192-kb-DNA-Genom des VACV kodiert > 200 Proteine, von die viele immunmodulatorische Eigenschaften anzuzeigen, die virale Replikation durch die Unterdrückung der Host Immunantworten19zu fördern. Daher wir die Hypothese aufgestellt, die die "Rettung" der VSV-Replikation in LD652 Zellen durch VACV Coinfection wahrscheinlich durch VACV Immunmodulatoren vermittelt wurde, die L. Dispar Antworten normalerweise einschränken VSV Replikation gehemmt. Zur Unterstützung rettet die Behandlung von LD652 Zellen mit dem Host RNA Polymerase II Inhibitor Actinomycin D auch VSV Replikation in LD652 Zellen, die darauf hinweist, dass die Transkription-abhängigen Host Antworten VSV Replikation nach dem Eintrag13 Block.

Die obigen Beobachtungen legen nahe, dass die natürlich restriktive Charakter der LD652 Zellen, VSV-Infektion einen relativ niedrigen Hintergrund vorsehen, beim screening für die Bedingungen, die Reporter VSV-codierte Signale (d.h.diejenigen, die Host hemmen zu verstärken antiviralen Abwehr). Hier vermitteln wir die Methoden für die Verwendung von Fluoreszenz oder LUC basierende Assays zum Bildschirm für die Bedingungen, die VSV Einschränkung in Lepidoptera Zellen zu entlasten. Zunächst zeigen wir, wie diese Tests verwendet werden können, um Viral codierten immunmodulatorische Faktoren identifizieren, die VSV Einschränkung während der beiden Coinfection Experimente oder durch ektopische Expression von Kandidaten virale Faktoren zu brechen. Als Beispiel zeigen wir, wie wir diese Screening-Techniken verwendet, um Poxvirus-codierte A51R Proteine als eine neue Familie von immunmodulatorische Faktoren zu identifizieren, die VSV-Replikation in Abwesenheit von anderen Poxvirus Faktoren13zu retten. Zweitens zeigen wir, wie RNAi screening in restriktiven VSV-LD652 Zelle Infektionen verwendet werden kann, direkt Arboviren Einschränkung13eukaryotischen Host Faktoren identifizieren.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. allgemeine Lymantria Dispar (LD652) Zelle und Virus-Kultur

  1. LD652 Zelle kultiviert und Beschichtung
    1. Zur Kultur L. Dispar-abgeleitete LD652 Zellen, pflegen eine Monolage von Zellen in einem Wachstumsmedium (Table of Materials) bei 27 ° C unter normaler Atmosphäre inkubiert. Zellen in 10 cm Gewebe-Kultur-behandelten Gerichte zu erhalten und die Zellen beim erreichen von 80 % Konfluenz passage.
    2. Platte, adhärente Zellen der LD652 von der Platte zu vertreiben, durch die Medien immer wieder auf die Monolayer (diese Zellen benötigen keine Trypsinization, verdrängen) pipettieren und die Probe im Wachstumsmedium zu einer ungefähren Dichte von 1 x 105 Zellen/mL verdünnen. Pipette 1 mL verdünnte Kultur/Brunnen von einer 24-Well-Platte. Säen Sie ein Minimum von drei replizieren Brunnen/Behandlungsart für jeden Zeitpunkt (maximal acht Behandlungen/Platte).
    3. Lassen Sie die Zellen für ein Minimum von 1 h zu begleichen.
  2. Vaccinia Virus Vorbereitung
    1. Die Bestände des VACV vorzubereiten, verstärken das Virus in HeLa Zellen20 oder African Green Monkey Niere Zellen (BSC-1 oder BSC-40 Zellen)20,21,22.
      Hinweis: Dehnung VACV Western Reserve (VACV-WR) funktioniert gut in die hier beschriebenen Assays.
    2. Titrieren Sie VACV Belastung über Plaque-Assay auf BSC-1 oder BSC-40 Zellen20,22.
      Hinweis: Alle angegebenen VACV Multiplizität der Infektion (MOI) hier für LD652 beschrieben, die Zelle Infektionen auf Titer von BSC-40 Plaque Tests erhalten basieren.
  3. Vesikuläre Stomatitis Virus Vorbereitung
    1. Zur Vorbereitung der VSV Bestände verstärken Sie das Virus in BHK-Zellen-23.
    2. Titrieren Sie VSV durch Plaque-Assay auf BSC-40 oder BHK Cell Monolayer13,23.
      Hinweis: Alle VSV MOIs beschrieben hier für LD652 Zelle Infektionen auf Titer von BSC-40 Plaque Tests erhalten basieren.

(2) Fluoreszenz basierende VSV Rettung Assay-Co-Infektion mit Live Cell Imaging

  1. Aussaat und Infektion von LD652 Zellen
    1. Platte 40.000 LD652 Zellen/nun ein 8-Well-Kammer.
    2. Verwenden Sie für Fluoreszenz basierende live Cell Imaging, VSV Stämme fluoreszierende Proteine codieren. Die hier vorgestellten Experimente verwenden VSV-DsRed17, eine rekombinante VSV-Sorte, die kostenlose DsRed Protein bringt zum Ausdruck, die nicht an andere VSV-Protein fusioniert ist.
      Hinweis: VSV-Infektion von LD652 Zellen ist nicht zytopathischen von 96 Hpi und so der Zelltod ist keine verwirrende Faktor bei der Bewertung der VSV Replikation innerhalb dieses Zeitrahmens.
    3. Bereiten Sie VSV-DsRed und VACV-FL-GFP vor, in einem serumfreien Medium (SFM; Tabelle der Materialien) bei einer MOI von 1 und 25 beziehungsweise.
      Hinweis: VACV-FL-GFP ist eine rekombinante VACV Sorte, die eine Fusion zwischen LUC und GFP24ausdrückt. Mit Hilfe einer MOI von 25 oder höher für VACV Stämme sorgt dafür, dass alle LD652 Zellen infizierten13sind. Wenn einen anderen coinfecting Virus zu verwenden, müssen die MOI empirisch vom Benutzer bestimmt werden. Jede Infektion Behandlung sollte in doppelte Brunnen eingerichtet und beinhalten Mock-infizierten Behandlungen, in denen die Zellen nur SFM hinzugefügt wird.
    4. Inkubieren Sie die Zellen in 0,2 mL Inokulum für 2 h bei 27 ° c
    5. Waschen Sie die Zellen mit 0,5 mL/auch von Wachstumsmedium.
    6. Inkubieren Sie die Zellen in der Zelle Lebensfähigkeit Farbstoff (Table of Materials) 25 μM im Wachstumsmedium für 45 min bei 27 ° c
    7. Aspirieren Sie die Medien und waschen Sie die Vertiefungen 1 X mit 0,5 mL/gut, überschüssige Farbe zu entfernen.
    8. Pflegen Sie die Zellen in 0,3 mL/auch der Wachstumsmedien.
  2. Leben Zelle Bildaufnahme
    1. Schalten Sie ein confocal Mikroskop 30 min im voraus und laden Sie eine 8-Well-Kammer-Gericht zu.
      Hinweis: LD652 Zellen bei Raumtemperaturen von 20 – 25 ° C abgebildet werden können, aber für optimale Bedingungen sollte die Temperatur des Raumes auf 27 ° c eingestellt werden
    2. Richten Sie die entsprechende Anregung/Emission Einstellungen für jedes fluoreszierenden Marker Protein abgebildet werden, sowie die Phase Kontrast Bildeinstellungen.
    3. Die Laser-Intensität für jeden Kanal.
      Hinweis: Dies kann erfordern, läuft einen Pilotversuch um festzustellen, das Spektrum der fluoreszierenden Signalintensitäten beobachtet in den zeitlichen Verlauf im letzten Versuch verwendet werden.
    4. Mit der 10 X-Objektiv erfassen die Phasenbilder Kontrast und Fluoreszenz von jedem auch jeden 1 – 5 h für die Dauer der Infektion bis zu einem gewünschten Zeitpunkt (zB., 48 – 72 Hpi).
      Hinweis: Es ist wichtig, mehrere Gesichtsfelder in jedes gut, genau zu schätzen, die Infektionsraten in der Kultur zu erfassen.
  3. Bildanalyse
    1. Bildanalyse-Software für die automatisierte Bildanalyse von entsprechenden fluoreszierende Kanäle verwenden (zB., 405 nm, 488 nm, 568 nm).
    2. Um den Prozentsatz der Zellen berechnen, die infiziert sind, teilen Sie die Gesamtzahl der fluoreszierenden Zellen VSV-Infektion anzeigt (z. B.., DsRed-positiven Zellen für VSV-DsRed Infektionen) durch die Gesamtzahl der lebensfähigen Zellen gekennzeichnet durch Zelle Lebensfähigkeit Farbstoff für jedes Sichtfeld über alle Behandlungen.

3. allgemeine Virusinfektion Protokoll für Lumineszenz-basierte VSV-Rescue-Assays in LD652 Zellen

  1. Vorbereitung des Inokulums
    1. 30 min vor der Infektion, tauen die Bestände der VSV-LUC16 (eine rekombinante VSV belasten, dass bringt kostenlose Firefly Luciferase Protein nicht an andere VSV-Protein fusioniert). Wenn für VSV-LUC Rettung während VACV Coinfection prüfen, tauen Sie auch VACV-WR-Virus auf Eis.
      Hinweis: Andere Viren (neben VACV-WR) können während der Coinfection VSV-LUC retten, aber dies muss jeder Benutzer empirisch bestimmt werden.
    2. Bereiten Sie das Inokulum VSV-LUC in das Vorhandensein oder Fehlen des VACV-WR in SFM verdünnen, sodass eine MOI von 10 und 25, bzw. erreicht wird, wenn Sie ein total Inokulum Volumen von 0,2 mL hinzufügen/gut.
  2. Infektion der Zellen
    1. Aspirieren Reife LD652 Medien sorgfältig, um nicht zu stören der Monolage und impfen mit 0,2 mL Virus/gut. Diesmal ist definiert als 0 Hpi. Fügen Sie sterile SFM zusätzliche Brunnen als "Mock-infizierten" Negativkontrolle Behandlungen dienen hinzu.
    2. Inkubieren Sie die Zellen im Inokulum für 2 h bei 27 ° c
    3. 2 HPI Inokulum durch Aspiration entfernen und ersetzen mit 1 mL/sowie LD652 Wachstumsmedien.
    4. Lassen Sie die Infektion 24 / 72 Hpi vorzugehen.

4. Luciferase Assay

  1. Vorbereitung der Zelle lysates
    1. Vorsichtig Aspirieren überstand und fügen Sie 1 mL Dulbeccos Phosphat-gepufferte Kochsalzlösung (DPBS) / gut.
    2. Verwenden den Kolben der eine 1 mL Spritze, kratzen Sie die Zellen in DPBS.
    3. Transfer der Zellen zu einem Microcentrifuge Schlauch und Zentrifuge bei 400 X g für 20 min bei 4 ° C.
    4. Unterdessen bereiten Sie 1 X Verdünnung 5 x Reporter Lyse Puffer (RLB) in sterilen H2O.
    5. Nach der Zentrifugation Aspirieren des DPBS ohne zu stören die Zelle Pellet.
    6. Aufschwemmen jedes Pellet in 150 µL 1 X RLB.
    7. Frost-Tausalz-die Proben 1 x mit einer 5-min Inkubation in einem-80 ° C Gefrierschrank gefolgt von schnellen Tauwetter im Wasserbad Raumtemperatur. Speichern Sie die Lysates bei-80 ° C bis zu analysieren.
  2. Luciferase assay
    1. Die Lysates auf Eis Auftauen.
    2. Pipette 20 μL der in einen Brunnen eine solide schwarz oder weiß 96-Well Mikrotestplatte lysate.
    3. Fügen Sie 100 μL der Luciferase Assay Reagenz in jede Vertiefung.
    4. Messen Sie sofort die Lichtintensität mit einem Luminometer (geeignete Einstellungen für bestimmte Luminometer müssen vom Benutzer empirisch bestimmt werden).
  3. Luciferase Assay Analyse
    1. Normalisieren Sie LU Signale für jede Behandlung, LU Lesungen von Behandlungen (Vertreter Ergebnisse) erhalten. Nach mindestens drei unabhängige Experimente durchgeführt wurden, kann das bedeuten, dass, das jede Behandlung/Kontrollgruppe LU eingeholt, durch entsprechende statistische Tests analysiert werden.

5. Immunoblot

  1. Verwenden Sie Lysates für LUC-Assays für die SDS-PAGE und anschließende Immunoblotting, mit entsprechenden Reagenzien und Instrumentierung extrahiert.

(6) Titer von VSV aus Zellkulturen LD652

  1. Platte LD652 Zellen gemäß Schritt 1.1.
  2. Viral infizieren die Zellen nach Schritt 3.
  3. Zu gewünschten Zeitpunkten sammeln Sie die Überstände in sterilen Mikrozentrifugenröhrchen.
  4. Pellet-die Zellen mit 1.000 X g für 10 min bei 4 ° C und die Überstände auf neue Rohre übertragen.
  5. Die Überstände bei-80 ° C zu speichern oder mit Titration von Plaque-Assay auf BSC-40 Zellen fortfahren.
    Hinweis: Wenn VSV aus LD652 Zellkulturen titrieren, die VACV enthalten, ist es ratsam die BSC-40 Nährmedien innerhalb 2 Hpi zu verhindern, dass VACV restpartikel bilden Plaques auf der BSC-40 Monolagen13100 μg/mL Cytosin Arabinoside (AraC) hinzu. AraC ist ein viraler DNA-Polymerase-Hemmer, der Blöcke VACV DNA-Replikation25 aber hat keinen Einfluss auf die VSV-Replikation.

7. Variationen der Lumineszenz-basierte VSV retten Assays in LD652 Zellen: RNAi und Plasmid Transfection Experimente

  1. Vorbereitung der DsRNA für RNAi-vermittelten Knockdown von viralen oder host-Protokolle
    1. Design-gen-spezifische Primer tailed am 5'-Ende mit T7 promotorsequenz (TAATACGACTCACTATAGGG), entweder Ziel das coinfecting Virus (z.B.VACV) oder L. Dispar mRNA Transkripte von Interesse. Diese Primer sollte ein PCR-Produkt von 400 – 600 bp für effektive RNAi-vermittelten Knockdown produzieren. Siehe Gammon Et al. 13 für Grundierung Sequenzen verwendet unten Knockdown VACV oder L. Dispar Transkripte von DsRNA-vermittelten RNAi in LD652 Zellen.
      Hinweis: L. Dispar mRNA Transkripte von identifiziert werden können veröffentlicht L. Dispar Transkriptom Datenbanken26,27,28.
    2. Erzeugen ein DNA-Vorlage über RT-PCR (cDNA Synthese: 1 Zyklus von 50 ° C für 30 min; PCR: 40 Zyklen von 94 ° C für 15 s, 50 ° C für 30 s und 68 ° C für 45 s).
    3. Reinigen Sie das PCR-Produkt mit einem PCR-Reinigung-Kit.
    4. Die gereinigte PCR-Produkt als Vorlage verwenden, in Vitro transkribieren und reinigen mit einem in-vitro- Transkription und Reinigung Kit DsRNA.
  2. Transfektion von DsRNA oder Plasmid DNA in Zellen LD652
    1. Samen 1 x 105 Zellen/Brunnen von einer 24-Well-Platte und lassen Sie die Zellen, die für mindestens 1 h zu begleichen.
    2. Verdünnen Sie für jedes gut zu transfiziert werden 4 μL Transfection Reagens in 100 μL der SFM. Bis zu 15 min bei Raumtemperatur inkubieren. Dies kann skaliert werden, um ein master-Mix für alle Transfektionen durchgeführt werden zu machen.
    3. Verdünnen Sie bis 1 μg DsRNA oder total Plasmid DNA mit 100 μL der SFM für jedes gut zu transfiziert werden. Bis zu 15 min bei Raumtemperatur inkubieren.
      Hinweis: Wir haben bereits festgestellt, dass eine Transfektion von 1 μg DsRNA/105 LD652 Zellen ausreichend für > 80 % Zuschlag entweder viralen oder host Transkripte13, aber DsRNA Dosen benötigt für experimentelle geändert set-ups/Bedingungen müssen werden Sie empirisch bestimmt.
    4. Transfection Reagens und DsRNA/Plasmid-DNA-Verdünnungen mit einem Verhältnis von 1:1 zu kombinieren (z. B.100 μL der verdünnten DsRNA ist gemischt mit 100 μl verdünnter Transfection Reagens) und 20 min bei Raumtemperatur inkubieren.
    5. Währenddessen waschen Sie die Brunnen mit 1 mL/auch von SFM, und fügen Sie 500 μL der SFM in jede Vertiefung.
    6. Fügen Sie langsam die Transfection Reagens DsRNA (oder Plasmid DNA) Mischung tropfenweise in jede Vertiefung.
    7. Inkubieren Sie die Transfektion Reagenz mit den Zellen für 5 h.
      1. Für RNAi Experimente mit dem Zuschlag von Transkripten kodiert, indem ein coinfecting Virus (z.B.VACV), ersetzen Transfection Reagens nach der Inkubationszeit 5-h Transfektion mit Virus Inokulum mit VSV-LUC (mit oder ohne VACV oder ein weiterer coinfecting Virus) (Schritt 3). Anschließend ersetzen Sie das komplette Wachstum Medien 2 Hpi VSV-LUC mit Virus-Inokulum. LUC-Assays (Schritt 4) können dann auf extrahierten Lysates zu verschiedenen Zeitpunkten zu bestimmen, ob die Knockdown von coinfecting Virus Transkripte zu einem Verlust der VSV-LUC Rettung führt ausgeführt werden.
      2. Ersetzen Sie bei RNAi Experimente mit RNAi L. Dispar Transkripte die Transfektion Mischung mit kompletten Wachstumsmedien und Zuschlag für 24 h vor der Infektion mit VSV-LUC (Schritt 4) ergeben. LUC-Assays (Schritt 4) können dann auf extrahierten Lysates zu verschiedenen Zeitpunkten zu bestimmen, ob die Knockdown von L. Dispar Transkripte VSV-LUC Rettung fördert ausgeführt werden.
      3. Ersetzen Sie für Experimente mit Transfektionen Plasmid Expressionsvektoren auszudrücken Kandidat Immunmodulatoren die Transfection Reagens und Protein-Expression für 24 h vor der Infektion mit VSV-LUC (Schritt 4) ermöglichen. LUC-Assays (Schritt 4) können dann auf extrahierten Lysates zu verschiedenen Zeitpunkten zu bestimmen, ob die Expression von Kandidaten immunmodulatorische Proteinen fördert die VSV-LUC Rettung ausgeführt werden.
        Hinweis: Die Transfektion beschriebenen Bedingungen hier Transfektion Wirkungsgrade von 40 – 60 %131 μg/Brunnen von Plasmid DNA-Ergebnis bei.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Als ein Beispiel für live Cell imaging-Anwendungen VSV Rettung auf VACV Coinfection überwachen, LD652 Zellen waren überzogen in einem 8-Brunnen gekammerten und dann Mock-infizierten oder infizierte VSV-DsRed (MOI = 1) in das Vorhandensein oder Fehlen der VACV-FL-GLP (MOI = 25). Da VSV-DsRed DsRed als freie Protein drückt und nicht, VSV Strukturproteinen (Abbildung 1A fixiert wird), ist es nur erkannt, nachdem VSV-Eintrag und Gen-Ausdruck initiiert. Alle Zellen wurden dann mit Zelle Lebensfähigkeit Farbstoff beschriftet, die frei der Plasmamembran der Zellen durchläuft, wo es zu einem Membran-impermeant Produkt gewandelt wird, die die Beibehaltung der das Fluoreszenzsignal in den markierten Zellen fördert. Bilder erworben wurden alle 5 Std. bis zu 65 Hpi mit der 405 nm, 488 nm, 568 nm und weißen Licht Filter, um die Zelle Lebensfähigkeit Farbstoff, VACV-FL-GFP und VSV-DsRed Phase Kontrast (PC) Kanäle, bzw. zu erfassen. Einzige Infektion Bedingungen beschränken LD652 Zellen VSV-DsRed Replikation; Daher stellen nur eine kleine Anzahl von Zellen ein DsRed Signal. Coinfection des VSV-DsRed mit VACV-FL-GFP führt jedoch in den meisten Zellen anzeigen DsRed Signale bis zum Jahresende den zeitlichen Verlauf (Abbildung 1 b). Bilder, die zu jedem Zeitpunkt einer ausgesetzt waren, Bildanalyse-Software, wo 405 nm und 568 nm Kanal Bilder wurden verwendet, um automatisch insgesamt und Anzahl DsRed-positiven Zellen, bzw. zu ermitteln. Der Anteil der Zellen anzeigen ein DsRed Signal für jede Behandlung errechnet sich durch Division von Objekten (Zellen) mit einem positiven Signal in den 568 nm-Kanal durch die Anzahl der Objekte in der 405 nm-Kanal für jeden Zeitpunkt, gefolgt durch Multiplikation von 100 % identifiziert . Wie aus Abbildung 1hervorgeht, waren ~ 2 % der Zellen aus einzelnen Infektionen VSV-DsRed DsRed-positiv von 65 Hpi. Im Gegensatz dazu waren ~ 77 % der Zellen im VSV-DsRed + VACV-FL-GFP Koinfektionen DsRed-positiv zu diesem Zeitpunkt. Filme-S1 und S2 zeigen den Verlauf der VSV-DsRed Infektion bzw. ganze 65-h Zeit Laufe in einzelne Infektion und Coinfection Bedingungen. Es ist wichtig zu beachten, dass die GFP Expression von VACV-FL-GFP nachweisbar von 10 Hpi vor das DsRed Signal wurde, darauf hinweist, dass ausreichende VACV Genexpression vor dem VSV-DsRed Rettung (nicht dargestellt) erforderlich ist. Gemeinsam, zeigen diese Ergebnisse deutlich eine Rettung der VSV-DsRed Replikation von VACV Coinfection. Wenn ein coinfecting Virus VSV-DsRed retten konnte, würden wir gleich Prozentsätze DsRed-positiven Zellen zwischen einzelnen Infektion und Coinfection Behandlungen erwarten.

VSV-Replikation in LD652 Zellen kann alternativ mit Lumineszenz basierende Assays bei VSV-LUC Stämme (Abbildung 2A) quantifiziert werden. Als Beispiel, Abb. 2 b zeigt die Ergebnisse eines LUC-Assays mit Lysates vorbereitet ein 72 h Zeit Laufe von Mock-infizierte Zellen oder Zellen mit VSV-LUC infiziert (MOI = 10) in das Vorhandensein oder Fehlen des VACV-WR (MOI = 25). Eine positive Rettung der VSV-LUC Replikation wird durch die logarithmische Zunahme der willkürlichen LU mit Lysates zubereitet aus inzwischen Zellen im Vergleich zu Lysaten aus einzelnen VSV-LUC Infektionen erkannt. Ein negatives Ergebnis würde durch den Ausfall von einem Coinfection LU Lesungen von denen in Einzelbehandlungen VSV-LUC Infektion beobachtet verändern in diesem Assay anzugeben. Falls gewünscht, vorbereitete Lysates auch für Immunoblotting, einsetzbar, verbesserte VSV-Genexpression in Coinfection Behandlungen zu bestätigen. Zum Beispiel zeigt Abbildung 2 eine typische Immunoblot Ergebnis für VSV-codierte LUC und Matrix (M) Proteine in Lysates aus Mock, VSV-LUC und VSV-LUC + VACV-WR Behandlungen 72 Hpi vorbereitet. Immunoblotting für VACV I3L Protein diente als Marker des VACV Infektion und Immunoblotting für zelluläre Aktin diente als Steuerelement laden. Die deutliche Verbesserung der VSV-codierte LUC und M-Proteine in der Coinfection Lysates weiter bestätigen VSV Rettung durch VACV. Zu guter Letzt kann produktive VSV-Replikation durch Überstände aus diesen LD652 Zellkulturen zu sammeln und titrieren einer ansteckenden Virus auf BSC-40 Monoschichten (Abb. 2D) bestätigt werden. Dieses Ergebnis zeigt, dass nur während VACV Coinfection VSV produktiv replizieren kann.

Sobald ein coinfecting Virus Rettung VSV Replikation in LD652 Zellen unter Beweis gestellt ist, kann RNAi-Screening zur Faktoren kodiert, indem das coinfecting-Virus zu identifizieren, die VSV Rettung beitragen. In diesem Experiment, Bildschirm für eine RNAi-Bedingung, die einen "Verlust der Rettung" Phänotyp beim VSV-LUC Coinfection mit einem Rettung Virus führt. Wir zuvor identifiziert VACV A51R Protein als VSV Rettung Faktor durch eine RNAi-Screening von Dutzenden von VACV-codierte Transkripte13. Als Beispiel haben wir eine kleinere Version von diesem Bild (Abbildung 3) zusammengefaßt. RNAi ist vermittelt durch Transfektion von in-vitro- DsRNAs, die auf Transkripte, die durch das coinfecting Virus verschlüsselt übertragen. In den hier gezeigten Daten zielten viralen Transkripte VACV A50R, A51R und A52R Proteine codieren für RNAi Knockdown. Als negative Kontrolle für den Verlust der Rettung waren auch Zellen mit DsRNAs Ausrichtung der GFP-Codierung Transkripte transfiziert. Als Positivkontrolle für einen Verlust der Rettung Phänotyp wurden Zellen mit DsRNAs gegen LUC-Codierung Transkripte transfiziert. Diese Behandlung erzeugt einen starken Verlust des LU-Signals während Coinfection und hilft den Forschern, die bestätigen, dass Transfektion/RNAi-Protokollen arbeiten. Nach 5 h DsRNA Transfektion Zellen wurden inzwischen mit VSV-LUC (MOI = 10) und VACV-WR (MOI = 25). Separate Infektionen mit nur VSV-LUC wurden auch durchgeführt, um einen Hintergrund LU Signal festzulegen. Lysates waren dann 72 Hpi geerntet und in einem LUC Assay verwendet. Vergleich des VSV Rettung über DsRNA Behandlungen, die GFP DsRNA Behandlung, die Ergebnisse zeigen, dass die Knockdown von VACV A51R einen starken Verlust der Rettung Phänotyp erzeugt, während der Knockdown von A50R und A52R ein negatives Ergebnis (ohne Verlust der produziert Rettung im Vergleich zu GFP DsRNA).

Als Alternative zur RNAi screening um virale Faktoren zu identifizieren, die VSV Rettung beitragen, overexpress Kandidat virale Faktoren in den LD652 Zellen und dann assay für VSV-LUC Rettung. Dies kann erreicht werden durch Klonen Kandidatengene von Interesse in angemessener Ausdruck Vektoren wie p16629 und transfecting diese Plasmide in LD652 Zellen vor dem VSV-LUC-Herausforderung. Als Beispiel zeigt Abbildung 4A eine Rettungs-Experiment in welche Flagge markiert GFP (FGFP) oder Flagge markiert A51R (FA51R) p166 Vektoren wurden in LD652 Zellen in verschiedenen Konzentrationen, gefolgt von VSV-LUC Infektion transfiziert (MO = 10) 24 h später. Als Negativkontrolle für VSV Rettung zusätzliche Kulturen wurden Mock-transfizierten und erhielten keine Plasmid DNA. Lysates wurden von 72 Hpi Kulturen gesammelt und LUC Tests unterzogen wurden. FA51R Behandlungen produziert ein positives Ergebnis der VSV-Rettung, wie gezeigt durch verbesserte LU Signale über Mock-transfizierten Behandlungen in mehreren Dosen. Im Gegensatz dazu wurden FGFP Behandlungen negativ für VSV Rettung bei jeder Dosis getestet. Immunoblotting von Lysaten aus Abbildung 4A bestätigt einen ähnlichen Ausdruck der FGFP und FA51R Proteine (Abbildung 4 b).

Verwenden eine RNAi-Vorführung des Kandidaten L. dispar Faktoren, wir haben gezeigt, dass die Beschränkung des VSV in LD652 Zellen von verschiedenen zellulären Faktoren Zugehörigkeit zu antiviralen RNAi Wege vermittelt wird (z. B. AGO2 und Dicer-2), die Nuclear Factor Kappa B (NF-κB)-Verwandte IMD Weg (z. B. Relish), und das Ubiquitin-Proteasom-System (zB., Polyubiquitin)13. Als Beispiel haben wir eine kleinere Version dieser RNAi-Experimente mit DsRNAs L. Dispar Transkripte, die VSV-LUC Replikation auf Zuschlag verbessert gezielt wiederholt (zB., AGO2, Dicer-2, Relish, Polyubiquitin) oder hatte keinen Effekt (AGO1 )13. Nach 24 h DsRNA Transfektion wurden Zellen angefochten mit VSV-LUC für 72 h um festzustellen, ob RNAi Behandlungen LU Signale über Negativkontrolle GFP DsRNA Behandlungen erweitert. RNAi-Behandlungen, die LU Signale zu verstärken zeigen, dass der Faktor codiert durch das gezielte Transkript VSV Replikation beschränkt. Als Positivkontrolle für RNAi Knockdown waren DsRNAs targeting LUC-Codierung Transkripte auch in parallele Behandlungen transfiziert. Aufgrund der niedrigen Hintergrund LU meldet in GLP DsRNA Behandlungen, erkannt, es war relativ einfach zu identifizieren, Host-codierte Einschränkung Faktoren mit RNAi-Screening, weil ihre Zuschlag ~ 10 produziert – zu einem 1,000-fold Anstieg LU Signale ( Abbildung 5). Somit ist es möglich, relativ niedrigen Hintergrund Nutzen der VSV-gen-Expression in den LD652 Zellen für Host RNAi Knockdown Bedingungen auf den Bildschirm, die VSV Einschränkung zu lindern.

Figure 1
Abbildung 1: Identifizierung der VSV Rettung durch Virus Coinfection LD652 Zellen mit Fluoreszenz-basierten live Cell Imaging. (A) dieses Panel zeigt eine schematische Darstellung des VSV-DsRed Genom, die DsRed (dR) Gen Position angibt. (B) diese Vertreter 10 X konfokalen Mikroskopie Bilder sind aufgenommene 60 Hpi. 405 nm-Kanal kennzeichnet einen Fleck für lebensfähige Zellen, 488 nm-Kanal zeigt VACV-FL-GFP Infektion und 568 nm Kanal VSV-DsRed Infektion. Phasenbilder Kontrast (PC) werden ebenfalls angezeigt. Skalieren von Balken = 100 µm. (C) dieses Panel zeigt den Prozentsatz der DsRed-Positive LD652 Zellen im gesamten 65 h Infektion Zeit Laufe. Der mittlere (SD) Anteil der Zellen zeigt für jeden Zeitpunkt ein DsRed Signal wird angezeigt. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 2
Abbildung 2: Beurteilung der VSV Rettung in LD652 Zellen mit LUC Assays. (A) dieses Panel zeigt eine schematische Darstellung des VSV-LUC Genom. (B) dieses Panel zeigt willkürlich Leuchteinheiten (LUC) Assays von Lysaten von Mock-infizierte Zellen oder Zellen mit VSV-LUC, in das Fehlen oder Vorhandensein von VACV-WR infiziert. (C) dieses Panel zeigt ein Immunoblot LUC, VSV M, VACV I3L und zelluläre Aktin Proteine in der Lysaten aus Schalttafel A 72 Hpi gesammelt. (D) zeigt dieses Fenster VSV-LUC Titer in Kultur Überstände von Panel Berhalten. Die quantitativen Daten in Feldern B und D repräsentieren die Mittel (± SD) von Experimenten in dreifacher Ausfertigung. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 3
Abbildung 3: Identifizierung eines Viral-codierte VSV Rettung Faktors durch RNAi Screening während der Coinfection LD652 Zellen. Dieses Panel zeigt Falten Änderungen in LU in Lysaten von Zellen 72 Hpi mit VSV-LUC und VACV-WR erkannt, nach der angegebenen RNAi-Behandlung im Vergleich zu LU in Lysates aus Zellen einzeln mit VSV-LUC infiziert erkannt. Die Daten stellen die Mittel (± SD) von Experimenten in dreifacher Ausfertigung. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 4
Abbildung 4: Rettung des VSV durch die Überexpression von einer viralen Immunmodulator in LD652 Zellen. (A) dieses Panel zeigt eine LUC assay von VSV-LUC-infizierten Zellen 72 Hpi, die Mock-transfizierten (Mock) oder mit FGFP oder FA51R p166 Ausdruck Plasmide transfiziert. LU-Signale von jeder Behandlung wurden auf Signale erkannt im Mock-transfizierten Behandlungen normalisiert. Die Daten stellen die Mittel (± SD) von Experimenten in dreifacher Ausfertigung. (B) dieses Panel zeigt Lysates von Panel A, Immunoblotted mit Fahne und Aktin-Antikörper. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 5
Abbildung 5: Identifizierung von Host Faktoren Beschränkung des VSV-Replikation in LD652 Zellen durch RNAi Screening. Dieses Panel zeigt, dass die Falte in LU-Signale im angegebenen RNAi-Behandlungen im Vergleich zu der GFP DsRNA Kontrolle Behandlungen 72 Hpi mit VSV-LUC ändern. Die Daten stellen die Mittel (± SD) von Experimenten in dreifacher Ausfertigung. Bitte klicken Sie hier für eine größere Version dieser Figur.

Film S1: Repräsentative 405 nm (Zelle Lebensfähigkeit Farbstoff) und 568 nm (DsRed) Kanal Bilder über einen zeitlichen Verlauf 65 h (jeden Frame = 5 h Intervall) infectionem VSV-DsRed Zellen LD652. Bitte klicken Sie hier, um diese Datei herunterladen.

Film S2: Repräsentative 405 nm (Zelle Lebensfähigkeit Farbstoff) und 568 nm (DsRed) Kanal Bilder über einen zeitlichen Verlauf 65 h (jeden Frame = 5 h Intervall) nach Coinfection LD652 Zellen mit VSV-DsRed und VACV-FL-GFP. Bitte klicken Sie hier, um diese Datei herunterladen.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Hier haben wir beschrieben, einfache Fluoreszenz und Lumineszenz-basierende Assays für die Bedingungen auf den Bildschirm, das VSV-Replikation in restriktiven Lepidoptera Zellkulturen zu retten. Die abortive Infektion des VSV in Lepidoptera Zellen erstellt ein ausgezeichnetes Signal-Rausch-Verhältnis beim VSV Genexpression zu prüfen. Zum Beispiel die LU-Signale in Lysaten aus einzelnen VSV-LUC Infektionen erkannt wurden ~ 1,000-fold höher als im Mock-infizierten Lysates, doch diese Signale nur etwa zweifach über einen 72-Stunden-Kurs geändert. Im Gegensatz dazu verstärkt Coinfection des VSV-LUC mit VACV LU Signale ~ 300-fold über einzelne VSV-LUC Infektionen durch 72 Hpi. VSV-Rettung-Assays anzeigen so einen ausgezeichneten dynamischen Bereich, umfasst mehrere Größenordnungen.

Die entscheidenden Schritte bei der Einrichtung dieser Tests beinhaltet die Entscheidung, zur Rettung der VSV mit Fluoreszenz oder Lumineszenz-basierten Ansätzen assay. Wir haben Beispiele dafür, wie VSV-codierte DsRed gezeigt, die Signale können quantitativ mit Leben-Zelle bildgebenden Techniken und Software-Pakete, die die automatisierte Quantifizierung der DsRed-positiven Zellen in das Fehlen oder Vorhandensein untersucht werden von einer Rettung zu erleichtern Coinfection. Wenn Forscher Zugriff auf live-Cell-imaging-Funktionen haben, sind diese Tests kostengünstig einrichten und es ihnen ermöglichen, eine breite Palette von Zeitpunkten zu erfassen, die bei der Erkennung der unterschiedlichen VSV Replikation Kinetik helfen kann, die einzige beobachtbare schmal sind Windows. Im Gegensatz dazu Lumineszenz basierende Ansätze sind im wesentlichen Endpunkt-Assays, die die Vorbereitung der Zelle Lysates zu vorgegebenen Zeitpunkten zu erfordern, und lysate Vorbereitung kann sehr zeitaufwendig sein. Auf der anderen Seite die Lumineszenz-based Assays erfordern keine anspruchsvolle Mikroskopie Ausrüstung – nur ein Teller Leser in der Lage, Lumineszenz Signale zu lesen. Lumineszenz-based Assays haben darüber hinaus einen größeren Dynamikbereich als Mikroskopie basierende Assays, die den Prozentsatz der infizierten Zellen berechnen. Zum Beispiel in Mikroskopie-Assays, DsRed-positiven Zellen (d. h. VSV-DsRed Infektion) nur reicht von 0 – 100 % der analysierten Zellen in ein Sichtfeld. Im Gegensatz dazu reichen LU Signale zwischen einzelnen VSV-LUC und Coinfection (oder andere Rettung Bedingungen) über mehrere Größenordnungen.

Ein entscheidender Vorteil der Verwendung der VSV -L. Dispar Zellsystem präsentiert hier zum Bildschirm für Säugetier-Virus-codierte Immunmodulatoren ist, dass es von Natur aus für die Identifizierung von viralen Faktoren, die unterdrücken auswählt, was voraussichtlich konserviert werden und alte sind antivirale Reaktionen, die die Wirbeltier-spezifischen Interferon Antwort zurückdatieren. In der Tat zufolge Vorbemerkungen A51R Proteine konservierte antivirale Ubiquitin-Proteasom-bezogenen zelluläre Reaktionen hemmen (siehe Gammon Et al. 13 und unveröffentlichte Daten). Die Entdeckung des VACV A51R Rettung des VSV war das erste Beispiel einer heterologen Virus Rettung von einem Wirbeltier Virus in einem Wirbellosen Host13, und es ist wahrscheinlich, dass diese Screening-Systeme zusätzliche vertebrate Virus-codierte Immunmodulatoren aufzudecken . Es ist wichtig zu beachten, dass der Schlüssel zur Verwendung VSV Rettung, wie eine Anzeige für Bedingungen, die wirtsimmunität hemmen die VSV-Replikation ist stark eingeschränkt (oder abortive) muss in der Zellentyp, der VSV Replikation in geprüft wird. Die meisten Säugetier-Zelle Arten wahrscheinlich wäre ungeeignet für diese Art von Tests, daher angesichts der Tatsache, dass auch in Säugetierzellen VSV repliziert. Deshalb L. Dispar Zellen dienten hier als ein natürlich restriktive Host Zelltyp für VSV.

Eine vorherige Studie in Drosophila Zellen zeigte, dass virale Unterdrücker der antiviralen RNAi Antworten von Cotransfection der Ausdruck Plasmide Codierung Kandidat RNAi Unterdrücker und eine selbstreplizierende Flock Haus Virus genomische RNA identifiziert werden konnte, GFP anstelle von B2, seine natürliche RNAi Suppressor30kodiert. Die Replikation der Flock Haus genomische RNA und Produktion der GLP war die Unterdrückung der RNAi um den Faktor cotransfected Kandidat abhängig, und damit die Rettung von GFP-Ausdruck angegeben RNAi Unterdrückung30. Unsere unveröffentlichten Arbeit zeigt, dass die Überexpression von Virus-codierte RNAi-Hemmern auch VSV-LUC Genexpression in L. dispar Zellen rettet, was darauf hindeutet, dass dieses System auch verwendet werden kann, Unterdrücker der RNAi Antworten im Zusammenhang mit der Ermittlung Infektion durch eine Bona Fide virale Erreger im Gegensatz zu einem Replicon. In der Tat, die Feststellung, die RNAi, IMD und Ubiquitin-Proteasom-bezogene Pfade zur Beschränkung der VSV-Replikation in L. Dispar Zellen13 beitragen zufolge virale Antagonisten mehrere antivirale Wege durch das VSV identifiziert werden kann Assays, die hier vorgestellten zu retten.

Eine mögliche Einschränkung dieser Screening-Methoden im Hinblick auf die Identifizierung von Host antivirale Proteine ist, dass die L. dispar Genomsequenz noch nicht verfügbar ist. Allerdings gibt es öffentlich zugängliche L. Dispar Transkriptom, die verwendet werden können, um Kandidaten Host Ziele für RNAi Knockdown26,27,28zu identifizieren. Darüber hinaus haben wir bereits gezeigt, dass VSV in Zelllinien aus anderen Schmetterlinge13 beschränkt ist, die haben jetzt eine öffentlich zugängliche Genom (z.B. Manduca Sexta)31. Daher können Zelllinien aus anderen Schmetterlinge mit sequenzierten Genome in das Protokoll hier beschriebenen L. Dispar Zellen ersetzen.

Angesichts der wachsenden wirtschaftlichen und Bedrohung der öffentlichen Gesundheit von Arboviren32, können die hier vorgestellten Screening-Assays bieten neuartige Strategien, um die neuen Features von Arboviren-Wirt Interaktionen zu identifizieren, die bei der Gestaltung der neuen antivirale Wert haben kann Therapeutika. Darüber hinaus wegen relativ begrenzten Verständnis für Lepidoptera Mechanismen zur Einschränkung der RNA-Virus-Replikation, die hier vorgestellten Tools bieten neue Möglichkeiten, um die Host Abwehrmechanismen kodiert, indem diese Sonde wirtschaftlich bedeutenden Ordnung der Insekten.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Die Autoren haben nichts preisgeben.

Acknowledgments

D.G. wurde unterstützt durch die Finanzierung von der University of Texas Southwestern Medical Center ausgestattet Scholars Program. Die Autoren danken Michael Whitt (The University of Tennessee Health Science Center) und Sean Whelan (Harvard Medical School) für die Bereitstellung von VSV-DsRed und VSV-LUC. Die Autoren danken auch Gary Luker (University of Michigan Medical School) für die freundlichen Gabe des VACV-FL-GFP-Stamm.

Materials

Name Company Catalog Number Comments
6-well tissue culture plates CELLTREAT 229106
24-well tissue culture plates CELLTREAT 229124
10 cm tissue culture dishes Corning C430167
Grace’s Insect Medium Sigma G8142
EX-CELL 420 Sigma 14420C
Fetal Bovine Serum - Optima Atlanta Biologicals S12450
Growth medium 1:1 mixture of Grace's Insect Medium and EX-Cell 420 Serum-Free Medium also containing 1% antibiotic-antimycotic solution and 10% Fetal bovine serum
Antibiotic-Antimycotic Solution (100×) Sigma A5955
Dulbecco’s Phosphate Buffered Saline (DPBS) Sigma D8662
Serum Free Media (SFM) Thermo Fisher 10902096
Cytosine arabinoside Sigma C1768
Transfection reagent Thermo Fisher 10362100
Corning cellgro DMSO (Dimethyl Sulfoxide) Corning 25950CQC
Reporter lysis buffer 5x Promega E3971
Luciferase Assay Reagent Promega E1483
96-Well Microplates Corning 3915
Mouse anti-FLAG antibody Wako 014-22383
Rabbit anti-firefly luciferase antibody Abcam ab21176
Mouse anti-actin antibody Sigma A2066
Mouse anti-VSV M N/A N/A Dr. John Connor (Boston University)
Mouse anti-VACV I3L N/A N/A Dr. David Evans (University of Alberta)
8-well Chambered dish Lab-Tek II 155409
Cell viability dye Thermo Fisher C12881
FLUOstar microplate reader BMG Labtech FLUOstar
Confocal microscope Olympus FV10i-LIV
Image analysis software Olympus v1.18 cellSens software
Eppendorf 5702 ventilated centrifuge Eppendorf 22628102
Odyssey Fc Infrared Imaging System Li-COR Biosciences Odyssey Fc
LD652 cells N/A N/A Dr. Basil Arif (Natural Resources Canada)
BSC-40 cells ATCC CRL-2761
BHK cells ATCC CCL-10
HeLa cells ATCC CCL-2
BSC-1 cells ATCC CCL-26
in vitro transcription and purification kit Thermo Fisher AM1626
PCR purification kit Qiagen 28104

DOWNLOAD MATERIALS LIST

References

  1. Nomaguchi, M., Fujita, M., Miyazaki, Y., Adachi, A. Viral tropism. Frontiers in Microbiology. 3, 281 (2012).
  2. Werden, S. J., McFadden, G. The role of cell signaling in poxvirus tropism: the case of the M-T5 host range protein of myxoma virus. Biochimica et Biophysica Acta (BBA) - Bioenergetics. 1784, (1), 228-237 (2008).
  3. McFadden, G., Mohamed, M. R., Rahman, M. M., Bartee, E. Cytokine determinants of viral tropism. Nature Reviews: Immunology. 9, (9), 645-655 (2009).
  4. Silva, J. M., et al. Second-generation shRNA libraries covering the mouse and human genomes. Nature Genetics. 37, (11), 1281-1288 (2005).
  5. Moffat, J., et al. A lentiviral RNAi library for human and mouse genes applied to an arrayed viral high-content screen. Cell. 124, (6), 1283-1298 (2006).
  6. Ma, D., Liu, F. Genome Editing and Its Applications in Model Organisms. Genomics Proteomics Bioinformatics. 13, (6), 336-344 (2015).
  7. Yin, H., Kauffman, K. J., Anderson, D. G. Delivery technologies for genome editing. Nature Reviews: Drug Discovery. 16, (6), 387-399 (2017).
  8. Hao, L., et al. Drosophila RNAi screen identifies host genes important for influenza virus replication. Nature. 454, (7206), 890-893 (2008).
  9. Houzet, L., Jeang, K. T. Genome-wide screening using RNA interference to study host factors in viral replication and pathogenesis. Experimental Biology and Medicine. 236, (8), Maywood, NJ. 962-967 (2011).
  10. Marceau, C. D., et al. Genetic dissection of Flaviviridae host factors through genome-scale CRISPR screens. Nature. 535, (7610), 159-163 (2016).
  11. Savidis, G., et al. Identification of Zika Virus and Dengue Virus Dependency Factors using Functional Genomics. Cell Reports. 16, (1), 232-246 (2016).
  12. Panda, D., Cherry, S. Cell-based genomic screening: elucidating virus-host interactions. Current Opinion in Virology. 2, (6), 784-792 (2012).
  13. Gammon, D. B., et al. A single vertebrate DNA virus protein disarms invertebrate immunity to RNA virus infection. Elife. 3, (2014).
  14. Letchworth, G. J., Rodriguez, L. L., Del cbarrera,, J, Vesicular stomatitis. Veterinary Journal. 157, (3), 239-260 (1999).
  15. Whelan, S. P., Ball, L. A., Barr, J. N., Wertz, G. T. Efficient recovery of infectious vesicular stomatitis virus entirely from cDNA clones. Proceedings of the National Academy of Sciences of the United States of America. 92, (18), 8388-8392 (1995).
  16. Cureton, D. K., Massol, R. H., Saffarian, S., Kirchhausen, T. L., Whelan, S. P. Vesicular stomatitis virus enters cells through vesicles incompletely coated with clathrin that depend upon actin for internalization. PLoS Pathogens. 5, (4), e1000394 (2009).
  17. Duntsch, C. D., et al. Recombinant vesicular stomatitis virus vectors as oncolytic agents in the treatment of high-grade gliomas in an organotypic brain tissue slice-glioma coculture model. Journal of Neurosurgery. 100, (6), 1049-1059 (2004).
  18. Li, Y., Yuan, S., Moyer, R. W. The non-permissive infection of insect (gypsy moth) LD-652 cells by Vaccinia virus. Virology. 248, (1), 74-82 (1998).
  19. Seet, B. T., et al. Poxviruses and immune evasion. Annual Review of Immunology. 21, 377-423 (2003).
  20. Cotter, C. A., Earl, P. L., Wyatt, L. S., Moss, B. Preparation of Cell Cultures and Vaccinia Virus Stocks. Current Protocols in Microbiology. 39, 11-18 (2015).
  21. Andrei, G., et al. Cidofovir resistance in vaccinia virus is linked to diminished virulence in mice. Journal of Virology. 80, (19), 9391-9401 (2006).
  22. Dascher, C., VanSlyke, J. K., Thomas, L., Balch, W. E., Thomas, G. Preparation of recombinant vaccinia virus for expression of small GTPases. Methods in Enzymology. 174-188 (1995).
  23. Martin, A., Rex, E. A., Ishidate, T., Lin, R., Gammon, D. B. Infection of Caenorhabditis elegans with Vesicular Stomatitis Virus via Microinjection. Bio-Protocol. 7, (22), (2017).
  24. Luker, K. E., Hutchens, M., Schultz, T., Pekosz, A., Luker, G. D. Bioluminescence imaging of vaccinia virus: effects of interferon on viral replication and spread. Virology. 341, (2), 284-300 (2005).
  25. Rozelle, D. K., Filone, C. M., Dower, K., Connor, J. H. Vaccinia reporter viruses for quantifying viral function at all stages of gene expression. Journal of Visualizes Experiments. (87), e51522 (2014).
  26. Cao, C., et al. Characterization of the transcriptome of the Asian gypsy moth Lymantria dispar identifies numerous transcripts associated with insecticide resistance. Pesticide Biochemistry and Physiology. 119, 54-61 (2015).
  27. Sparks, M. E., Blackburn, M. B., Kuhar, D., Gundersen-Rindal, D. E. Transcriptome of the Lymantria dispar (gypsy moth) larval midgut in response to infection by Bacillus thuringiensis. PloS One. 8, (5), e61190 (2013).
  28. Sparks, M. E., Gundersen-Rindal, D. E. The Lymantria dispar IPLB-Ld652Y cell line transcriptome comprises diverse virus-associated transcripts. Viruses. 3, (11), 2339-2350 (2011).
  29. Lin, G., Li, G., Granados, R. R., Blissard, G. W. Stable cell lines expressing baculovirus P35: resistance to apoptosis and nutrient stress, and increased glycoprotein secretion. In Vitro Cellular & Developmental Biology - Animal. 37, (5), 293-302 (2001).
  30. Li, W. X., et al. Interferon antagonist proteins of influenza and vaccinia viruses are suppressors of RNA silencing. Proceedings of the National Academy of Sciences of the United States of America. 101, (5), 1350-1355 (2004).
  31. Kanost, M. R., et al. Multifaceted biological insights from a draft genome sequence of the tobacco hornworm moth, Manduca sexta. Insect Biochemistry and Molecular Biology. 76, 118-147 (2016).
  32. Paixao, E. S., Teixeira, M. G., Rodrigues, L. C. Zika, chikungunya and dengue: the causes and threats of new and re-emerging arboviral diseases. BMJ Global Health. 3, (2018).
Arboviren Infektionen als Screening-Tools für die Identifizierung von viralen Immunmodulatoren und Host antiviralen Faktoren
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Rex, E. A., Seo, D., Gammon, D. B. Arbovirus Infections As Screening Tools for the Identification of Viral Immunomodulators and Host Antiviral Factors. J. Vis. Exp. (139), e58244, doi:10.3791/58244 (2018).More

Rex, E. A., Seo, D., Gammon, D. B. Arbovirus Infections As Screening Tools for the Identification of Viral Immunomodulators and Host Antiviral Factors. J. Vis. Exp. (139), e58244, doi:10.3791/58244 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter