Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Immunology and Infection

Infecciones del arbovirus como herramientas de detección para la identificación de factores antivirales inmunomoduladores y anfitrión Viral

doi: 10.3791/58244 Published: September 13, 2018

Summary

Aquí, presentamos los protocolos para identificar inmunomoduladores 1) virus-codificado que promueven la replicación de arbovirus y host 2) eucariotas factores que limitan la replicación de arbovirus. Estos métodos basados en fluorescencia y luminiscencia permiten a los investigadores obtener rápidamente lecturas cuantitativas de la replicación de arbovirus en análisis simplistas con proporciones bajas de señal a ruido.

Abstract

Interferencia de RNA - y genoma de edición basados en plataformas de detección han sido ampliamente utilizados para identificar los factores de la célula huésped que limitan la replicación del virus. Sin embargo, estas pantallas se realizan normalmente en las células que son naturalmente permisivas al patógeno viral bajo estudio. Por lo tanto, la sólida réplica de virus en condiciones de control puede limitar el rango dinámico de estas pantallas. Además, estas pantallas no puede identificar fácilmente las vías de defensa celular que limitan la replicación del virus si el virus es capaz de contrarrestar las defensas antivirales y bien adaptado al host. En este artículo, describimos un nuevo paradigma para explorar interacciones virus-huésped mediante el uso de pantallas que a abortado naturalmente infecciones por arbovirus como el virus de la estomatitis vesicular (VSV). A pesar de la capacidad de VSV para replicar en una amplia gama de insecto díptero y anfitriones mamíferos, VSV experimenta una infección abortiva post entrada en una variedad de líneas celulares derivadas de insectos lepidópteros, como la polilla gitana (Monacha anaerobias). Sin embargo, estas infecciones abortivas de VSV pueden ser "rescatadas" cuando las defensas antivirales de la célula anfitrión están en peligro. Describimos cómo VSV cepas codificación genes del reportero conveniente y restrictivas dispar L. líneas celulares pueden ser asociadas a las pantallas de configuración para identificar factores de host involucrados en la restricción de arbovirus. Además, también mostramos la utilidad de estas herramientas de investigación en la identificación de factores codificados viralmente que rescatar replicación VSV durante la coinfección o a través de la expresión ectópica, las codificadas por los virus de mamíferos incluidas. La restricción natural de replicación de VSV en dispar L. células proporciona una alta relación señal a ruido cuando la detección de las condiciones que promueven el rescate VSV, permitiendo el uso de simplista luminiscencia y fluorescencia-ensayos para controlar los cambios en la replicación del VSV. Estas metodologías son valiosas para la comprensión de la interrelación entre respuestas antivirales del huésped y factores de evasión inmune viral.

Introduction

La capacidad de un virus para replicar productivamente en un anfitrión particular se rige en parte por la disponibilidad de factores de la célula huésped que admiten entrada viral y replicación1. La gama de virus también puede ser dictada por la capacidad de un virus a contador celular antiviral las defensas que de lo contrario impediría la replicación viral2,3. Es el resultado de estas interacciones virus-huésped complejos que en última instancia decide si un virus será capaz de completar su ciclo de vida en un anfitrión particular. Dadas las consecuencias potencialmente patógenas para el host si sobreviene la replicación viral, es fundamental para el desarrollo de estrategias experimentales para mejorar nuestra comprensión de las interacciones virus-huésped claves que pueden inclinar la balanza entre abortivos y productivo infecciones. Dilucidar las características moleculares de la interacción virus-huésped será instrumental en el desarrollo de estrategias terapéuticas antivirales nuevos y alternativos.

Con el advenimiento del RNA de interferencia (ARNi)4,5 y herramientas de edición de genoma (e.g., CRISPR Cas9, Zinc finger nucleasas, TALENs)6,7, se ha convertido en experimentalmente factible modificar el expresión de factores celulares de todo el genoma de escalas y explorar el impacto de estas alteraciones en la replicación del virus. De hecho, se han realizado numerosos ARNi y genoma de edición basado en pantallas en tipos de la célula huésped invertebrados y vertebrados que han dado a conocer nuevas facetas de interacción virus-huésped8,9,10, 11 , 12. estas pantallas suelen emplean virus codificación reporteros, como luciferasa de luciérnaga (LUC) o proteínas fluorescentes (e.g., GFP, DsRed), que proporcionan medios convenientes de evaluar cuantitativamente la expresión viral del gene como una lectura para la replicación viral9,12. Esta estrategia permite a los investigadores a identificar los factores de huésped que sea promoverán o antagonizan la replicación viral como lo demuestran los aumentos o disminuciones, respectivamente, en reportero viral señales9,12. Sin embargo, en la mayoría de los casos, estas pantallas se han realizado utilizando virus que están bien adaptadas para el tipo de célula de host en el que se están estudiando. Mientras que esta estrategia puede ser importante para la comprensión de las relaciones coevolutivas entre los patógenos virales y sus anfitriones naturales, existen preocupaciones fundamentales en cuanto a su uso en descubrir factores antivirales de host. En estos casos, una mejora en reporter virus señal sobre RNAi caída está siendo buscada, o la inactivación de un factor celular que normalmente impide la replicación viral. En primer lugar, si un virus ya es capaz de replicar enérgicamente en la célula huésped siendo examinada bajo condiciones de control, el rango dinámico de la pantalla (es decir, la capacidad de distinguir entre fondo y señales mejoradas reportero viral) puede ser limitado. En segundo lugar, este problema se agrava aún más por las situaciones en que el virus está bien adaptada a la célula huésped y eficaz en la lucha contra vías de defensa del anfitrión que se apunta en la pantalla.

Debido a las preocupaciones anteriores sobre interacción virus-huésped tradicionales métodos de cribado, se desarrolló un nuevo paradigma para el estudio de las interacciones virus-host que explotan infecciones del arbovirus naturalmente abortiva en células de los insectos lepidópteros. Esta estrategia deriva de una observación que los arbovirus humanos estudiados, VSV, sufre una infección abortiva en las células derivadas de la polilla gitana (L. anaerobias)13. VSV es transmitido naturalmente por insectos díptero (es decir, moscas de la arena) a los anfitriones mamíferos y se ha demostrado experimentalmente para infectar a una amplia gama de invertebrados y vertebrados hospedadores en celular cultivo e in vivo14. El genoma de ARN monocatenario de 11 kb sentido negativo de VSV codifica cinco mRNAs subgenómico que cada uno se traducen a las proteínas que forman el virión envuelto. Sin embargo, sistemas genéticos inversos VSV han permitido la creación de cepas réplica-competente codificación de LUC o proteínas fluorescentes, además de los cinco naturales VSV gene productos15,16,17. Porque estas proteínas del reportero no se incorporan en el virión VSV, proporcionan una lectura conveniente para la expresión de gene VSV que ocurre post entrada. Utilizando cepas VSV codifican GFP o LUC, previamente hemos demostrado que genes VSV es seriamente restricto a la entrada de las células LD652 y que títulos VSV no aumentan por la infección después de 72 horas (hpi). En contraste, la coinfección de células LD652 con VSV y los mamíferos poxvirus, virus vaccinia (VACV), conduce a aumento logarítmico en la expresión génica VSV y los títulos por este momento. VACV experimenta la expresión temprana de genes, replicación del ADN y tardía expresión génica en las infecciones LD652 de la célula, pero el ciclo de replicación VACV es en última instancia infructuoso debido a virión incompleta morfogénesis18. El genoma de ADN ~ 192 kb grande de VACV codifica proteínas > 200, muchos de los cuales mostrar propiedades inmunomoduladoras que promueven la replicación viral a través de la supresión del anfitrión inmunorespuestas19. Por lo tanto, la hipótesis de que el "rescate" de la replicación de VSV en células LD652 por coinfección VACV fue probablemente mediado por VACV inmunomoduladores que inhibían dispar L. respuestas normalmente restringir la replicación del VSV. En apoyo de esto, el tratamiento de las células LD652 con el inhibidor de host RNA polimerasa II actinomicina D también rescata replicación VSV en células LD652, que indica que las respuestas de acogida dependiente de la transcripción cuadra VSV replicación post entrada13.

Las observaciones anteriores sugieren que la naturaleza naturalmente restrictiva de las células LD652 a la infección de VSV puede proporcionar un fondo relativamente bajo cuando la detección de las condiciones que mejoran las señales reportero VSV-codificado (es decir, los que inhiben la host defensas antivirales). Aquí, ofrecemos los métodos para el uso de fluorescencia o ensayos de LUC a pantalla para condiciones que aliviar la restricción de VSV en células de lepidópteros. En primer lugar, mostramos cómo estos ensayos pueden utilizarse para identificar los factores inmunomoduladores virally codificado que restricción de VSV durante cualquiera de los dos experimentos de coinfección o a través de la expresión ectópica de factores virales candidato. Por ejemplo, ilustramos cómo utilizamos estas técnicas de proyección para identificar poxvirus codifican proteínas de A51R como una nueva familia de factores inmunomoduladores que rescatar replicación de VSV en ausencia de otros factores de poxvirus13. En segundo lugar, ilustramos cómo ARNi en restrictivas VSV-LD652 infecciones de células se puede utilizar para identificar directamente factores eucarióticos host arbovirus restricción13.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. general Monacha dispar (LD652) celular y cultivo de Virus

  1. LD652 célula de cultivo y de la galjanoplastia
    1. A la cultura dispar L.-derivado de las células LD652, mantener una monocapa de células en un medio de crecimiento (Tabla de materiales) se incubaron a 27 ° C en atmósfera normal. Mantener las células en platos tratados con tejido y cultura de 10 cm y paso de las células al llegar al 80% de confluencia.
    2. Para placa, desalojar las células adherentes de LD652 de la placa transfiriendo los medios de comunicación varias veces en la monocapa (estas células no requieren la tripsinización para desalojar) y diluir la muestra en medios de cultivo a una densidad aproximada de 1 x 105 células/mL. Pipetear 1 mL de cultura diluida/pozo de una placa de 24 pocillos. Un mínimo de tipo de tratamiento de pozos replicar o tres para cada punto de tiempo (un máximo de ocho tratamientos/placa) de la semilla.
    3. Permitir que las células que conformarse con un mínimo de 1 h.
  2. Preparación de virus de vaccinia
    1. Para preparar las acciones de VACV, amplifican el virus en HeLa células20 o células de riñón de mono verde africano (células BSC-1 o BSC-40)20,21,22.
      Nota: Cepa VACV Western Reserve (VACV-WR) funciona bien en los ensayos aquí descritos.
    2. Valorar el VACV cepa mediante placa ensayo en BSC-1 o células de BSC-4020,22.
      Nota: Todos indican multiplicidad VACV de infección (MOI) descrito aquí para LD652 infecciones de células se basan en títulos obtenidos de ensayos de placa de BSC-40.
  3. Preparación de virus de estomatitis vesicular
    1. Para preparar las acciones VSV, amplifican el virus en las células BHK23.
    2. Valorar VSV por ensayo de placa de BSC-40 o BHK células monocapas13,23.
      Nota: Todos los MOIs de VSV descrito aquí para LD652 infecciones de células se basan en títulos obtenidos de ensayos de placa de BSC-40.

2. VSV fluorescencia basada en ensayo de rescate usando proyección de imagen de células vivas y coinfección

  1. Siembra y la infección de las células LD652
    1. LD652 40.000 células/pozo de una cámara de 8 pocillos de la placa.
    2. Basados en fluorescencia células vivas imágenes, usar cepas VSV que codifican las proteínas fluorescentes. Los experimentos presentados aquí utilizan VSV-DsRed17, una cepa recombinante de VSV que expresa la proteína DsRed libre que no está fusionada a cualquier otra proteína VSV.
      Nota: VSV la infección de las células LD652 no es citopática por hpi 96 y, por lo tanto, la muerte celular no es un factor de confusión al evaluar la replicación VSV dentro de este marco de tiempo.
    3. Preparar VSV-DsRed y VACV-FL-GFP en un medio libre de suero (MFS; Tabla de materiales) en una MOI de 1 y 25, respectivamente.
      Nota: VACV-FL-GFP es una cepa recombinante de VACV que expresa una fusión entre LUC y GFP24. Usando una MOI de 25 o mayor para las cepas VACV asegura que todas las células del LD652 infectado13. Si está usando un virus coinfecting diferente, el Ministerio del interior tendrá que ser determinado empíricamente por el usuario. Cada tratamiento de la infección debería establecerse en los pocillos duplicados e incluyen tratamientos mock-infectados en los que sólo SFM se agrega a las células.
    4. Incubar las células en 0,2 mL de inóculo por 2 h a 27 ° C.
    5. Lavar las células con 0.5 mL o de medios de cultivo.
    6. Incubar las células en 25 μM de tinte de viabilidad celular (Tabla de materiales) en medios de cultivo durante 45 minutos a 27 ° C.
    7. Los medios de comunicación de aspirar y lavar los pocillos 1 x con 0.5 mL o bien para eliminar el exceso de tinte.
    8. Mantener las células en 0,3 mL/pozo de los medios de crecimiento.
  2. Captura de imágenes de células en vivo
    1. Encienda un microscopio confocal 30 min de anticipación y un plato de cámara 8-pozo de carga.
      Nota: LD652 las células pueden ser reflejadas a temperatura ambiente entre 20-25 º C, pero para condiciones óptimas, debe ajustarse la temperatura de la habitación a 27 ° C.
    2. Establecer la configuración adecuada de excitación/emisión para cada proteína del marcador fluorescente al ser reflejada, así como la configuración de imagen de contraste de fase.
    3. Ajustar la intensidad del láser para cada canal.
      Nota: Esto puede requerir ejecutar un experimento piloto para determinar el rango de intensidades de la señal fluorescente observada durante todo el tiempo para ser utilizado en el experimento final.
    4. Usando el objetivo de X 10, captura las imágenes de contraste y de la fluorescencia de fase de cada bien cada 1, 5 h para la duración de la infección hasta un punto del tiempo deseado (por ej., 48 – 72 hpi).
      Nota: Es importante capturar múltiples campos de vista en cada pozo para estimar con precisión las tasas de infección a través de la cultura.
  3. Análisis de imagen
    1. Utilizar software de análisis de imagen para análisis de imagen automatizado de canales adecuados de fluorescentes (e.g., 405 nanómetro, 488 nanómetro, 568 nm).
    2. Para calcular el porcentaje de células que están infectadas, dividir el número total de células fluorescentes indicando infección de VSV (por ej., células DsRed-positivos para las infecciones de VSV-DsRed) por el número total de células viables por tinte de viabilidad celular para cada campo de visión a través de todos los tratamientos.

3. general infección Viral protocolo para ensayos de rescate VSV luminescencia-basado en las células LD652

  1. Preparación del inóculo
    1. 30 min antes de la infección, descongelar las existencias de VSV-LUC16 (un recombinante VSV tensión expresa proteína luciferasa de luciérnaga libre no unida a cualquier otra proteína VSV). Si ensayando para el rescate de VSV-LUC durante la coinfección VACV, también descongelar el virus VACV-WR en el hielo.
      Nota: Otros virus (además de VACV-WR) pueden rescatar VSV-LUC durante la coinfección, pero esto tendrá que ser determinado empíricamente por cada usuario.
    2. Preparar el inóculo diluyendo VSV-LUC en la presencia o ausencia de VACV-WR en SFM que una MOI de 10 y 25, respectivamente, se obtiene cuando se agrega un volumen de inóculo total de 0,2 mL/pozo.
  2. Infección de las células
    1. Aspire maduros LD652 medios con cuidado para evitar molestar a la monocapa e inocular 0,2 ml de virus/bien. Este tiempo se define como 0 hpi. Añadir estéril SFM a pozos adicionales para servir como "mock-infectado" tratamientos de control negativo.
    2. Incubar las células en el inóculo por 2 h a 27 ° C.
    3. En hpi 2, retirar el inóculo por la aspiración de reemplazar con 1 mL y bien LD652 medios del crecimiento.
    4. Permiten la infección proceder a 24 – 72 hpi.

4. ensayo de luciferasa

  1. Preparación de lysates de la célula
    1. Cuidadosamente aspirar el sobrenadante y agregar 1 mL de solución salina de Dulbecco tamponada con fosfato (DPBS) bien.
    2. Utilizando el émbolo de una jeringa de 1 mL, raspar las células en DPBS.
    3. Transferir las células a un tubo de microcentrífuga y centrifugar a 400 x g por 20 min a 4 ° C.
    4. Mientras tanto, preparar la dilución de x 1 de 5 x buffer de lisis reportero (RLB) en estéril de H2O.
    5. Después de la centrifugación, Aspire la DPBS sin perturbar el sedimento celulares.
    6. Resuspender cada precipitado en 150 μL de 1 x RLB.
    7. Congelación y descongelación de las muestras 1 x usando una incubación de 5 minutos en un congelador de-80 ° C seguido de un rápido deshielo en un baño de agua temperatura ambiente. Almacenar los lisados a-80 ° C hasta que esté listo para analizar.
  2. Ensayo de luciferasa
    1. Descongelar los lisados en el hielo.
    2. Pipetear 20 μL de lisado en un pozo de una microplaca de 96 pozos negro o blanco sólido.
    3. Añada 100 μL de reactivo de ensayo de luciferasa a cada pocillo.
    4. Medir inmediatamente la intensidad de la luz utilizando un luminómetro (ajustes apropiados para luminómetros específico tendrá que ser determinado empíricamente por el usuario).
  3. Análisis de ensayo de luciferasa
    1. Normalizar el LU señales para cada tratamiento para lecturas de LU obtenidos de tratamientos de control (Resultados de representante). Después de que se han realizado por lo menos tres experimentos independientes, puede analizarse la media que Lu obtenida de cada grupo de tratamiento y control de pruebas estadísticas apropiadas.

5. Immunoblot

  1. Uso de lisados extraídos de los ensayos LUC para SDS-PAGE y el immunoblotting posterior, usando instrumentación y reactivos adecuados.

6. título de VSV de cultivos de células de LD652

  1. Células LD652 de la placa según el paso 1.1.
  2. Virales infectan las células según el paso 3.
  3. En puntos de tiempo deseado, recoger el sobrenadante en tubos estériles de microcentrífuga.
  4. Sedimenten las células usando 1.000 x g durante 10 min a 4 ° C y transferir el sobrenadante a tubos de nuevo.
  5. Guarde el sobrenadante a-80 ° C o proceder con la titulación de ensayo de placa de BSC-40 células.
    Nota: Si valorar VSV de cultivos de células de LD652 que contenía VACV, es aconsejable añadir 100 μg/mL el arabinósido de citosina (AraC) a los medios de cultivo de BSC-40 dentro de hpi 2, para evitar que las partículas residuales de VACV formando placas en monocapas de BSC-4013. AraC es un inhibidor de la ADN polimerasa viral que bloquea la replicación de ADN VACV25 pero no afecta a la replicación de VSV.

7. variaciones de VSV basados en luminiscencia rescatar ensayos en células LD652: ARNi y experimentos de transfección del plásmido

  1. Preparación de dsRNA de caída RNAi-mediada de viral o transcripciones
    1. Cartillas de gene-específicas del diseño de cola en el extremo 5' con la secuencia de promotor de T7 (TAATACGACTCACTATAGGG) o dirigirse a coinfecting virus (p. ej., VACV) o dispar L. certificados de ARNm de interés. Estos iniciadores deben producir un producto PCR de 400 – 600 bp por caída efectiva de RNAi-mediada. Ver Gammon et al. 13 para las secuencias de la cartilla solía debajo de precipitación VACV o dispar L. transcripciones por RNAi mediado por el dsRNA en las células LD652.
      Nota: Dispar L. mRNA las transcripciones pueden ser identificadas desde publicado dispar L. transcriptoma bases de datos26,27,28.
    2. Generar un ADN plantilla mediante RT-PCR (síntesis de cDNA: 1 ciclo de 50 ° C para 30 min; PCR: 40 ciclos de 94 ° C por 15 s, 50 ° C para 30 s y 68 ° C por 45 s cada uno).
    3. Purificar el producto PCR utilizando un kit de potabilización de la polimerización en cadena.
    4. Usando el producto PCR purificado como plantilla, vitro en transcribir y purificar el dsRNA utilizando una en vitro transcripción y purificación kit.
  2. Transfección de dsRNA o ADN plásmido en las células LD652
    1. Semilla 1 x 105 células/pocillo de una placa de 24 pocillos y dejar que las células a reposar al menos 1 h.
    2. Para que cada pozo a ser transfectadas, diluir 4 μL de reactivo de transfección en 100 μL de la OFS. Incubar a 15 min a temperatura ambiente. Esto puede ampliarse para hacer una mezcla maestra de transfecciones todos a realizar.
    3. Diluir hasta 1 μg de dsRNA o ADN de plásmido total con 100 μL de SFM para cada pozo a ser transfectadas. Incubar a 15 min a temperatura ambiente.
      Nota: Previamente hemos encontrado que una transfección de 1 μg de dsARN/105 LD652 células es suficiente para > 80% caída de ya sea viral o transcripciones13, pero dosis de dsARN necesarios para modificados experimental set-ups y condiciones tendrá que determinarse empíricamente.
    4. Diluciones de transfección reactivos y dsRNA/plásmido de DNA con una proporción de 1:1 se combinan (e.g., 100 μL de dsRNA diluido se mezcla con 100 μL de reactivo de transfección diluido) e incubar por 20 min a temperatura ambiente.
    5. Mientras tanto, lavar los pocillos con 1 mL/pozo de la OFS y luego añadir 500 μL de la OFS a cada pocillo.
    6. Lentamente agregar el reactivo de transfección dsRNA (o ADN plásmido) mezcla gota a gota en cada pocillo.
    7. Incubar el reactivo de transfección con las células de 5 horas.
      1. Para RNAi experimentos que implican la caída de la transcripción codificado por el virus coinfecting (p. ej., VACV), vuelva a colocar el reactivo de transfección después del período de incubación de 5 h de la transfección con inóculo de virus que contiene VSV-LUC (con o sin VACV o otro virus coinfecting) (paso 3). Posteriormente, vuelva a colocar el inóculo de virus que contiene VSV-LUC con crecimiento completo media 2 hpi. Ensayos de LUC (paso 4) pueden entonces realizarse en lisados extraídos en diferentes puntos del tiempo para determinar si la caída de coinfecting transcripciones del virus conduce a una pérdida de rescate VSV-LUC.
      2. Para experimentos de RNAi con RNAi de dispar L. transcripciones, vuelva a colocar la mezcla de transfección con medios de crecimiento completa y permitirá a derribo a sobrevenir durante 24 h antes de la infección con VSV-LUC (paso 4). Ensayos de LUC (paso 4) pueden entonces realizarse en lisados extraídos en diferentes puntos del tiempo para determinar si la caída de las transcripciones de dispar L. promueve rescate de VSV-LUC.
      3. Para experimentos transfecciones de vectores de expresión de plásmidos expresar candidato inmunomoduladores, vuelva a colocar el reactivo de transfección y permitir la expresión de la proteína durante 24 h antes de la infección con VSV-LUC (paso 4). Ensayos de LUC (paso 4) pueden entonces realizarse en lisados extraídos en diferentes puntos del tiempo para determinar si la expresión de proteínas inmunomoduladoras de candidato promueve rescate de VSV-LUC.
        Nota: Las transfección condiciones descritas aquí en 1 μg/pocillo de resultado de ADN de plásmido de eficacias de transfección de 40 – 60%13.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Como ejemplo de células vivas aplicaciones para supervisar el rescate VSV en coinfección VACV, LD652 células fueron plateadas en un pozo de 8 cámara plato y mock-infectados o infectadas con VSV-DsRed (MOI = 1) en la presencia o ausencia de VACV-FL-GFP (MOI = 25). Porque VSV-DsRed expresa DsRed como una proteína libre y no está unido a proteínas estructurales de VSV (figura 1A), sólo se detecta después de inicia de VSV entrada y expresión genética. Todas las células entonces fueron etiquetadas con tinte de viabilidad celular que pasa libremente a través de la membrana plasmática de las células, donde se convierte en un producto membrana impermeant, que promueve la retención de la señal fluorescente en células marcadas. Imágenes fueron adquiridas cada 5 h hasta 65 hpi, con el 405 nanómetro, 488 nanómetro, 568 nm y blanca luz filtros para capturar el tinte de viabilidad celular, VACV-FL-GFP, VSV-DsRed y canales (PC) de contraste de fase, respectivamente. Bajo condiciones de una infección, las células LD652 restringen VSV-DsRed replicación; por lo tanto, sólo un pequeño número de células exhibe una señal DsRed. Sin embargo, la coinfección de VSV-DsRed con VACV-FL-GFP resultados en la mayoría de las células mostrando señales DsRed por el final del curso del tiempo (figura 1B). Imágenes capturadas en cada momento se sometieron a software de análisis de imagen, donde 405 nm y 568 nm canal imágenes fueron utilizadas para determinar automáticamente el total y número de células positivas DsRed, respectivamente. El porcentaje de células mostrando una señal DsRed para cada tratamiento se calcula dividiendo objetos (células) con una señal positiva en el canal de 568 nm el número de objetos en el canal 405 de nm para cada punto del tiempo, seguido por la multiplicación por 100% . Como se muestra en la figura 1, ~ 2% de las células de VSV-DsRed infecciones solo eran positivos DsRed por hpi 65. Por el contrario, ~ 77% de las células de VSV-DsRed + coinfecciones VACV-FL-GFP eran DsRed-positivos en este momento. Películas de S1 y S2 muestran la progresión de la infección de VSV-DsRed a lo largo de todo el tiempo 65-h solo infección y las condiciones de la coinfección, respectivamente. Es importante tener en cuenta que la expresión de GFP por VACV-FL-GFP llegó a ser perceptible por 10 hpi, antes de la señal de la DsRed, indicando que suficiente expresión del gen VACV es requerida antes de VSV-DsRed rescate (no mostrado). Colectivamente, estos resultados indican claramente un rescate de la replicación de VSV-DsRed por coinfección VACV. Si un virus coinfecting pudo rescatar VSV-DsRed, esperamos iguales porcentajes de células DsRed-positivas entre una infección y los tratamientos de coinfección.

Replicación de VSV en células LD652 también puede cuantificarse mediante ensayos basados en luminiscencia cuando utilizando cepas de VSV-LUC (figura 2A). Por ejemplo, la figura 2B muestra los resultados de un ensayo de LUC utilizando lisados preparado sobre un curso de tiempo de 72 h de las células infectadas de mofa o células infectadas con VSV-LUC (MOI = 10) en la presencia o ausencia de VACV-WR (MOI = 25). Un rescate positivo de replicación VSV-LUC se indica por el aumento logarítmico de LU arbitraria con lisados de células co-infectados, comparadas con lisados de solo infecciones de VSV-LUC. Un resultado negativo estaría indicado en este ensayo por la falta de una coinfección de alterar las lecturas de la LU de los observados en tratamientos de infección de VSV-LUC solo. Si lo desea, lisados preparado pueden también usarse para immunoblotting, para confirmar la mayor expresión de genes VSV en tratamientos de coinfección. Por ejemplo, figura 2 muestra un resultado típico immunoblot LUC codificado de VSV y matriz (M) proteínas en lisados de mock, VSV-LUC y VSV-LUC + VACV-WR tratamientos 72 hpi. Immunoblotting VACV I3L proteína sirve como marcador de infección VACV, y immunoblotting para actina celular fue utilizado como un control de carga. La clara mejora de proteínas codificada VSV LUC y M en los lisados de coinfección más confirman rescate VSV por VACV. Por último, replicación de VSV productiva puede confirmarse por recolección de sobrenadantes de estas culturas de célula LD652 y valoración de un virus infeccioso en monocapas de BSC-40 (Figura 2D). Este resultado muestra que solamente durante VACV coinfección no VSV productivamente replicar.

Cuando un virus coinfecting se muestra capaz de rescatar a replicación de VSV en células LD652, proyección de RNAi puede utilizarse para identificar factores codificados por el virus coinfecting que contribuyen al rescate VSV. En este experimento, la pantalla para una condición de RNAi que conduce a un fenotipo de «pérdida de rescate» durante la coinfección de VSV-LUC con el virus de un rescate. Anteriormente se identificaron la proteína VACV A51R como factor de rescate VSV a través de una proyección de ARNi de docenas de transcripciones VACV-codificado13. Como ejemplo, hemos recapitulado una versión más pequeña de la escala de esta pantalla (figura 3). Arni está mediada por la transfección de in vitro transcritos dsRNAs que apuntan transcripciones codificadas por el virus coinfecting. En los datos mostrados aquí, transcripciones virales codifican las proteínas VACV A50R, A51R y A52R fueron destinadas a la caída de RNAi. Como control negativo por pérdida de rescate, las células fueron también transfected con dsRNAs a transcritos codifican GFP. Como control positivo para una pérdida de fenotipo de rescate, las células fueron transfectadas con dsRNAs contra LUC-codificación de las transcripciones. Este tratamiento produce una fuerte pérdida de la señal de LU durante la coinfección y ayuda a los investigadores a confirmar que los protocolos de la transfección/RNAi están trabajando. Después de 5 h de la transfección de dsRNA, las células estaban co-infectados con VSV-LUC (MOI = 10) y VACV-WR (MOI = 25). También se realizaron infecciones separadas con sólo VSV-LUC para establecer un nivel de fondo de señal de LU. Lisados fueron entonces cosecharon 72 hpi y utilizan en un ensayo de LUC. Comparando el nivel de rescate VSV por dsRNA tratamientos para el tratamiento de control de dsRNA GFP, los resultados indican que la caída de VACV A51R produce una fuerte pérdida del fenotipo de rescate, mientras que la caída de A50R y A52R produce un resultado negativo (sin pérdida de rescate en comparación con GFP dsRNA).

Como alternativa a ARNi cribado para identificar los factores virales que contribuyen al rescate VSV, sobreexpresar factores virales candidato en células LD652 y luego ensayo para rescate de VSV-LUC. Esto puede lograrse por clonación de genes candidatos de interés en vectores de expresión apropiada como p16629 y transferencia de estos plásmidos a las células LD652 antes el desafío de VSV-LUC. Como ejemplo, Figura 4A muestra un experimento de rescate tagged bandera GFP (FGFP) o bandera con la etiqueta A51R (FA51R) p166 vectores fueron transfected en las células LD652 a diferentes concentraciones, seguidas por infección de VSV-LUC (MO = 10) 24 h más tarde. Como control negativo para el rescate de VSV, culturas adicionales fueron transfectadas mock y no recibe ADN de plásmido. Lisados de culturas 72 hpi se recolectaron y fueron sometidos a ensayos LUC. FA51R tratamientos produjeron un resultado positivo de rescate VSV según lo demostrado por las señales mejoradas de LU sobre tratamientos mock-transfected en dosis múltiples. En cambio, FGFP tratamientos fueron negativos para el rescate VSV en cualquier dosis probadas. Immunoblotting de los lisados de Figura 4A confirmó una expresión similar de proteínas FGFP y FA51R (Figura 4B).

Usando una proyección de ARNi de factores L. anaerobias candidato, hemos demostrado que la restricción de VSV en LD652 células es mediada por varios factores celulares pertenecientes a caminos RNAi antivirales (p. ej., antes2 y Dicer-2), el Factor Nuclear kappa B (NF-κB)-camino de IMD relacionada (p. ej., condimento)y el sistema ubiquitina-proteasoma (e.g., poliubiquitina)13. Como ejemplo, hemos repetido una versión más pequeña de la escala de estos experimentos de RNAi con dsRNAs a dispar L. transcripciones que replicación de VSV-LUC en caída (e.g., antes2, Dicer-2, Relish, poliubiquitina) o no tuvo ningún efecto (AGO1 )13. Después de 24 h de dsRNA de la transfección, las células fueron desafiadas con VSV-LUC durante 72 h para determinar si ARNi tratamientos mejorado LU señales sobre los tratamientos de dsRNA GFP de control negativo. Tratamientos de RNAi que mejoran las señales LU indican que el factor codificado por la transcripción específica restringe la replicación de VSV. Como control positivo para caída de ARNi, dsRNAs a LUC-codificación de las transcripciones también fueron transfectadas en tratamientos paralelos. Debido al bajo fondo LU señales detectadas en tratamientos de control de dsRNA GFP, era relativamente sencillo identificar los factores de restricción codificadas de host utilizando RNAi proyección porque su caída produce ~ 10-aumentos 1,000-fold en señales LU ( Figura 5). Por lo tanto, es posible aprovechar el fondo relativamente bajo nivel de expresión génica VSV en células LD652 para detectar host ARNi precipitación las condiciones que aliviar la restricción de VSV.

Figure 1
Figura 1: identificación de rescate VSV por coinfection del virus de las células de LD652 usando proyección de imagen de células vivas basadas en fluorescencia. (A) este panel muestra un diagrama esquemático de un genoma de VSV-DsRed indicando la ubicación del gen DsRed (dR). Imágenes de microscopía confocal (B) estos representante 10 X son capturados 60 hpi. Canal 405 nm indica una tinción para células viables, el canal de 488 nm indica infección VACV-FL-GFP y el canal de 568 nm indica infección VSV-DsRed. También se muestran imágenes de contraste (PC) de fase. Barras de escala = 100 μm. (C) este panel muestra el porcentaje de células positivas DsRed LD652 sobre el curso del tiempo todo 65 h infección. Se muestra el porcentaje de (SD) media de las células mostrando una señal DsRed para cada punto del tiempo. Haga clic aquí para ver una versión más grande de esta figura.

Figure 2
Figura 2: evaluación de rescate VSV en LD652 celdas usando ensayos LUC. (A) este panel muestra un diagrama esquemático de un genoma de VSV-LUC. (B) este panel muestra unidades arbitrarias de luz ensayos (LUC) de lisados de células infectadas por mock o células infectadas con VSV-LUC, en la ausencia o presencia de VACV-WR. (C) este panel muestra un immunoblot de LUC, VSV M, VACV I3L y proteínas actina celular en los lisados de panel A recogen 72 hpi. (D) este panel muestra títulos de VSV-LUC en sobrenadantes de cultivo obtenidas del panel B. Los datos cuantitativos en los paneles B y D representan los medios (± SD) de experimentos llevados a cabo por triplicado. Haga clic aquí para ver una versión más grande de esta figura.

Figure 3
Figura 3: identificación de un factor de rescate VSV codificados viralmente a través de la proyección de ARNi durante la coinfección de células LD652. Este panel muestra cambios de doblez en LU detectado en lisados de células 72 hpi con VSV-LUC y VACV-WR después del tratamiento indicado de ARNi, en relación con LU en lisados de células infectadas solo con VSV-LUC. Los datos representan los medios (± SD) de experimentos llevados a cabo por triplicado. Haga clic aquí para ver una versión más grande de esta figura.

Figure 4
Figura 4: rescate de VSV por la sobreexpresión de un inmunomodulador viral en las células de LD652. (A) este panel muestra un LUC ensayo de células infectadas con VSV-LUC 72 hpi que fueron transfectadas de mock (mock) o transfected con los plásmidos de expresión p166 o FGFP o FA51R. LU las señales de cada tratamiento se normalizaron a las señales detectadas en tratamientos de control transfected mock. Los datos representan los medios (± SD) de experimentos llevados a cabo por triplicado. (B) este panel muestra lisados de panel A, immunoblotted con los anticuerpos de la actinia y bandera. Haga clic aquí para ver una versión más grande de esta figura.

Figure 5
Figura 5: factores de identificación de host restrinja replicación de VSV en células LD652 a través de la investigación de RNAi. Este panel muestra que el pliegue cambia señales de LU en tratamientos de ARNi indicados en relación con la GFP dsARN control tratamientos 72 hpi con VSV-LUC. Los datos representan los medios (± SD) de experimentos llevados a cabo por triplicado. Haga clic aquí para ver una versión más grande de esta figura.

Película S1: representante de 405 nm (tinte de viabilidad celular) y 568 nm (DsRed) canal imágenes en un transcurso de tiempo de 65 h (cada fotograma = 5 h intervalo) después de la infección de VSV-DsRed de células LD652. Haga clic aquí para descargar este archivo.

Película S2: representante de 405 nm (tinte de viabilidad celular) y 568 nm (DsRed) canal imágenes en un transcurso de tiempo de 65 h (cada fotograma = intervalo de 5 h) después de coinfección de células LD652 con VSV-DsRed y VACV-FL-GFP. Haga clic aquí para descargar este archivo.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Aquí hemos descrito simple fluorescencia y luminiscencia-ensayos para detectar condiciones que rescatar replicación de VSV en cultivos celulares de lepidópteros restrictivas. La infección abortiva de VSV en lepidópteros células crea una excelente relación señal-ruído cuando ensayando para la expresión de gene VSV. Por ejemplo, las señales de LU en lisados de infecciones VSV-LUC solo eran ~ 1,000-fold superior en mock-infectados lisados, pero estas señales solamente cambiaron aproximadamente doble en un transcurso de tiempo 72 h. En contraste, la coinfección de VSV-LUC con VACV mejorado señales LU ~ 300-fold sobre single infecciones VSV-LUC de 72 hpi. Por lo tanto, VSV rescate ensayos muestran un excelente rango dinámico, que abarca varios órdenes de magnitud.

Uno de los pasos críticos en la creación de estos ensayos consiste en la decisión de ensayo para el rescate VSV con enfoques basados en fluorescencia o luminiscencia. Hemos mostrado ejemplos de cómo VSV-codificado DsRed señales pueden ensayarse cuantitativamente usando técnicas de imágenes de células vivas y paquetes de software que facilitan la cuantificación automática de células DsRed-positivas en la ausencia o presencia de un rescate coinfección. Si los investigadores tienen acceso a las capacidades de imágenes de células vivas, estos ensayos son baratos y que puedan captar una amplia gama de puntos de tiempo que puede ayudar en la detección de diferencias en la cinética de replicación de VSV que son solamente observables en tiempo estrecho Windows. En contraste, los enfoques basados en luminiscencia son esencialmente ensayos de punto final que requieren la preparación de lisados de células en los puntos de tiempo predeterminado y preparación lisado puede ser desperdiciador de tiempo. Por otra parte, los ensayos basados en luminiscencia no requieren equipo sofisticado microscopio — sólo un lector de placas capaz de leer las señales de luminiscencia. Además, ensayos de luminiscencia con un rango dinámico mayor que ensayos microscopia que calcula el porcentaje de células infectadas. Por ejemplo, en los análisis de microscopía, células DsRed-positivos (indicando infección VSV-DsRed) sólo pueden variar entre 0 – 100% de células analizadas en un campo de visión. Por el contrario, señales LU entre solo VSV-LUC y condiciones de coinfección (u otras condiciones de rescate) pueden variar en varios órdenes de magnitud.

Una ventaja de utilizar el sistema de célula de VSV -dispar L. presentado a pantalla para mamíferos inmunomoduladores virus-codificado es que inherentemente se selecciona para la identificación de factores virales que suprimir lo que es probable que ser conservado y antiguo respuestas antivirales que son anteriores a la respuesta de interferón vertebrados específicos. De hecho, observaciones preliminares sugieren que las proteínas A51R inhiben conservadas antivirales relacionados con ubiquitina-proteasoma respuestas celulares (véase Gammon et al. 13 y datos no publicados). El descubrimiento de VACV A51R rescate de VSV fue el primer ejemplo de un rescate de virus heterólogos por un virus de vertebrados en un huésped invertebrado13, y es probable que estos sistemas de proyección destapará adicionales inmunomoduladores vertebrados virus-codificado . Es importante tener en cuenta que la clave para utilizar rescate VSV como una lectura de las condiciones que inhiben la inmunidad del anfitrión es que la replicación VSV debe ser muy restringida (o abortiva) en el tipo de célula que replicación de VSV se examina en. Por lo tanto, mamíferos más tipos de células sería probablemente inadecuados para estos tipos de ensayos, teniendo en cuenta que el VSV se replica bien en células de mamíferos. Por esta razón se utilizaron células de dispar L. aquí como un tipo de células del anfitrión natural restrictivas para VSV.

Un estudio previo en las células de Drosophila mostraron que supresores virales de antivirus RNAi respuestas podrían identificarse por cotransfection de plásmidos de expresión codifican supresores del ARNi de candidato y un rebaño casa auto-replicadoras del ARN genómico de virus que codifica la GFP en lugar de B2, su natural RNAi supresor30. La replicación del ARN genómico casa del rebaño y la producción de GFP eran dependientes sobre la supresión de RNAi por el factor de cotransfected candidato y, por lo tanto, el rescate de la expresión de GFP indica supresión de ARNi30. Nuestro trabajo no publicado indica que la sobreexpresión de virus-codificado ARNi inhibidores también rescata VSV-LUC genes en las células anaerobias L. , lo que sugiere que este sistema puede utilizarse también para identificar supresores del ARNi respuestas en el contexto de infección por un patógeno viral de bona fide en contraposición a un replicón. De hecho, el hallazgo de que ARNi, IMD y caminos relacionados con ubiquitina-proteasoma, contribuyen a la restricción de la replicación de VSV en dispar L. células13 sugiere que antagonistas virales de varias vías antivirales pueden ser identificados por el VSV rescatar el análisis presentados aquí.

Una limitación potencial de estos métodos de proyección con respecto a la identificación de proteínas antivirales host es que la secuencia del genoma de L. anaerobias aún no está disponible. Sin embargo, hay disponible para el público dispar L. transcriptomas que pueden utilizarse para identificar objetivos de host candidato para RNAi precipitación26,27,28. Además, hemos demostrado previamente que el VSV se restringe a líneas celulares derivadas de otros lepidópteros13 que ahora tienen un genoma públicamente disponible (por ejemplo, Manduca sexta)31. Por lo tanto, líneas celulares derivadas de otros lepidópteros con genomas secuenciados pueden reemplazar las células dispar L. se describe en el protocolo aquí.

Dado el crecimiento económico y la amenaza de salud pública de arbovirus32, los ensayos de investigación aquí presentados pueden proporcionar nuevas estrategias para identificar nuevas características de las interacciones de arbovirus del host que tengan valor en el diseño de nuevos antivirales terapéutica. Además, debido a nuestra relativamente limitada comprensión de lepidópteros mecanismos para restringir la replicación del virus de ARN, las herramientas aquí presentadas ofrecen nuevas oportunidades para sondear los mecanismos de defensa del anfitrión codificados por esto económicamente importante orden de insectos.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Los autores no tienen nada que revelar.

Acknowledgments

D.G. fue apoyado por fondos de programa de la Universidad de Texas Southwestern Medical Center dotado. Los autores agradecen la disposición de VSV-DsRed y VSV-LUC Michael Whitt (la Universidad de Tennessee Health Science Center) y Sean Whelan (Harvard Medical School). Los autores también agradecen Gary Luker (escuela de medicina de la Universidad de Michigan) el amable don de la cepa VACV-FL-GFP.

Materials

Name Company Catalog Number Comments
6-well tissue culture plates CELLTREAT 229106
24-well tissue culture plates CELLTREAT 229124
10 cm tissue culture dishes Corning C430167
Grace’s Insect Medium Sigma G8142
EX-CELL 420 Sigma 14420C
Fetal Bovine Serum - Optima Atlanta Biologicals S12450
Growth medium 1:1 mixture of Grace's Insect Medium and EX-Cell 420 Serum-Free Medium also containing 1% antibiotic-antimycotic solution and 10% Fetal bovine serum
Antibiotic-Antimycotic Solution (100×) Sigma A5955
Dulbecco’s Phosphate Buffered Saline (DPBS) Sigma D8662
Serum Free Media (SFM) Thermo Fisher 10902096
Cytosine arabinoside Sigma C1768
Transfection reagent Thermo Fisher 10362100
Corning cellgro DMSO (Dimethyl Sulfoxide) Corning 25950CQC
Reporter lysis buffer 5x Promega E3971
Luciferase Assay Reagent Promega E1483
96-Well Microplates Corning 3915
Mouse anti-FLAG antibody Wako 014-22383
Rabbit anti-firefly luciferase antibody Abcam ab21176
Mouse anti-actin antibody Sigma A2066
Mouse anti-VSV M N/A N/A Dr. John Connor (Boston University)
Mouse anti-VACV I3L N/A N/A Dr. David Evans (University of Alberta)
8-well Chambered dish Lab-Tek II 155409
Cell viability dye Thermo Fisher C12881
FLUOstar microplate reader BMG Labtech FLUOstar
Confocal microscope Olympus FV10i-LIV
Image analysis software Olympus v1.18 cellSens software
Eppendorf 5702 ventilated centrifuge Eppendorf 22628102
Odyssey Fc Infrared Imaging System Li-COR Biosciences Odyssey Fc
LD652 cells N/A N/A Dr. Basil Arif (Natural Resources Canada)
BSC-40 cells ATCC CRL-2761
BHK cells ATCC CCL-10
HeLa cells ATCC CCL-2
BSC-1 cells ATCC CCL-26
in vitro transcription and purification kit Thermo Fisher AM1626
PCR purification kit Qiagen 28104

DOWNLOAD MATERIALS LIST

References

  1. Nomaguchi, M., Fujita, M., Miyazaki, Y., Adachi, A. Viral tropism. Frontiers in Microbiology. 3, 281 (2012).
  2. Werden, S. J., McFadden, G. The role of cell signaling in poxvirus tropism: the case of the M-T5 host range protein of myxoma virus. Biochimica et Biophysica Acta (BBA) - Bioenergetics. 1784, (1), 228-237 (2008).
  3. McFadden, G., Mohamed, M. R., Rahman, M. M., Bartee, E. Cytokine determinants of viral tropism. Nature Reviews: Immunology. 9, (9), 645-655 (2009).
  4. Silva, J. M., et al. Second-generation shRNA libraries covering the mouse and human genomes. Nature Genetics. 37, (11), 1281-1288 (2005).
  5. Moffat, J., et al. A lentiviral RNAi library for human and mouse genes applied to an arrayed viral high-content screen. Cell. 124, (6), 1283-1298 (2006).
  6. Ma, D., Liu, F. Genome Editing and Its Applications in Model Organisms. Genomics Proteomics Bioinformatics. 13, (6), 336-344 (2015).
  7. Yin, H., Kauffman, K. J., Anderson, D. G. Delivery technologies for genome editing. Nature Reviews: Drug Discovery. 16, (6), 387-399 (2017).
  8. Hao, L., et al. Drosophila RNAi screen identifies host genes important for influenza virus replication. Nature. 454, (7206), 890-893 (2008).
  9. Houzet, L., Jeang, K. T. Genome-wide screening using RNA interference to study host factors in viral replication and pathogenesis. Experimental Biology and Medicine. 236, (8), Maywood, NJ. 962-967 (2011).
  10. Marceau, C. D., et al. Genetic dissection of Flaviviridae host factors through genome-scale CRISPR screens. Nature. 535, (7610), 159-163 (2016).
  11. Savidis, G., et al. Identification of Zika Virus and Dengue Virus Dependency Factors using Functional Genomics. Cell Reports. 16, (1), 232-246 (2016).
  12. Panda, D., Cherry, S. Cell-based genomic screening: elucidating virus-host interactions. Current Opinion in Virology. 2, (6), 784-792 (2012).
  13. Gammon, D. B., et al. A single vertebrate DNA virus protein disarms invertebrate immunity to RNA virus infection. Elife. 3, (2014).
  14. Letchworth, G. J., Rodriguez, L. L., Del cbarrera,, J, Vesicular stomatitis. Veterinary Journal. 157, (3), 239-260 (1999).
  15. Whelan, S. P., Ball, L. A., Barr, J. N., Wertz, G. T. Efficient recovery of infectious vesicular stomatitis virus entirely from cDNA clones. Proceedings of the National Academy of Sciences of the United States of America. 92, (18), 8388-8392 (1995).
  16. Cureton, D. K., Massol, R. H., Saffarian, S., Kirchhausen, T. L., Whelan, S. P. Vesicular stomatitis virus enters cells through vesicles incompletely coated with clathrin that depend upon actin for internalization. PLoS Pathogens. 5, (4), e1000394 (2009).
  17. Duntsch, C. D., et al. Recombinant vesicular stomatitis virus vectors as oncolytic agents in the treatment of high-grade gliomas in an organotypic brain tissue slice-glioma coculture model. Journal of Neurosurgery. 100, (6), 1049-1059 (2004).
  18. Li, Y., Yuan, S., Moyer, R. W. The non-permissive infection of insect (gypsy moth) LD-652 cells by Vaccinia virus. Virology. 248, (1), 74-82 (1998).
  19. Seet, B. T., et al. Poxviruses and immune evasion. Annual Review of Immunology. 21, 377-423 (2003).
  20. Cotter, C. A., Earl, P. L., Wyatt, L. S., Moss, B. Preparation of Cell Cultures and Vaccinia Virus Stocks. Current Protocols in Microbiology. 39, 11-18 (2015).
  21. Andrei, G., et al. Cidofovir resistance in vaccinia virus is linked to diminished virulence in mice. Journal of Virology. 80, (19), 9391-9401 (2006).
  22. Dascher, C., VanSlyke, J. K., Thomas, L., Balch, W. E., Thomas, G. Preparation of recombinant vaccinia virus for expression of small GTPases. Methods in Enzymology. 174-188 (1995).
  23. Martin, A., Rex, E. A., Ishidate, T., Lin, R., Gammon, D. B. Infection of Caenorhabditis elegans with Vesicular Stomatitis Virus via Microinjection. Bio-Protocol. 7, (22), (2017).
  24. Luker, K. E., Hutchens, M., Schultz, T., Pekosz, A., Luker, G. D. Bioluminescence imaging of vaccinia virus: effects of interferon on viral replication and spread. Virology. 341, (2), 284-300 (2005).
  25. Rozelle, D. K., Filone, C. M., Dower, K., Connor, J. H. Vaccinia reporter viruses for quantifying viral function at all stages of gene expression. Journal of Visualizes Experiments. (87), e51522 (2014).
  26. Cao, C., et al. Characterization of the transcriptome of the Asian gypsy moth Lymantria dispar identifies numerous transcripts associated with insecticide resistance. Pesticide Biochemistry and Physiology. 119, 54-61 (2015).
  27. Sparks, M. E., Blackburn, M. B., Kuhar, D., Gundersen-Rindal, D. E. Transcriptome of the Lymantria dispar (gypsy moth) larval midgut in response to infection by Bacillus thuringiensis. PloS One. 8, (5), e61190 (2013).
  28. Sparks, M. E., Gundersen-Rindal, D. E. The Lymantria dispar IPLB-Ld652Y cell line transcriptome comprises diverse virus-associated transcripts. Viruses. 3, (11), 2339-2350 (2011).
  29. Lin, G., Li, G., Granados, R. R., Blissard, G. W. Stable cell lines expressing baculovirus P35: resistance to apoptosis and nutrient stress, and increased glycoprotein secretion. In Vitro Cellular & Developmental Biology - Animal. 37, (5), 293-302 (2001).
  30. Li, W. X., et al. Interferon antagonist proteins of influenza and vaccinia viruses are suppressors of RNA silencing. Proceedings of the National Academy of Sciences of the United States of America. 101, (5), 1350-1355 (2004).
  31. Kanost, M. R., et al. Multifaceted biological insights from a draft genome sequence of the tobacco hornworm moth, Manduca sexta. Insect Biochemistry and Molecular Biology. 76, 118-147 (2016).
  32. Paixao, E. S., Teixeira, M. G., Rodrigues, L. C. Zika, chikungunya and dengue: the causes and threats of new and re-emerging arboviral diseases. BMJ Global Health. 3, (2018).
Infecciones del arbovirus como herramientas de detección para la identificación de factores antivirales inmunomoduladores y anfitrión Viral
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Rex, E. A., Seo, D., Gammon, D. B. Arbovirus Infections As Screening Tools for the Identification of Viral Immunomodulators and Host Antiviral Factors. J. Vis. Exp. (139), e58244, doi:10.3791/58244 (2018).More

Rex, E. A., Seo, D., Gammon, D. B. Arbovirus Infections As Screening Tools for the Identification of Viral Immunomodulators and Host Antiviral Factors. J. Vis. Exp. (139), e58244, doi:10.3791/58244 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter