Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Immunology and Infection

Infezioni da arbovirus come strumenti di Screening per l'identificazione di fattori virali immunomodulatori e Host antivirale

doi: 10.3791/58244 Published: September 13, 2018

Summary

Qui, presentiamo i protocolli per identificare gli immunomodulatori 1) virus-messo che promuovono la replica da arbovirus e fattori ospite 2) eucariotica che limitano la replica da arbovirus. Questi metodi basati su fluorescenza e luminescenza permettono ai ricercatori di ottenere rapidamente letture quantitative della replica da arbovirus nelle analisi semplicistiche con bassi rapporti segnale-rumore.

Abstract

Interferenza di RNA - e genoma editing basato su piattaforme di screening sono stati ampiamente usati per identificare fattori di cellula ospite che limitano la replicazione del virus. Tuttavia, questi schermi sono in genere condotti in cellule che sono naturalmente permissive al patogeno virale in fase di studio. Di conseguenza, la robusta replicazione del virus in condizioni di controllo può limitare la gamma dinamica di queste schermate. Inoltre, questi schermi potrebbero essere Impossibile identificare facilmente i percorsi di difesa cellulare che limitano la replicazione del virus, se il virus è in grado di contrastare le difese antivirali e ben adattati all'host. In questo articolo, descriviamo un nuovo paradigma per esplorare le interazioni virus-ospite attraverso l'uso di schermi che centro a naturalmente abortite infezioni da arbovirus come virus della stomatite vescicolare (VSV). Nonostante la capacità di riprodursi in una vasta gamma di insetti Ditteri e ospita mammiferi dei VSV, VSV subisce un'infezione post-voce, abortita in una varietà di linee cellulari derivate da lepidotteri insetti come il bombice dispari (Lymantria dispar). Tuttavia, queste infezioni VSV abortive possono essere "salvate" quando le difese antivirali di cellula ospite sono compromesse. Descriviamo come VSV ceppi codifica geni reporter conveniente e restrittive dispar L. linee cellulari possono essere accoppiate agli schermi di messa a punto per identificare fattori dell'ospite coinvolti nella restrizione da arbovirus. Inoltre, mostriamo anche l'utilità di questi strumenti di screening nell'identificazione dei fattori viralmente codificati che replica VSV durante il coinfection o attraverso l'espressione ectopica, compresi quelli codificati dal virus dei mammiferi di soccorso. La limitazione naturale della replica di VSV in dispar L. cellule fornisce un elevato rapporto segnale-rumore quando lo screening per le condizioni che favoriscono il salvataggio VSV, consentendo in tal modo l'uso di metodi semplicistici luminescenza e fluorescenza-basata per monitorare le modifiche nella replica di VSV. Queste metodologie sono utili per comprendere l'interazione tra risposte antivirali ospite e fattori virali evasione immune.

Introduction

La capacità di un virus di replicare in modo produttivo in un particolare host è in parte regolata dalla disponibilità di fattori di cellula ospite che supportano entrata virale e replica1. La gamma di virus-ospite può essere dettata anche dalla capacità di un virus a contatore antivirale le difese cellulari che altrimenti impedirebbero la replicazione virale2,3. Esso è il risultato di queste interazioni virus-ospite complessi che in ultima analisi, decidere se un virus sarà in grado di completare il suo ciclo di vita in un particolare host. Dato le conseguenze potenzialmente patogene per l'host se ne deriva la replicazione virale, è fondamentale per sviluppare strategie sperimentali per avanzare la nostra comprensione delle interazioni virus-ospite chiave che l'ago della bilancia tra abortiti e produttivo infezioni. Chiarire le caratteristiche molecolari di interazione virus-ospite sarà determinante nello sviluppo di strategie terapeutiche antivirali nuove e alternative.

Con l'avvento di RNA interferenza (RNAi)4,5 e strumenti di modifica del genoma (ad es., CRISPR-Cas9, zinco dito nucleasi, TALENs)6,7, è diventato sperimentalmente fattibile per alterare la espressione di fattori cellulari sul genoma scale ed esplorare l'impatto di queste alterazioni sulla replicazione del virus. Infatti, sono stati condotti numerosi RNAi e genoma di editing basati su schermi in tipi di cellule ospite invertebrati e vertebrati che hanno svelato nuove sfaccettature del virus-ospite interazioni8,9,10, 11 , 12. queste schermate di solito impiegano virus codifica reporter, come la luciferasi di lucciola (LUC) o proteine fluorescenti (ad es., GFP, DsRed), che forniscono comodo mezzo per valutare quantitativamente l'espressione genica virale come una lettura per la replicazione virale9,12. Questa strategia permette ai ricercatori di identificare fattori ospite che sia promuovono o antagonizzano replicazione virale, come evidenziato da aumenti o diminuzioni, rispettivamente, virale Reporter segnala9,12. Tuttavia, nella stragrande maggioranza dei casi, questi schermi sono stati condotti usando i virus che si siano ben adattati al tipo di cellula ospite in cui stanno studiandi. Mentre questa strategia può essere importante per comprendere le relazioni coevolutionary tra agenti patogeni virali e loro ospiti naturali, pongono fondamentali preoccupazioni per quanto riguarda il loro uso in scoprendo fattori antivirali dell'ospite. In questi casi, un miglioramento in reporter di virus segnale di RNAi atterramento è ricercato, o l'inattivazione di un fattore cellulare che normalmente impedisce la replicazione virale. In primo luogo, se un virus è già in grado di replicare con fermezza nella cellula ospite all'esame in condizioni di controllo, la gamma dinamica dello schermo (cioè, la capacità di distinguere tra sfondo e segnali reporter virale avanzata) può essere limitata. In secondo luogo, questo problema è ulteriormente aggravato dalle situazioni in cui il virus è ben adattato alla cellula ospite ed efficace nel contrastare le vie di difesa ospite che sono presi di mira nella schermata.

A causa delle preoccupazioni di cui sopra per quanto riguarda l'interazione virus-ospite tradizionali metodi di screening, abbiamo sviluppato un nuovo paradigma per lo studio delle interazioni virus-ospite che sfruttano le infezioni da arbovirus naturalmente abortiti in cellule di insetto lepidottero. Questa strategia deriva da un'osservazione che l'arbovirus umano ben studiata, VSV, subisce un'infezione abortita in cellule derivate dal lepidottero zingaresco (L. dispar)13. VSV è naturalmente trasmessa da insetti Ditteri (cioè, flebotomi) agli host dei mammiferi e ha dimostrato sperimentalmente di infettare una vasta gamma di invertebrati e vertebrati host sia in cella cultura ed in vivo14. Il genoma di 11-kb-senso single-stranded RNA di VSV codifica cinque mRNAs subgenomic che ciascuno si traducono in proteine che compongono il virione avvolta. Tuttavia, sistemi di genetica inverso VSV hanno permesso la creazione di ceppi replica-competente codifica LUC o proteine fluorescenti, oltre le cinque naturale VSV gene prodotti15,16,17. Poiché queste proteine reporter non sono incorporate nel virione VSV, forniscono una lettura comoda per l'espressione genica VSV che si verifica post-voce. Utilizzo di ceppi VSV codifica GFP o LUC, precedentemente abbiamo indicato che l'espressione genica VSV è severamente limitato al momento dell'entrata delle cellule LD652 e che i titoli VSV non aumentano da post-infezione 72 ore (hpi). Al contrario, la coinfezione di cellule LD652 con VSV e mammiferi di poxvirus, virus vaccinico (VACV), conduce ad un aumento logaritmico sia espressione genica VSV ed i titoli da questo punto di tempo. VACV subisce precoce espressione genica, la replicazione del DNA e tardi espressione genica nelle infezioni delle cellule LD652, ma il ciclo di replica VACV è in definitiva abortito a causa di incompleta virione morfogenesi18. Il grande genoma DNA ~ 192 kb di VACV codifica proteine > 200, molti dei quali visualizzare proprietà immunomodulatorie che promuovono la replicazione virale attraverso la soppressione di host le risposte immunitarie19. Di conseguenza, abbiamo supposto che il "salvataggio" di replica VSV in cellule LD652 da coinfezione VACV probabilmente è stato mediato da immunomodulatori VACV che ha inibito dispar L. risposte normalmente limitando replica VSV. A sostegno di ciò, il trattamento delle cellule di LD652 con l'inibitore di host RNA polimerasi II actinomicina D salva anche replica VSV in cellule di LD652, che indica che la risposta dell'ospite di trascrizione-dipendente blocco VSV replica post-voce13.

Queste osservazioni indicano che la natura naturalmente restrittiva delle cellule di LD652 all'infezione di VSV può fornire uno sfondo relativamente basso quando lo screening per le condizioni che migliorare i segnali reporter VSV-codificati (cioè, quelli che inibiscono host difese antivirali). Qui, mettiamo a disposizione i metodi per l'utilizzo di fluorescenza o saggi basati su LUC alla schermata per condizioni che alleviano la restrizione di VSV in cellule di lepidotteri. In primo luogo, vi mostriamo come queste analisi possono essere utilizzate per identificare i fattori immunomodulatori viralmente codificato che rompono restrizione VSV durante entrambi gli esperimenti di coinfezione o attraverso l'espressione ectopica di fattori virali candidato. Ad esempio, vi illustriamo come abbiamo usato queste tecniche di screening per identificare proteine codificate poxvirus di A51R come una nuova famiglia di fattori immunomodulatori che replica VSV in assenza di altri fattori di poxvirus13di soccorso. In secondo luogo, vi illustriamo come RNAi di screening nelle infezioni di cella restrittive VSV-LD652 può essere utilizzato per identificare direttamente coinvolti da arbovirus restrizione13fattori dell'ospite eucariotica.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. generale Lymantria dispar (LD652) cella e cultura del Virus

  1. Cella LD652 coltura e placcatura
    1. Alla cultura dispar L.-derivata LD652 cellule, mantenere un monostrato di cellule in un mezzo di crescita (Tabella materiali) incubate a 27 ° C in atmosfera normale. Mantenere le cellule in piatti di tessuto-cultura-trattati di 10cm e passaggio le cellule giunti confluency di 80%.
    2. Piastra, sloggiare le cellule aderenti LD652 dalla piastra pipettando i media ripetutamente sul monostrato (queste cellule non hanno bisogno di trypsinization per sloggiare) e diluire il campione in coltura ad una densità approssimativa di 1 x 105 cellule/mL. Pipettare 1 mL di diluito cultura/pozzetto di una piastra a 24 pozzetti. Un minimo di tre pozzi replica/trattamento di tipo per ogni punto di tempo (un massimo di otto trattamenti/piastra) del seme.
    3. Permettono alle cellule di stabilirsi per un minimo di 1 h.
  2. Preparazione di vaccinia virus
    1. Per preparare le scorte di VACV, amplificare il virus in HeLa cells20 o cellule di rene di scimmia verde africana (cellule BSC-1 o BSC-40)20,21,22.
      Nota: Ceppo VACV Western Reserve (VACV-WR) funziona bene nelle analisi descritte qui.
    2. Titolare il saggio del ceppo via della placca VACV su BSC-1 o BSC-40 cellule20,22.
      Nota: Tutti indicati molteplicità VACV di infezione (MOI) descritto qui per LD652 infezioni di cella si basano su titoli ottenuti da saggi di placca BSC-40.
  3. Preparazione del virus di stomatite vescicolare
    1. Per preparare scorte VSV, amplificare il virus, cellule BHK23.
    2. Titolare VSV di saggio della placca il BSC-40 o BHK cella monostrati13,23.
      Nota: Tutti i VSV MOIs descritto qui per LD652 infezioni di cella si basano su titoli ottenuti da saggi di placca BSC-40.

2. base di fluorescenza VSV Rescue analisi usando co-infezione e Live cell Imaging

  1. Semina e l'infezione delle cellule LD652
    1. LD652 40.000 cellule/pozzetto di una camera di 8 pozzetti della piastra.
    2. Per acquisizione di immagini di cellule vive basata sulla fluorescenza, utilizzare ceppi VSV codifica proteine fluorescenti. Gli esperimenti presentati qui utilizzano VSV-DsRed17, un ceppo batterico di VSV che esprime la proteina DsRed libera che non è fuso a qualsiasi altra proteina VSV.
      Nota: VSV infezione delle cellule di LD652 non è citopatico da hpi 96 e, quindi, la morte delle cellule non è un fattore di confusione quando si valutano replica VSV entro questo lasso di tempo.
    3. Preparare VSV-DsRed e VACV-FL-GFP in un supporto privo di siero (SFM; Tabella materiali) presso un MOI 1 e 25, rispettivamente.
      Nota: VACV-FL-GFP è un ceppo batterico di VACV che esprime una fusione tra LUC e GFP24. Utilizzando un MOI di 25 o superiore per i ceppi VACV assicura che tutte le cellule LD652 sono infetti13. Se si utilizza un virus coinfecting diverso, il MOI dovrà essere determinata empiricamente dall'utente. Ogni trattamento di infezione devono essere configurate in pozzetti duplicati e includono trattamenti mock-infettati in cui solo SFM è aggiunto alle cellule.
    4. Incubare le cellule in 0,2 mL di inoculo per 2 ore a 27 ° C.
    5. Lavare le cellule con 0,5 mL/bene di crescita media.
    6. Incubare le cellule a 25 μM della tintura di attuabilità delle cellule (Tabella materiali) nei mezzi di crescita per 45 min a 27 ° C.
    7. I media di aspirare e lavare i pozzetti 1 x con 0,5 mL/bene a rimuovere il colorante in eccesso.
    8. Mantenere le cellule in 0,3 mL/bene dei media crescita.
  2. Vivere la cattura delle immagini di cella
    1. Girare su un microscopio confocale 30 min di anticipo e un piatto di 8 pozzetti camera di carico.
      Nota: Le cellule LD652 possono essere imaged a temperature ambiente che vanno da 20 – 25 ° C, ma per condizioni ottimali, la temperatura della stanza deve essere regolata a 27 ° C.
    2. Configurare le impostazioni di eccitazione/emissione appropriato per ogni proteina marcatore fluorescente essere imaged, nonché le impostazioni di immagine contrasto di fase.
    3. Regolare l'intensità del laser per ogni canale.
      Nota: Ciò può richiedere l'esecuzione di un esperimento pilota per determinare la gamma di intensità di segnale fluorescente osservati durante il corso di tempo per essere utilizzato nell'esperimento finale.
    4. Utilizzando l'obiettivo 10x, catturare le immagini di fluorescenza e contrasto di fase di ogni bene ogni 1 – 5 ore per la durata dell'infezione fino a un punto di tempo desiderato (ad es., 48 – 72 hpi).
      Nota: È importante acquisire molteplici campi di vista in ogni pozzetto per stimare con precisione i tassi di infezione in tutta la cultura.
  3. Analisi dell'immagine
    1. Utilizzare software di analisi di immagine per l'analisi di immagine automatizzato dei canali fluorescente appropriati (ad es., 405 nm, 488 nm, 568 nm).
    2. Per calcolare la percentuale di cellule che sono infettati, dividere il numero totale di cellule fluorescenti che indica infezione VSV (ad es., cellule DsRed-positive per infezioni VSV-DsRed) per il numero totale di cellule vitali con l'etichetta di tintura di attuabilità delle cellule per ogni campo visivo attraverso tutti i trattamenti.

3. generale infezione virale protocollo per basata su luminescenza VSV Rescue saggi in cellule di LD652

  1. Preparazione dell'inoculo
    1. 30 min prima dell'infezione, scongelare le scorte di VSV-LUC16 (un recombinant VSV ceppo che esprime libero firefly luciferase proteina fusa non a qualsiasi altra proteina VSV). Se analizzando per salvataggio VSV-LUC durante il coinfection VACV, anche scongelare il virus VACV-WR sul ghiaccio.
      Nota: Altri virus (oltre VACV-WR) può salvare VSV-LUC durante la coinfezione, ma questo dovrà essere determinata empiricamente da ciascun utente.
    2. Preparare l'inoculo diluendo VSV-LUC in presenza o assenza di VACV-WR in SFM, tale che un MOI di 10 e 25, rispettivamente, si ottiene quando si aggiunge un volume totale di inoculo di 0,2 mL/bene.
  2. Infezione delle cellule
    1. Maturo LD652 supporti con cautela per evitare di disturbare il monostrato di aspirare e inoculare con 0,2 mL di virus per pozzetto. Questo tempo è definito come 0 hpi. Aggiungere sterile SFM ulteriori pozzi per servire come "mock-infetto" trattamenti di controllo negativo.
    2. Incubare le cellule nell'inoculo per 2 ore a 27 ° C.
    3. Alle 2 hpi, rimuovere inoculo dall'aspirazione e sostituire con 1 mL/bene LD652 crescita media.
    4. Permettere che l'infezione di procedere hpi 24 – 72.

4. luciferase Assay

  1. Preparazione dei lisati cellulari
    1. Attentamente, aspirare il supernatante e aggiungere 1 mL di soluzione tampone fosfato di Dulbecco (DPBS) / bene.
    2. Utilizzando lo stantuffo di una siringa da 1 mL, raschiare le cellule in DPBS.
    3. Trasferire le cellule in un tubo del microcentrifuge e centrifuga a 400 x g per 20 min a 4 ° C.
    4. Nel frattempo, preparare 1 x diluizione di 5 x buffer di lisi di reporter (RLB) in sterile H2O.
    5. Dopo la centrifugazione, aspirare il DPBS senza disturbare il pellet cellulare.
    6. Ogni risospendere in 150 µ l di 1 x RLB.
    7. Congelamento-scongelamento dei campioni 1 x utilizzando un'incubazione di 5 min in un congelatore-80 ° C seguito da un rapido disgelo in un bagno di acqua temperatura ambiente. Memorizzare i lisati a-80 ° C fino al momento di analizzare.
  2. Analisi di luciferase
    1. Scongelare i lisati sul ghiaccio.
    2. Aggiungere 20 μL di lisato in un pozzo di una micropiastra a 96 pozzetti solido bianco o nero.
    3. Aggiungere 100 μL di reagente di saggio di luciferasi in ciascun pozzetto.
    4. Immediatamente misurare l'intensità della luce utilizzando un luminometro (impostazioni appropriate per Luminometri specifico dovrà essere determinata empiricamente dall'utente).
  3. Analisi del saggio di luciferasi
    1. Normalizzare LU segnali per ogni trattamento per letture di LU ottenuti dai trattamenti di controllo (Rappresentante risultati). Dopo almeno tre esperimenti indipendenti sono stati eseguiti, la media che Lu ottenuti da ciascun gruppo di trattamento/controllo può essere analizzata mediante test statistici appropriati.

5. Immunoblot

  1. Utilizzare lisati estratte per i saggi LUC per SDS-PAGE e immunoblotting successivo, utilizzando Strumentazione e reagenti appropriati.

6. titolo di VSV dalle colture delle cellule LD652

  1. Piastra LD652 cellule secondo punto 1.1.
  2. Virale infettare le cellule secondo passaggio 3.
  3. Intervalli di tempo desiderato, è possibile raccogliere i surnatanti in microcentrifuga sterile.
  4. Appallottolare le celle utilizzando 1.000 x g per 10 min a 4 ° C e trasferire i surnatanti in nuove provette.
  5. Memorizzare i surnatanti a-80 ° C o procedere con titolazione di saggio della placca sulle cellule BSC-40.
    Nota: Se la titolazione VSV da colture di cellule LD652 che conteneva VACV, è consigliabile aggiungere 100 μg/mL citosina arabinoside (AraC) per i terreni di coltura di BSC-40 entro 2 hpi, per impedire la formazione di placche su BSC-40 strati monomolecolari13di particelle residue di VACV. AraC è un inibitore della polimerasi del DNA virale che blocca VACV DNA replica25 ma non influisce sulla replica di VSV.

7. variazioni di VSV basata su luminescenza salvataggio saggi in cellule di LD652: RNAi e gli esperimenti di transfezione del plasmide

  1. Preparazione di dsRNA per atterramento di RNAi-mediata di virale o ospitare trascrizioni
    1. Gli iniettori di gene-specific design dalla coda all'estremità 5' con la sequenza del promotore T7 (TAATACGACTCACTATAGGG) fare riferimento il virus coinfecting (ad es., VACV) o dispar L. trascrizioni del mRNA di interesse. Questi iniettori dovrebbero produrre un prodotto PCR di 400 – 600 bp per atterramento di RNAi-mediata efficace. Vedere Gammon et al. 13 per sequenze dell'iniettore usato sotto per atterramento VACV o dispar L. trascrizioni di dsRNA-mediata RNAi in cellule di LD652.
      Nota: Dispar L. mRNA trascritti possono essere identificati da pubblicato dispar L. transcriptome database26,27,28.
    2. Generare un DNA modello tramite RT-PCR (sintesi del cDNA: 1 ciclo di 50 ° C per 30 min; PCR: 40 cicli di 94 ° C per 15 s, 50 ° C per 30 s e 68 ° C per 45 s ciascuno).
    3. Purificare il prodotto PCR utilizzando un kit di purificazione di PCR.
    4. Utilizzando il prodotto PCR purificato come modello, in vitro trascrivere e purificare dsRNA utilizzando un kit di purificazione e di trascrizione in vitro .
  2. Transfezione di dsRNA o plasmide DNA nelle cellule LD652
    1. Semi 1 x 105 cellule/pozzetto di una piastra a 24 pozzetti e lasciare che le celle di stabilirsi per almeno 1 h.
    2. Per ciascun pozzetto per transfettate, diluire 4 μL di reagente di transfezione in 100 μL di SFM. Incubare per fino a 15 min a temperatura ambiente. Questo può essere scalato per rendere un mix master per tutte le transfezioni deve essere eseguita.
    3. Diluire fino a 1 μg di dsRNA o DNA plasmidico totale con 100 μL di SFM per ciascun pozzetto per essere transfected. Incubare per fino a 15 min a temperatura ambiente.
      Nota: Precedentemente abbiamo trovato che una trasfezione di 1 μg di dsRNA/105 LD652 celle è sufficiente per > 80% atterramento di sia virale o ospitare trascrizioni13, ma dsRNA dosi necessarie per modificato sperimentale set-ups/condizioni dovrà essere determinata empiricamente.
    4. Combinare le diluizioni di transfezione reagente e dsRNA/plasmide DNA con un rapporto 1:1 (ad esempio, 100 μL di dsRNA diluito è mescolato con 100 μL di reagente di transfezione diluito) e incubare per 20 minuti a temperatura ambiente.
    5. Nel frattempo, lavare i pozzetti con 1 mL/bene di SFM e quindi aggiungere 500 μL di SFM in ciascun pozzetto.
    6. Aggiungere lentamente la transfezione reagente dsRNA (o DNA plasmidico) miscela goccia a goccia in ciascun pozzetto.
    7. Incubare il reagente di transfezione con le cellule per 5 h.
      1. Per RNAi esperimenti che coinvolgono l'atterramento delle trascrizioni codificate da un virus coinfecting (ad es., VACV), sostituire il reagente di transfezione dopo il periodo di incubazione di 5-h transfezione con inoculo di virus contenente VSV-LUC (con o senza VACV o un altro virus coinfecting) (passaggio 3). Successivamente, sostituire l'inoculo di virus contenente VSV-LUC con completa crescita media 2 hpi. Saggi di LUC (passaggio 4) quindi possono essere eseguite su lisati estratti a vari intervalli di tempo per determinare se l'atterramento di coinfecting trascrizioni del virus conduce ad una perdita di salvataggio VSV-LUC.
      2. Per esperimenti di RNAi che coinvolgono RNAi delle trascrizioni dispar L. , sostituire il mix di transfezione con media crescita completa e consentire atterramento di derivare per 24 h prima dell'infezione con VSV-LUC (passaggio 4). Saggi di LUC (passaggio 4) quindi possono essere eseguite su lisati estratti a vari intervalli di tempo per determinare se l'atterramento delle trascrizioni dispar L. promuove salvataggio VSV-LUC.
      3. Per gli esperimenti che coinvolgono transfezioni di vettori di espressione plasmidici esprimendo candidati immunomodulatori, sostituire il reagente di transfezione e consentire l'espressione della proteina per 24 h prima dell'infezione con VSV-LUC (passaggio 4). Saggi di LUC (passaggio 4) quindi possono essere eseguite su lisati estratti a vari intervalli di tempo per determinare se l'espressione delle proteine di immunomodulatori candidato promuove salvataggio VSV-LUC.
        Nota: Le condizioni di transfezione descritte qui con 1 μg/pozzetto di risultato DNA plasmidico in efficienza di trasfezione di 40 – 60%13.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Come un esempio di applicazioni di imaging di cellule vive per monitorare salvataggio VSV su coinfection VACV, LD652 cellule erano placcate in un piatto chambered 8 pozzetti e poi mock-infettati o infettate con VSV-DsRed (MOI = 1) in presenza o assenza di VACV-FL-GFP (MOI = 25). Perché VSV-DsRed esprime DsRed come una proteina libera e non è fusa delle proteine strutturali di VSV (Figura 1A), viene rilevato solo dopo avvia VSV voce e l'espressione genica. Tutte le celle sono state quindi identificate con tintura di attuabilità delle cellule che passa liberamente attraverso la membrana plasmatica delle cellule, dove viene convertito in un prodotto della membrana-impermeant, che promuove la ritenzione del segnale fluorescente in cellule con etichettate. Immagini sono state acquisite ogni 5 h fino a 65 hpi, utilizzando il 405 nanometro, 488 nanometro, 568 nm e bianco luce filtra per catturare la tintura di attuabilità delle cellule, VACV-FL-GFP, VSV-DsRed e canali di contrasto (PC) di fase, rispettivamente. In condizioni di singola infezione, le cellule LD652 limitano la replica VSV-DsRed; Pertanto, solo un piccolo numero di cellule Mostra un segnale DsRed. Tuttavia, coinfection di VSV-DsRed con VACV-FL-GFP si traduce in maggior parte delle cellule visualizzazione di segnali DsRed entro la fine del corso tempo (Figura 1B). Le immagini catturate in ogni punto del tempo sono stati sottoposti a software di analisi di immagine, dove 405 nm e 568 nm canale immagini sono state utilizzate per determinare automaticamente il totale e i numeri di cellulare DsRed-positivi, rispettivamente. La percentuale di cellule visualizzati da un segnale di DsRed per ogni trattamento viene calcolata dividendo gli oggetti (celle) con un segnale positivo nel canale 568-nm per il numero di oggetti identificati nel canale 405 nm per ciascun punto di tempo, seguita da moltiplicazione di 100% . Come illustrato nella Figura 1, ~ 2% delle cellule da infezioni singole VSV-DsRed erano DsRed-positivi da 65 hpi. Al contrario, ~ 77% delle cellule in VSV-DsRed + coinfezioni VACV-FL-GFP erano DsRed-positivi in questo momento. Film S1 e S2 mostrano la progressione dell'infezione di VSV-DsRed nel corso di tutto il tempo 65-h in singola infezione e coinfection condizioni, rispettivamente. È importante notare che l'espressione di GFP di VACV-FL-GFP è diventato rilevabile da 10 hpi, prima il segnale di DsRed, che indica che l'espressione genica VACV sufficiente è richiesto prima del salvataggio di VSV-DsRed (non mostrato). Collettivamente, questi risultati indicano chiaramente un salvataggio di VSV-DsRed replica da coinfezione di VACV. Se un virus coinfecting è riuscito a salvare VSV-DsRed, ci si aspetterebbe uguali percentuali delle cellule DsRed-positive tra singola infezione e trattamenti coinfection.

Replica di VSV in cellule di LD652 può essere quantificata in alternativa usando le analisi basate su luminescenza quando usando ceppi di VSV-LUC (Figura 2A). Ad esempio, la Figura 2B Mostra i risultati di un'analisi LUC usando lisati preparato sopra un corso di tempo di 72 h da cellule infettate da mock o cellule infettate con VSV-LUC (MOI = 10) in presenza o assenza di VACV-WR (MOI = 25). Un salvataggio positivo di replica VSV-LUC è indicato tramite l'aumento logaritmico a LU arbitrario rilevato con lisati preparato dalle cellule coinfected, rispetto ai lisati da singole infezioni VSV-LUC. Un risultato negativo sarebbe indicato in questo saggio dal fallimento di una coinfezione di alterare letture LU da quelle osservate nei singoli trattamenti di infezione VSV-LUC. Se lo si desidera, preparati lisati utilizzabile anche per immunoblotting, per confermare l'espressione di gene VSV migliorata nei trattamenti coinfection. Ad esempio, Figura 2 Mostra un risultato tipico immunoblot per LUC VSV-codificato e matrix proteine (M) nei lysates preparato da mock-, VSV-LUC e VSV-LUC + VACV-WR trattamenti 72 hpi. Immunoblotting per proteina VACV I3L servito come un marcatore di infezione VACV e immunoblotting per actina cellulare è stato usato come un controllo di carico. Il chiaro miglioramento delle proteine LUC VSV-codificato e M nei lisati coinfection ulteriormente confermare salvataggio VSV di VACV. Infine, replica VSV produttiva può essere confermata mediante la raccolta surnatanti da queste colture delle cellule LD652 e titolazione un virus contagioso il BSC-40 strati monomolecolari (Figura 2D). Questo risultato viene illustrato che solo durante VACV coinfection fa VSV produttivamente replicare.

Una volta che un virus coinfecting è dimostrato capace di salvataggio replica VSV in cellule di LD652, lo screening RNAi può essere utilizzato per identificare i fattori che contribuiscono al salvataggio VSV codificati dal virus coinfecting. In questo esperimento, schermo per una condizione di RNAi che conduce ad un fenotipo "perdita di salvataggio" durante coinfection VSV-LUC con un virus di salvataggio. Precedentemente abbiamo identificato la proteina VACV A51R come un fattore di salvataggio VSV attraverso uno screening di RNAi di decine di trascrizioni con codifica VACV13. Ad esempio, noi abbiamo ricapitolato una versione su scala più piccola di questa schermata (Figura 3). RNAi è mediata dalla transfezione in vitro di trascritto RNAds destinati a trascrizioni codificate dal virus coinfecting. Nei dati riportati qui, trascrizioni virali codificano per proteine VACV A50R, A51R e A52R sono state mirate per atterramento di RNAi. Come controllo negativo per la perdita di salvataggio, cellule transfected anche con RNAds GFP-codifica trascrizioni di targeting. Come controllo positivo per una perdita del fenotipo di salvataggio, le cellule transfected con RNAds contro LUC-codifica trascrizioni. Questo trattamento produce una forte perdita di segnale LU durante il coinfection e aiuta i ricercatori a confermare che i protocolli di transfezione/RNAi stanno lavorando. Dopo 5 h di dsRNA trasfezione, le cellule erano coinfezione con VSV-LUC (MOI = 10) e VACV-WR (MOI = 25). Infezioni separate con solo VSV-LUC inoltre sono state effettuate per stabilire un livello di sfondo del segnale LU. Lisati sono state poi raccolgono 72 hpi e utilizzato in un dosaggio LUC. Confrontando il livello di salvataggio VSV attraverso trattamenti di dsRNA per il trattamento di controllo dsRNA GFP, i risultati indicano che l'atterramento di VACV A51R produce una forte perdita del fenotipo di salvataggio, mentre l'atterramento di A50R e A52R produce un risultato negativo (nessuna perdita di salvataggio in confronto al dsRNA GFP).

Come alternativa alla RNAi di screening per identificare fattori virali che contribuiscono al salvataggio VSV, overexpress dei fattori virali candidato in cellule di LD652 e poi analizzare per salvataggio VSV-LUC. Questo è possibile dalla clonazione di geni di interesse in vettori di espressione appropriata come p16629 e trasfezione questi plasmidi in cellule LD652 prima la sfida di VSV-LUC. Ad esempio, nella figura 4A Mostra un esperimento di salvataggio in cui bandiera-tagged GFP (FGFP) o la bandierina-etichettate A51R (FA51R) p166 vettori erano transfected nelle cellule LD652 a varie concentrazioni, seguite dall'infezione VSV-LUC (MO = 10) 24 ore più tardi. Come controllo negativo per il salvataggio VSV, altre culture erano mock-transfettate e non hanno ricevuto il DNA del plasmide. Lisati sono stati raccolti da hpi 72 culture e sono stati sottoposti a test LUC. FA51R trattamenti hanno prodotto un risultato positivo di salvataggio VSV come dimostrato dall'avanzata LU segnali sopra mock-transfettate trattamenti a dosi multiple. Al contrario, FGFP trattamenti erano negativi per il salvataggio VSV a qualsiasi dose testata. Immunoblotting dei lisati da Figura 4A ha confermato una simile espressione delle proteine FGFP e FA51R (Figura 4B).

Utilizzando uno screening di RNAi di fattori L. dispar candidati, abbiamo dimostrato che la restrizione di VSV in LD652 cellule è mediata da vari fattori cellulari appartenendo a vie di RNAi antivirale (ad es., AGO2 e Dicer-2), la fattore nucleare kappa B (NF-κB)-via di IMD correlata (ad es., Relish)e il sistema ubiquitina-proteasoma (ad es., poliubiquitina)13. Ad esempio, abbiamo ripetuto una versione più piccola scala di questi esperimenti di RNAi con RNAds dispar L. trascrizioni che migliorati replica VSV-LUC all'atterramento di targeting (ad es., AGO2, Dicer-2, Relish, poliubiquitina) o non ha avuto effetto (AGO1 )13. Dopo 24 h di dsRNA trasfezione, le cellule sono state sfidate con VSV-LUC per 72 h per determinare se RNAi trattamenti enhanced LU segnali rispetto ai trattamenti di controllo negativo GFP dsRNA. Trattamenti di RNAi che migliorare LU segnali indicano che il fattore codificato dalla trascrizione mirata limita VSV replica. Come controllo positivo per atterramento di RNAi, RNAds LUC-codifica trascrizioni di targeting transfected anche nei trattamenti paralleli. A causa del basso fondo LU segnali rilevati nei trattamenti di controllo dsRNA GFP, era relativamente semplice per identificare i fattori di restrizione host-codificati utilizzando lo screening RNAi perché loro atterramento produce ~ 10-1000 volte aumenti nei segnali di LU ( Figura 5). Così, è possibile sfruttare il background relativamente basso livello di espressione genica VSV in cellule di LD652 allo schermo per condizioni atterramento di RNAi host che alleviano la restrizione VSV.

Figure 1
Figura 1: identificazione di salvataggio VSV di coinfection del virus delle cellule di LD652 usando la formazione immagine di cellule vive basati sulla fluorescenza. (A), questo pannello mostra un disegno schematico di un genoma di VSV-DsRed che indica la posizione del gene DsRed (dR). Immagini di microscopia confocale (B) questi rappresentante 10x sono catturati 60 hpi. Il canale 405 nm indica una macchia per cellule vitali, il canale di 488 nm indica infezione VACV-FL-GFP e il canale 568 nm indica infezione VSV-DsRed. Immagini di contrasto (PC) di fase sono mostrati. Scala bar = 100 µm. (C), questo pannello mostra la percentuale di cellule DsRed-positivi LD652 sopra il corso di tempo di infezione intero h 65. Viene visualizzata la percentuale media (SD) delle cellule che mostra un segnale di DsRed per ogni punto di tempo. Clicca qui per visualizzare una versione più grande di questa figura.

Figure 2
Figura 2: valutazione di salvataggio VSV in LD652 cellule utilizzando dosaggi di LUC. (A), questo pannello mostra un disegno schematico di un genoma di VSV-LUC. (B) questo pannello mostra le unità arbitrarie luce saggi (LUC) di lisati di cellule infettate da mock o cellule infettate con VSV-LUC, nell'assenza o nella presenza di VACV-WR. (C), questo pannello mostra un immunoblot di LUC, VSV M, VACV I3L e proteine actina cellulare nei lisati da pannello A raccolti 72 hpi. (D) questo pannello mostra i titoli VSV-LUC in surnatanti ottenuti dal pannello B. I dati quantitativi in pannelli B e D rappresentano i mezzi (± SD) da esperimenti condotti in triplicato. Clicca qui per visualizzare una versione più grande di questa figura.

Figure 3
Figura 3: identificazione di un fattore di salvataggio VSV viralmente codificato mediante RNAi screening durante la coinfezione di cellule di LD652. Questo pannello Mostra modifiche volte a LU rilevato nei lysates dalle cellule hpi 72 con VSV-LUC e VACV-WR dopo il trattamento di RNAi indicato, relativo LU rilevato nei lysates dalle cellule infettate singolarmente con VSV-LUC. I dati rappresentano il mezzo (± SD) da esperimenti condotti in triplicato. Clicca qui per visualizzare una versione più grande di questa figura.

Figure 4
Figura 4: salvataggio del VSV dalla sovraespressione di un immunomodulatore virale in cellule di LD652. (A), questo pannello mostra un LUC dosaggio da cellule VSV-LUC-infettate 72 hpi che era mock-transfettate (finto) o transfettate con i plasmidi di espressione p166 FGFP o FA51R. LU segnali da ogni trattamento sono stati normalizzati per i segnali rilevati nei trattamenti di controllo mock-transfettate. I dati rappresentano il mezzo (± SD) da esperimenti condotti in triplicato. (B), questo pannello mostra lisati dal pannello A, immunoblotted con gli anticorpi di bandiera e l'actina. Clicca qui per visualizzare una versione più grande di questa figura.

Figure 5
Figura 5: identificazione dell'host fattori di limitazione replica VSV in LD652 cellule attraverso lo screening RNAi. Questo pannello mostra che la piega cambia in LU segnali nei trattamenti di RNAi indicati rispetto la GFP dsRNA controllo trattamenti 72 hpi con VSV-LUC. I dati rappresentano il mezzo (± SD) da esperimenti condotti in triplicato. Clicca qui per visualizzare una versione più grande di questa figura.

Film S1: rappresentante 405 nm (tintura di attuabilità delle cellule) e 568 nm (DsRed) canale immagini catturate sopra un corso di tempo 65H (ogni fotogramma = intervallo di 5 h) dopo l'infezione di VSV-DsRed delle cellule di LD652. Per favore clicca qui per scaricare questo file.

Film S2: rappresentante 405 nm (tintura di attuabilità delle cellule) e 568 nm (DsRed) canale immagini catturate sopra un corso di tempo 65H (ogni fotogramma = intervallo di 5 h) dopo il coinfection di cellule LD652 con VSV-DsRed e VACV-FL-GFP. Per favore clicca qui per scaricare questo file.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Qui abbiamo descritto analisi semplice di fluorescenza e luminescenza basata allo schermo per condizioni che replica VSV in colture cellulari di lepidotteri restrittive di soccorso. L'infezione abortita di VSV in cellule di lepidotteri crea un eccellente rapporto segnale-rumore quando analizzando per espressione genica VSV. Ad esempio, sono stati i segnali di LU rilevati nei lysates dalle singole infezioni VSV-LUC ~ 1.000 superiore a nei lysates mock-infettati, eppure questi segnali solo cambiato circa duplice sopra un corso di tempo di 72 h. Al contrario, coinfection di VSV-LUC con VACV migliorato LU segnali ~ 300-fold over single infezioni VSV-LUC di 72 hpi. Così, VSV salvataggio saggi visualizzare un'eccellente gamma dinamica, che comprende diversi ordini di grandezza.

Uno dei passaggi critici nella creazione di queste analisi comporta la decisione di dosaggio per salvataggio VSV mediante approcci basati sulla fluorescenza o luminescenza. Abbiamo mostrato esempi di modalità di codifica VSV DsRed segnali possono essere analizzati quantitativamente utilizzando tecniche di imaging di cellule vive e pacchetti software che facilitano la quantificazione automatizzata delle cellule DsRed-positive in assenza o in presenza di un salvataggio coinfection. Se i ricercatori hanno accesso alle funzionalità di imaging di cellule vive, queste analisi sono economiche impostare e consentire loro di acquisire una vasta gamma di punti di tempo che può aiutare nell'individuazione delle differenze nella cinetica VSV replica che sono osservabili solo in tempo stretto Windows. Al contrario, gli approcci basati sulla luminescenza sono essenzialmente le analisi end-point che richiedono la preparazione di lisati cellulari a intervalli di tempo predeterminati e preparazione del lysate può richiedere molto tempo. D'altra parte, l'analisi basata su luminescenza non richiedono apparecchiature sofisticate microscopia — solo un lettore di piastra in grado di leggere i segnali di luminescenza. Inoltre, analisi luminescenza-based hanno una maggiore gamma dinamica di analisi di microscopia-based che consentono di calcolare la percentuale di cellule infettate. Ad esempio, nelle analisi di microscopia, cellule DsRed-positive (che indica infezione VSV-DsRed) solo possono variare da 0 – 100% delle cellule analizzate in un campo di vista. Al contrario, LU segnali tra singolo VSV-LUC e coinfection condizioni (o altre condizioni di salvataggio) possono variare nel corso di diversi ordini di grandezza.

Offre il vantaggio di utilizzare il sistema di cella di VSV -dispar L. presentato qui a schermo per mammiferi immunomodulatori virus-messo che intrinsecamente seleziona per l'identificazione di fattori virali che sopprimono cosa sono suscettibili di essere conservate e antico risposte antivirali che precedono la risposta di vertebrato specifico interferone. Infatti, osservazioni preliminari suggeriscono che A51R proteine inibiscono conservate risposte di cellulari antivirali ubiquitin-proteasome-correlate (Vedi Gammon et al. 13 e dati non pubblicati). La scoperta di VACV A51R salvataggio di VSV fu il primo esempio di un salvataggio di virus eterologo da un virus dei vertebrati in un ospite invertebrato13, ed è probabile che questi sistemi di screening saranno scoprire ulteriori vertebrati immunomodulatori virus-messo . È importante notare che la chiave per utilizzare salvataggio VSV come una lettura per condizioni che inibiscono l'immunità ospite è che la replica VSV deve essere fortemente limitato (o abortiti) nel tipo di cellula replica VSV viene esaminata in. Di conseguenza, tipi di cella più mammiferi sarebbe probabilmente inadatti per questi tipi di analisi, dato che VSV replica bene in cellule di mammifero. Ecco perché le cellule dispar L. sono state utilizzate qui come un tipo di cellula ospite naturalmente restrittive per VSV.

Uno studio preliminare in cellule di Drosophila ha mostrato che virale soppressori di antivirali RNAi risposte potrebbero essere identificati da cotransfection dei plasmidi di espressione codifica candidato RNAi soppressori e un auto-replicanti Flock House virus RNA genomico che codifica GFP al posto di B2, il suo naturale RNAi soppressore30. La replica del RNA genomico Flock House e produzione di GFP dipendeva la soppressione del RNAi per il fattore di cotransfected candidato e, quindi, il salvataggio di espressione di GFP indicata RNAi soppressione30. Il nostro lavoro non pubblicati indica che la sovraespressione di virus-messo RNAi inibitori salva anche VSV-LUC l'espressione genica in cellule L. dispar , suggerendo che questo sistema utilizzabile anche per identificare i soppressori delle risposte di RNAi nel contesto della infezione da un agente patogeno virale di bona fide in contrasto con un replicone. Infatti, la constatazione della RNAi-, IMD- e vie di ubiquitin-proteasome-correlate contribuiscono alla limitazione della replica di VSV dispar L. cellule13 suggerisce che gli antagonisti virali di parecchie vie antivirale possono essere identificati con il VSV saggi di salvataggio presentati qui.

Una potenziale limitazione di questi metodi di screening per quanto riguarda l'identificazione di proteine antivirali ospite è che la sequenza del genoma di L. dispar non è ancora disponibile. Tuttavia, ci sono pubblicamente disponibili dispar L. trascrittomi che possono essere utilizzato per identificare gli obiettivi di host candidato per RNAi atterramento26,27,28. Inoltre, abbiamo indicato precedentemente che VSV è limitato in linee cellulari derivate da altri lepidotteri13 che ora hanno un genoma pubblicamente disponibile (ad es., Manduca sexta)31. Pertanto, linee cellulari derivate da altri lepidotteri con genomi sequenziati possono sostituire le cellule dispar L. descritte nel protocollo qui.

Data la crescita economica e la minaccia alla salute pubblica di arbovirus32, l'analisi di selezione qui presentate possono fornire nuove strategie per identificare le nuove caratteristiche delle interazioni da arbovirus-ospite che possono avere valore nella progettazione di nuovi farmaci antivirali terapeutica. Inoltre, a causa della nostra comprensione relativamente limitata di lepidotteri meccanismi per limitare la replica del virus a RNA, gli strumenti presentati qui forniscono nuove opportunità di sondare i meccanismi di difesa ospite codificati da questo economicamente importante ordine di insetti.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Gli autori non hanno nulla a rivelare.

Acknowledgments

D.G. è stato sostenuto da finanziamenti da dotato Scholars Program dell'Università del Texas Southwestern Medical Center. Gli autori ringraziano Michael Whitt (The University of Tennessee Health Science Center) e Sean Whelan (Harvard Medical School) per la fornitura di VSV-DsRed e VSV-LUC. Gli autori ringraziano anche Gary Luker (University of Michigan Medical School) per il gentile dono del ceppo VACV-FL-GFP.

Materials

Name Company Catalog Number Comments
6-well tissue culture plates CELLTREAT 229106
24-well tissue culture plates CELLTREAT 229124
10 cm tissue culture dishes Corning C430167
Grace’s Insect Medium Sigma G8142
EX-CELL 420 Sigma 14420C
Fetal Bovine Serum - Optima Atlanta Biologicals S12450
Growth medium 1:1 mixture of Grace's Insect Medium and EX-Cell 420 Serum-Free Medium also containing 1% antibiotic-antimycotic solution and 10% Fetal bovine serum
Antibiotic-Antimycotic Solution (100×) Sigma A5955
Dulbecco’s Phosphate Buffered Saline (DPBS) Sigma D8662
Serum Free Media (SFM) Thermo Fisher 10902096
Cytosine arabinoside Sigma C1768
Transfection reagent Thermo Fisher 10362100
Corning cellgro DMSO (Dimethyl Sulfoxide) Corning 25950CQC
Reporter lysis buffer 5x Promega E3971
Luciferase Assay Reagent Promega E1483
96-Well Microplates Corning 3915
Mouse anti-FLAG antibody Wako 014-22383
Rabbit anti-firefly luciferase antibody Abcam ab21176
Mouse anti-actin antibody Sigma A2066
Mouse anti-VSV M N/A N/A Dr. John Connor (Boston University)
Mouse anti-VACV I3L N/A N/A Dr. David Evans (University of Alberta)
8-well Chambered dish Lab-Tek II 155409
Cell viability dye Thermo Fisher C12881
FLUOstar microplate reader BMG Labtech FLUOstar
Confocal microscope Olympus FV10i-LIV
Image analysis software Olympus v1.18 cellSens software
Eppendorf 5702 ventilated centrifuge Eppendorf 22628102
Odyssey Fc Infrared Imaging System Li-COR Biosciences Odyssey Fc
LD652 cells N/A N/A Dr. Basil Arif (Natural Resources Canada)
BSC-40 cells ATCC CRL-2761
BHK cells ATCC CCL-10
HeLa cells ATCC CCL-2
BSC-1 cells ATCC CCL-26
in vitro transcription and purification kit Thermo Fisher AM1626
PCR purification kit Qiagen 28104

DOWNLOAD MATERIALS LIST

References

  1. Nomaguchi, M., Fujita, M., Miyazaki, Y., Adachi, A. Viral tropism. Frontiers in Microbiology. 3, 281 (2012).
  2. Werden, S. J., McFadden, G. The role of cell signaling in poxvirus tropism: the case of the M-T5 host range protein of myxoma virus. Biochimica et Biophysica Acta (BBA) - Bioenergetics. 1784, (1), 228-237 (2008).
  3. McFadden, G., Mohamed, M. R., Rahman, M. M., Bartee, E. Cytokine determinants of viral tropism. Nature Reviews: Immunology. 9, (9), 645-655 (2009).
  4. Silva, J. M., et al. Second-generation shRNA libraries covering the mouse and human genomes. Nature Genetics. 37, (11), 1281-1288 (2005).
  5. Moffat, J., et al. A lentiviral RNAi library for human and mouse genes applied to an arrayed viral high-content screen. Cell. 124, (6), 1283-1298 (2006).
  6. Ma, D., Liu, F. Genome Editing and Its Applications in Model Organisms. Genomics Proteomics Bioinformatics. 13, (6), 336-344 (2015).
  7. Yin, H., Kauffman, K. J., Anderson, D. G. Delivery technologies for genome editing. Nature Reviews: Drug Discovery. 16, (6), 387-399 (2017).
  8. Hao, L., et al. Drosophila RNAi screen identifies host genes important for influenza virus replication. Nature. 454, (7206), 890-893 (2008).
  9. Houzet, L., Jeang, K. T. Genome-wide screening using RNA interference to study host factors in viral replication and pathogenesis. Experimental Biology and Medicine. 236, (8), Maywood, NJ. 962-967 (2011).
  10. Marceau, C. D., et al. Genetic dissection of Flaviviridae host factors through genome-scale CRISPR screens. Nature. 535, (7610), 159-163 (2016).
  11. Savidis, G., et al. Identification of Zika Virus and Dengue Virus Dependency Factors using Functional Genomics. Cell Reports. 16, (1), 232-246 (2016).
  12. Panda, D., Cherry, S. Cell-based genomic screening: elucidating virus-host interactions. Current Opinion in Virology. 2, (6), 784-792 (2012).
  13. Gammon, D. B., et al. A single vertebrate DNA virus protein disarms invertebrate immunity to RNA virus infection. Elife. 3, (2014).
  14. Letchworth, G. J., Rodriguez, L. L., Del cbarrera,, J, Vesicular stomatitis. Veterinary Journal. 157, (3), 239-260 (1999).
  15. Whelan, S. P., Ball, L. A., Barr, J. N., Wertz, G. T. Efficient recovery of infectious vesicular stomatitis virus entirely from cDNA clones. Proceedings of the National Academy of Sciences of the United States of America. 92, (18), 8388-8392 (1995).
  16. Cureton, D. K., Massol, R. H., Saffarian, S., Kirchhausen, T. L., Whelan, S. P. Vesicular stomatitis virus enters cells through vesicles incompletely coated with clathrin that depend upon actin for internalization. PLoS Pathogens. 5, (4), e1000394 (2009).
  17. Duntsch, C. D., et al. Recombinant vesicular stomatitis virus vectors as oncolytic agents in the treatment of high-grade gliomas in an organotypic brain tissue slice-glioma coculture model. Journal of Neurosurgery. 100, (6), 1049-1059 (2004).
  18. Li, Y., Yuan, S., Moyer, R. W. The non-permissive infection of insect (gypsy moth) LD-652 cells by Vaccinia virus. Virology. 248, (1), 74-82 (1998).
  19. Seet, B. T., et al. Poxviruses and immune evasion. Annual Review of Immunology. 21, 377-423 (2003).
  20. Cotter, C. A., Earl, P. L., Wyatt, L. S., Moss, B. Preparation of Cell Cultures and Vaccinia Virus Stocks. Current Protocols in Microbiology. 39, 11-18 (2015).
  21. Andrei, G., et al. Cidofovir resistance in vaccinia virus is linked to diminished virulence in mice. Journal of Virology. 80, (19), 9391-9401 (2006).
  22. Dascher, C., VanSlyke, J. K., Thomas, L., Balch, W. E., Thomas, G. Preparation of recombinant vaccinia virus for expression of small GTPases. Methods in Enzymology. 174-188 (1995).
  23. Martin, A., Rex, E. A., Ishidate, T., Lin, R., Gammon, D. B. Infection of Caenorhabditis elegans with Vesicular Stomatitis Virus via Microinjection. Bio-Protocol. 7, (22), (2017).
  24. Luker, K. E., Hutchens, M., Schultz, T., Pekosz, A., Luker, G. D. Bioluminescence imaging of vaccinia virus: effects of interferon on viral replication and spread. Virology. 341, (2), 284-300 (2005).
  25. Rozelle, D. K., Filone, C. M., Dower, K., Connor, J. H. Vaccinia reporter viruses for quantifying viral function at all stages of gene expression. Journal of Visualizes Experiments. (87), e51522 (2014).
  26. Cao, C., et al. Characterization of the transcriptome of the Asian gypsy moth Lymantria dispar identifies numerous transcripts associated with insecticide resistance. Pesticide Biochemistry and Physiology. 119, 54-61 (2015).
  27. Sparks, M. E., Blackburn, M. B., Kuhar, D., Gundersen-Rindal, D. E. Transcriptome of the Lymantria dispar (gypsy moth) larval midgut in response to infection by Bacillus thuringiensis. PloS One. 8, (5), e61190 (2013).
  28. Sparks, M. E., Gundersen-Rindal, D. E. The Lymantria dispar IPLB-Ld652Y cell line transcriptome comprises diverse virus-associated transcripts. Viruses. 3, (11), 2339-2350 (2011).
  29. Lin, G., Li, G., Granados, R. R., Blissard, G. W. Stable cell lines expressing baculovirus P35: resistance to apoptosis and nutrient stress, and increased glycoprotein secretion. In Vitro Cellular & Developmental Biology - Animal. 37, (5), 293-302 (2001).
  30. Li, W. X., et al. Interferon antagonist proteins of influenza and vaccinia viruses are suppressors of RNA silencing. Proceedings of the National Academy of Sciences of the United States of America. 101, (5), 1350-1355 (2004).
  31. Kanost, M. R., et al. Multifaceted biological insights from a draft genome sequence of the tobacco hornworm moth, Manduca sexta. Insect Biochemistry and Molecular Biology. 76, 118-147 (2016).
  32. Paixao, E. S., Teixeira, M. G., Rodrigues, L. C. Zika, chikungunya and dengue: the causes and threats of new and re-emerging arboviral diseases. BMJ Global Health. 3, (2018).
Infezioni da arbovirus come strumenti di Screening per l'identificazione di fattori virali immunomodulatori e Host antivirale
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Rex, E. A., Seo, D., Gammon, D. B. Arbovirus Infections As Screening Tools for the Identification of Viral Immunomodulators and Host Antiviral Factors. J. Vis. Exp. (139), e58244, doi:10.3791/58244 (2018).More

Rex, E. A., Seo, D., Gammon, D. B. Arbovirus Infections As Screening Tools for the Identification of Viral Immunomodulators and Host Antiviral Factors. J. Vis. Exp. (139), e58244, doi:10.3791/58244 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter