Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Immunology and Infection

Arbovirus infektioner som Screening verktyg för identifiering av Viral immunmodulerande och värd antivirala faktorer

doi: 10.3791/58244 Published: September 13, 2018

Summary

Här presenterar vi de protokoll för att identifiera 1) virus-kodade immunmodulerande medel som främjar arbovirus replikering och 2) eukaryota värd faktorer som begränsar arbovirus replikering. Dessa fluorescens - och luminiscens-baserade metoder tillåter forskare att snabbt få kvantitativa avläsning av arbovirus replikering i förenklade analyser med lågt signal-till-brus-förhållande.

Abstract

RNA interferens- och arvsmassan redigering-baserad screening plattformar har använts att identifiera värd cell faktorer som begränsar virusreplikation. Dessa skärmar bedrivs dock vanligtvis i celler som är naturligt tillåtande till viral patogenen under studien. Robust replikering av virus i kontroll villkor får därför begränsa det dynamiska omfånget av dessa skärmar. Dessutom kan dessa skärmar inte enkelt identifiera cellulära försvar vägar som begränsar virusreplikation om viruset är väl anpassade till värden och kan motverka antivirala försvar. I den här artikeln beskriver vi ett nytt paradigm för att upptäcka virus-host interaktioner med hjälp av skärmar det centrerar på naturligt misslyckade infektioner av arboviruses såsom vesikulär stomatit virus (VSV). Trots VSV förmåga att replikera i ett brett utbud av sorgmyggor insekter och däggdjur värdar, genomgår VSV en efter inresa, misslyckade infektion i en mängd olika cellinjer som härstammar från fjärilsarter insekter, såsom gypsy moth (Lymantria dispar). Dock kan dessa misslyckade VSV infektioner ”räddas” när mottagande cell antivirala försvar äventyras. Vi beskriver hur VSV stammar kodning bekvämt reporter gener och restriktiva L. dispar cellinjer kan kopplas till set-up skärmar att identifiera värd faktorer inblandade i arbovirus begränsning. Dessutom visar vi också nyttan av dessa screening verktyg i identifiering av viralt kodade faktorer som rädda VSV replikering under coinfection eller via ektopisk uttryck, inklusive de kodas av däggdjur virus. Den naturliga begränsningen av VSV replikering i L. dispar celler ger en hög signal-brus-förhållande när screening för de villkor som främjar VSV räddning, vilket möjliggör användning av förenklade luminiscens och fluorescens-baserade analyser att övervaka förändringar i VSV replikering. Dessa metoder är värdefulla för att förstå samspelet mellan värd antivirala svar och viral immune evasion faktorer.

Introduction

Förmågan hos virus att produktivt replikeras i en viss värd styrs delvis av tillgången till mottagande cell faktorer som stöder viral intrade och replikering1. Den virus-spektrum kan också dikteras av kapaciteten av ett virus till counter cellulära antivirala försvar som annars hämma virusreplikation2,3. Det är resultatet av dessa komplexa virus-värd-interaktioner som slutligen avgör om ett virus kommer att kunna slutföra sin livscykel i en viss värddator. Tanke på de potentiellt patogena konsekvenserna för värden om virusreplikation inträder, är det viktigt att utveckla experimentella strategier för att främja förståelsen av det nycklarna-virus-host samspel som kan rubba balansen mellan misslyckade och produktiv infektioner. Klarlägga molekylära funktioner i virus-host samspel kommer att bidra i utvecklingen av nya och alternativa antivirala terapeutiska strategier.

Med tillkomsten av RNA interferens (RNAi)4,5 och editering verktyg (t.ex., CRISPR-Cas9, zink finger nukleotider, TALENs)6,7, det har blivit experimentellt genomförbart att förändra den uttryck av cellulära faktorer på genome-wide skalor och utforska effekterna av dessa förändringar på virusreplikation. Faktiskt, många RNAi och genomet-redigering-baserade skärmar har utförts i ryggradslösa och ryggradsdjur värd celltyper som har avtäcka ny fasetter av virus-host interaktioner8,9,10, 11 , 12. dessa skärmar vanligtvis anställa virus kodning reportrar, såsom firefly luciferas (LUC) eller fluorescerande proteiner (t.ex., GFP, DsRed), som ger bekvämt sätt kvantitativt bedöma viral genuttryck som en avläsning för virusreplikation9,12. Denna strategi tillåter forskare att identifiera värd faktorer som antingen främja eller motverka dexmedetomidininducerade virusreplikation vilket framgår av ökar eller minskar, respektive, i viral reporter signaler9,12. Dock i de allra flesta fall, har dessa skärmar utförts med virus som är väl anpassade till den mottagande celltyp där de studeras. Denna strategi kan vara viktiga för att förstå coevolutionary relationer mellan virala patogener och deras naturliga värdar, utgör det grundläggande oro för deras användning i avslöjande värd antivirala faktorer. I dessa fall en förbättring i virus reporter signal vid RNAi knockdown som granskas för eller inaktivering av en cellulär faktor som normalt förhindrar virusreplikation. Först om ett virus är redan kunna kraftfullt replikera i värdcellen undersöks kontroll villkor, kan det dynamiska omfånget på skärmen (dvs, förmågan att skilja mellan bakgrunden och förbättrad viral reporter signaler) begränsas. Det andra förvärras problemet ytterligare av de situationer där viruset är väl anpassade till värdcellen och effektivt motverka värd försvar vägar som är riktade i skärmen.

På grund av de ovanstående funderingar kring traditionella virus-host interaktion screeningmetoder, utvecklade vi ett nytt paradigm för att studera virus-värd-interaktioner som utnyttjar naturligt misslyckade arbovirus infektioner i fjärilsarter insekt celler. Denna strategi härrör från en observation att det väl studerat människors arbovirus, VSV, genomgår en misslyckade infektion i celler från gypsy moth (L. dispar)13. VSV är naturligt överförs av sorgmyggor insekter (dvs, sandmyggor) till däggdjur värdar och har visat experimentellt att infektera ett brett utbud av ryggradslösa djur och ryggradsdjur värdar både i cell kultur och i vivo14. 11-kb negativ-sense enkelsträngat RNA genomet hos VSV kodar fem subgenomic mRNA som översätts varje till de proteiner som utgör den höljeförsedda virion. VSV omvänd genetiska system har dock möjliggjorde skapandet av replikering-behöriga stammar kodning LUC eller fluorescerande proteiner, förutom de fem naturliga VSV gen produkter15,16,17. Eftersom dessa reporter proteiner inte införlivas i den VSV virion, ger de en bekväm avläsning för VSV genuttryck som uppstår efter posten. Använda VSV stammar kodning GFP eller LUC, har vi tidigare visat att VSV genuttryck är strängt begränsad vid tillträdeet av LD652 celler och att inte öka VSV titrar av 72 timmar efter infektion (hpi). Däremot leder coinfection av LD652 celler med VSV och de däggdjur poxvirus, vacciniavirus (VACV), till logaritmisk ökningar i både VSV genuttryck och titrar av denna tidpunkt. VACV genomgår tidiga genuttryck, DNA-replikation och sena genuttryck i LD652 cell infektioner, men VACV replikering cykeln är slutligen misslyckade på grund av ofullständig virion morfogenes18. Det stora ~ 192 kb DNA-genomet hos VACV kodar > 200 proteiner, varav många Visa immunmodulerande egenskaper som främjar virusreplikation genom dämpningen av värd immunsvar19. Därför hypotesen vi som ”räddning” av VSV replikering i LD652 celler av VACV coinfection var troligen medierad av VACV immunomodulatorer som hämmas L. dispar Svaren normalt begränsar VSV replikering. Till stöd för detta räddar behandling av LD652 celler med värd RNA-polymeras II-hämmaren actinomycin D också VSV replikering i LD652 celler, vilket indikerar att transkription-beroende värd Svaren blockera VSV replikering efter posten13.

De ovanstående observationerna tyder på att den naturligt restriktiva karaktären av LD652 celler till VSV infektion kan ge en relativt låg bakgrund när screening för de villkor som förbättrar VSV-kodade reporter signaler (dvs, de som hämmar värd antivirala försvar). Här, tillhandahåller vi metoder för att med hjälp av fluorescens eller LUC-baserade analyser till skärmen för villkor som lindra VSV begränsning i fjärilsarter celler. Först, vi visar hur dessa analyser kan användas för att identifiera viralt kodade immunmodulerande faktorer som bryta VSV begränsning under antingen coinfection experiment eller via ektopisk uttryck för kandidat viral faktorer. Som ett exempel illustrera vi hur vi använt dessa screening metoder för att identifiera poxvirus-kodade A51R proteiner som en ny familj av immunmodulerande faktorer som rädda VSV replikering i avsaknad av andra poxvirus faktorer13. Det andra illustrera vi hur RNAi screening i restriktiva VSV-LD652 cell infektioner kan användas för att direkt identifiera eukaryota värd faktorer inblandade i arbovirus begränsning13.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. allmänna Lymantria dispar (LD652) Cell och Virus kultur

  1. LD652 cell odling och plätering
    1. Till kultur L. dispar-härledda LD652 celler, upprätthålla en enskiktslager av celler i ett odlingsmedium (Tabell för material) inkuberas vid 27 ° C under normal atmosfär. Upprätthålla cellerna i 10 cm vävnad-kultur-behandlade rätter och passage cellerna när den når 80% konfluens.
    2. Tallrik, rubba vidhäftande LD652 celler från plattan av pipettering media flera gånger på den enskiktslager (dessa celler inte kräver trypsinization att få bort) och späd provet i tillväxt medier till en ungefärlig densitet på 1 x 105 celler/mL. Pipettera 1 mL utspädd kultur/brunn 24-bra platta. Utsäde minst tre replikera brunnar/behandling typ för varje tidpunkt (maximalt åtta behandlingar/platta).
    3. Tillåta cellerna sedimentera i minst 1 h.
  2. Vaccinia virus förberedelse
    1. Att förbereda bestånden av VACV, förstärker viruset i HeLa celler20 eller afrikanska Green Monkey njure celler (BSC-1 eller BSC-40 celler)20,21,22.
      Obs: VACV stam Western Reserve (VACV-WR) fungerar bra i de analyser som beskrivs här.
    2. Titrera den VACV stam via plack test på BSC-1 eller BSC-40 celler20,22.
      Obs: Alla anvisas VACV multiplicity av infektion (MOI) beskrivs här LD652 cell infektioner är baserat på titrar som erhållits från BSC-40 plack analyser.
  3. Vesikulär stomatit virus förberedelse
    1. För att förbereda VSV bestånd, förstärka viruset i BHK celler23.
    2. Titrera VSV av plack test på BSC-40 eller BHK cell enskiktslager13,23.
      Obs: Alla VSV MOIs beskrivs här LD652 cell infektioner är baserat på titrar som erhållits från BSC-40 plack analyser.

2. fluorescens-baserade VSV Rescue Assay med samtidig infektion och Live-cell Imaging

  1. Sådd och infektion i LD652 celler
    1. Plattan 40.000 LD652 celler/väl av en 8-väl kammare.
    2. För fluorescens-baserade live-cell imaging, använda VSV stammar kodning fluorescerande proteiner. De experiment som presenteras här använder VSV-DsRed17, en rekombinant VSV stam som uttrycker gratis DsRed protein som inte smälts på några andra VSV protein.
      Obs: VSV infektion i LD652 celler är inte cytopatisk av 96 hpi och celldöd är alltså inte en störande faktor vid utvärdering av VSV replikering inom denna tidsram.
    3. Förbereda VSV-DsRed och VACV-FL-GFP i ett serumfritt medium (SFM; Tabell över material) på en MOI mellan 1 och 25, respektive.
      Obs: VACV-FL-GFP är en rekombinant VACV stam som uttrycker en fusion mellan LUC och god Jordbrukarsed24. Använda en MOI på 25 eller högre för VACV stammar säkerställer att alla LD652 celler är infekterade13. Om du använder ett annat coinfecting virus, kommer MOI har empiriskt fastställt användaren. Varje infektion behandling bör inrättas i dubbla brunnar och inkluderar mock-infekterade behandlingar där bara SFM läggs till cellerna.
    4. Inkubera cellerna i 0,2 mL av inokulatet för 2 h på 27 ° C.
    5. Tvätta cellerna med 0,5 mL/väl av tillväxtmassmedia.
    6. Inkubera cellerna i 25 μM cell livskraft färgämne (Tabell för material) i odlingsmedier för 45 min på 27 ° C.
    7. Aspirera media och Tvätta brunnarna 1 x med 0,5 mL/väl ta bort överflödig färg.
    8. Upprätthålla cellerna i 0,3 mL/väl av tillväxt medier.
  2. Levande cellen bild fånga
    1. Vända på en confocal mikroskopet 30 min i förväg och lasta en 8-väl kammaren maträtt.
      Obs: LD652 celler kan avbildas i rumstemperatur allt från 20 – 25 ° C, men för optimala förhållanden, temperaturen i rummet bör anpassas till 27 ° C.
    2. Ställ in lämpliga excitation/utsläpp inställningarna för varje fluorescerande markör protein som avbildas, liksom fas kontrast bildinställningarna.
    3. Justera laser intensitet för varje kanal.
      Obs: Detta kan kräva kör en pilot experimentet för att bestämma området för fluorescerande signal stödnivåer iakttas under hela tiden som ska användas i sista försöket.
    4. Med målsättningen 10 X, fånga fas kontrast och fluorescens bilder av varje väl varje 1 – 5 h för varaktigheten av infektionen upp till en önskad tidpunkt (t.ex., 48 – 72 hpi).
      Obs: Det är viktigt att fånga flera synfält i varje brunn för att exakt uppskattning av de infektion i hela kulturen.
  3. Bildanalys
    1. Använda bild analys programvara för automatiserad bildanalys av lämpliga fluorescerande kanaler (t.ex., 405 nm, 488 nm, 568 nm).
    2. För att beräkna procentandelen av celler som är infekterade, dela det totala antalet fluorescerande celler indikerar VSV infektion (t.ex., DsRed-positiva celler för VSV-DsRed infektioner) av det totala antalet livskraftiga celler märkta av cell livskraft färgämne för varje synfält över alla behandlingar.

3. allmänna virusinfektion protokoll för Luminiscens-baserade VSV Rescue analyser i LD652 celler

  1. Förberedelse av inokulatet
    1. 30 min före infektionen, Tina bestånden av VSV-LUC16 (en rekombinant VSV stam som uttrycker gratis firefly luciferas protein inte smält till några andra VSV protein). Om testmetoder för VSV-LUC räddning under VACV coinfection, också Tina VACV-WR viruset på is.
      Obs: Andra virus (förutom VACV-WR) kan rädda VSV-LUC under coinfection, men detta måste fastställas empiriskt av varje användare.
    2. Förbereda inokulatet genom spädning VSV-LUC i närvaron eller frånvaron av VACV-WR i SFM sådan att en MOI mellan 10 och 25, respektive uppnås när du lägger till en total inokulum volym 0,2 ml/väl.
  2. Infektion i cellerna
    1. Aspirera mogen LD652 media noggrant för att undvika att störa enskiktslager och Inokulera med 0,2 mL virus per brunn. Denna tid definieras som 0 hpi. Lägga till sterila SFM ytterligare brunnar att fungera som ”mock-infekterade” negativ kontroll behandlingar.
    2. Inkubera cellerna i inokulum för 2 h på 27 ° C.
    3. Vid 2 hpi, ta bort inokulum genom aspiration och ersätta med 1 mL/väl LD652 tillväxt medier.
    4. Tillåta infektionen fortsätta 24 – 72 hpi.

4. luciferas Assay

  1. Beredning av cell lysates
    1. Noggrant Aspirera supernatanten och tillsätt 1 mL Dulbeccos fosfatbuffrad koksaltlösning (DPBS) / väl.
    2. Hjälp kolven i en 1 mL spruta, skrapa cellerna i DPBS.
    3. Överföra cellerna till en mikrocentrifug rör och centrifugera vid 400 x g under 20 minuter vid 4 ° C.
    4. Under tiden Förbered 1 x spädning av 5 x reporter lyseringsbuffert (RLB) i steril H2O.
    5. Efter centrifugeringen, aspirera på DPBS utan att störa cellpelleten.
    6. Återsuspendera varje pellet i 150 µL av 1 x RLB.
    7. Frysning-tining proverna 1 x med en 5-minuters inkubation i-80 ° C frys följt av en snabb islossning i rumstemperatur vattenbad. Lagra lysates vid-80 ° C tills den ska analysera.
  2. Luciferas assay
    1. Tina lysates på is.
    2. Tillsätt 20 μL av lysat i en brunn av en solid svart eller vit 96 brunnar mikroplattan.
    3. Tillsätt 100 μL av luciferas assay reagensmedel till varje brunn.
    4. Omedelbart mäta ljusstyrkan med hjälp av en luminometer (lämpliga inställningar för specifika luminometers har empiriskt fastställt användaren).
  3. Luciferas analys analys
    1. Normalisera LU signaler för varje behandling till LU avläsningar från kontroll behandlingar (Representativa resultat). Efter minst tre oberoende experiment har utförts, kan medelvärdet LU erhålls från varje behandling/kontrollgrupp analyseras med lämpliga statistiska tester.

5. Immunoblot

  1. Använd lysates som utvinns för LUC analyserna för SDS-PAGE och efterföljande immunoblotting, med lämpligt reagens och instrumentation.

6. titer för VSV från LD652 cellkulturer

  1. Tallrik LD652 celler enligt steg 1,1.
  2. Viral infektera cellerna enligt steg 3.
  3. Vid önskade tidpunkter, samla supernatanterna i sterila mikrocentrifugrör.
  4. Pressa samman cellerna med 1 000 x g under 10 minuter vid 4 ° C och överföra supernatanterna till nya rör.
  5. Lagra supernatanterna vid-80 ° C eller fortsätta med titrering av plack test på BSC-40 celler.
    Obs: Om titreringen VSV från LD652 cellkulturer som innehöll VACV, är det lämpligt att lägga till 100 μg/mL cytosin arabinoside (AraC) till BSC-40 kultur media inom 2 hpi, att förhindra att resterande VACV partiklar bildas plack på BSC-40 enskiktslager13. AraC är en viral DNA-polymeras-hämmare som blockerar VACV DNA-replikering25 men påverkar inte VSV replikering.

7. varianter av Luminescence-baserade VSV rädda analyser i LD652 celler: RNAi och Plasmid Transfection experiment

  1. Beredning av dsRNA för RNAi-medierad Nedslagning av viral eller värd avskrifter
    1. Design gen-specifika primers tailed i 5' slutet med T7 promotorn sekvens (TAATACGACTCACTATAGGG) att rikta antingen coinfecting virus (t.ex., VACV) eller L. dispar mRNA avskrifter av intresse. Dessa primers bör producera en PCR produkt av 400 – 600 bp för effektiv RNAi-medierad knockdown. Se Gammon o.a. 13 för primer sekvenser brukade nedanför knockdown VACV eller L. dispar avskrifter av dsRNA-medierad RNAi i LD652 celler.
      Obs: L. dispar mRNA avskrifter kan identifieras från publiceras L. dispar transkriptom databaser26,27,28.
    2. Generera en DNA mall via RT-PCR (cDNA syntes: 1 cykel av 50 ° C i 30 min; PCR: 40 cykler av 94 ° C för 15 s, 50 ° C i 30 s och 68 ° C för 45 s varje).
    3. Rena PCR-produkten med hjälp av en PCR-rening kit.
    4. Med renat PCR-produkten som en mall, in vitro transkribera och rena dsRNA med hjälp av ett in vitro- transkription och rening kit.
  2. Transfection dsRNA eller plasmid DNA i LD652 celler
    1. Frö 1 x 105 celler per brunn 24-well platta och låt cellerna nöja sig minst 1 h.
    2. För varje brunn för att vara transfekterade, späd 4 μL transfection reagens in 100 μL av SFM. Inkubera i upp till 15 minuter vid rumstemperatur. Detta kan skalas för att göra en master mix för alla transfections som ska utföras.
    3. Späd upp till 1 μg dsRNA eller totala plasmid DNA med 100 μL av SFM för varje brunn att vara transfekterade. Inkubera i upp till 15 minuter vid rumstemperatur.
      Obs: Vi har tidigare funnit att en transfection på 1 μg dsRNA/105 LD652 celler räcker för > 80% Nedslagning av antingen virus eller värd avskrifter13, men dsRNA doser behövs för modifierade experimentella set-pop-ups/villkor måste bestämmas empiriskt.
    4. Kombinera transfection reagens och dsRNA/plasmid DNA spädningar med förhållandet 1:1 (t.ex.100 μL av utspädda dsRNA blandas med 100 μL utspätt transfection reagens) och inkubera i 20 min i rumstemperatur.
    5. Under tiden Tvätta brunnarna med 1 mL/väl av SFM, och sedan lägga till 500 μL av SFM till varje brunn.
    6. Tillsätt långsamt den transfection reagens dsRNA (eller plasmid DNA) blandning droppvis i varje brunn.
    7. Inkubera transfection reagens med celler i 5 h.
      1. För RNAi experiment med överväldigande av avskrifter som kodas av ett coinfecting virus (t.ex., VACV), ersätter transfection reagens efter 5-h transfection inkubationstiden med virus inokulum som innehåller VSV-LUC (med eller utan VACV eller en annan coinfecting virus) (steg 3). Därefter Ersätt den virus inokulum innehållande VSV-LUC med komplett tillväxt media 2 hpi. LUC analyser (steg 4) kan sedan utföras på extraherade lysates vid olika tidpunkter att avgöra om Nedslagning av coinfecting virus avskrifter leder till en förlust av VSV-LUC räddning.
      2. För RNAi experiment med RNAi av L. dispar avskrifter, ersätter transfection mixen med komplett tillväxt medier och tillåter knockdown att uppstå för 24 h före infektion med VSV-LUC (steg 4). LUC analyser (steg 4) kan sedan utföras på extraherade lysates vid olika tidpunkter att avgöra om Nedslagning av L. dispar avskrifter främjar VSV-LUC räddning.
      3. För experiment med transfections av Plasmiden uttryck vektorer uttrycker kandidat immunomodulatorer, ersätta transfection reagens och möjliggöra proteinuttryck för 24 h före infektionen med VSV-LUC (steg 4). LUC analyser (steg 4) kan sedan utföras på extraherade lysates vid olika tidpunkter att avgöra om uttrycket av kandidat immunmodulerande proteiner främjar VSV-LUC räddning.
        Obs: Transfection villkoren beskrivs här med 1 μg per brunn av plasmid DNA resultatet i transfection effektivitetsvinsterna av 40 – 60%13.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Som ett exempel på live-cell bildprogram att övervaka VSV räddning vid VACV coinfection, LD652 celler var klädd i en 8-väl kamrar maträtt och mock-infekterade eller smittade med VSV-DsRed (MOI = 1) i närvaron eller frånvaron av VACV-FL-GFP (MOI = 25). Eftersom VSV-DsRed uttrycker DsRed som en gratis protein och smälts inte på strukturella VSV proteiner (figur 1A), upptäcks det endast efter VSV intrade och gen uttryck initierar. Alla celler var då märkt med cell livskraft färgämne som fritt passerar genom plasmamembranet av celler, där det omvandlas till en membran-impermeant produkt som främjar lagring av fluorescerande signalen i märkta celler. Bilder förvärvades varje 5 h upp till 65 hpi, använda 405 nm, 488 nm, 568 nm och vitt ljus filter för att fånga cell livskraft färgämne, VACV-FL-GFP, VSV-DsRed och fas kontrast (PC) kanaler, respektive. Villkor som enda infektion begränsar LD652 celler VSV-DsRed replikering. Därför uppvisar endast ett litet antal celler en DsRed signal. Coinfection av VSV-DsRed med VACV-FL-GFP resulterar dock i de flesta celler visar DsRed signaler i slutet av gången kursen (figur 1B). Bilder tagna vid varje tidpunkt utsattes för bild analysprogram, där 405 nm och 568 nm kanal bilder användes för att automatiskt bestämma totalt och DsRed-positiv cell nummer, respektive. Procentandelen av celler som visar en DsRed signal för varje behandling beräknas genom att dividera objekt (celler) med en positiv signal i kanalen 568-nm med antalet objekt som identifierats i kanalen 405 nm för varje tidpunkt, följt av multiplikation av 100% . Som visas i figur 1 c, var ~ 2% av cellerna från VSV-DsRed enda infektioner DsRed-positiva av 65 hpi. Däremot var ~ 77% av cellerna i VSV-DsRed + VACV-FL-GFP coinfections DsRed-positiva vid denna tidpunkt. Filmer S1 och S2 Visa progressionen av VSV-DsRed infektion under hela 65-h tid i enda infektion och coinfection villkor, respektive. Det är viktigt att notera att GFP uttryckt av VACV-FL-GFP blev upptäckas av 10 hpi, innan signalen DsRed, som anger att det krävs tillräckliga VACV genuttryck före VSV-DsRed rescue (visas inte). Dessa resultat tyder sammantaget klart en räddning av VSV-DsRed replikering av VACV coinfection. Om ett coinfecting virus kunde rädda VSV-DsRed, förväntar vi lika procentandelar av DsRed-positiva celler mellan enstaka infektioner och coinfection behandlingar.

VSV replikering i LD652 celler kan alternativt kvantifieras med luminescence-baserade analyser när du använder VSV-LUC stammar (figur 2A). Som ett exempel, figur 2B visar resultaten av en LUC analysen använder lysates som tillagas över en 72 h tid kurs från mock-infekterade celler eller celler som smittats med VSV-LUC (MOI = 10) i närvaron eller frånvaron av VACV-WR (MOI = 25). En positiv räddning av VSV-LUC replikering indikeras av den logaritmiska ökningen av godtyckliga LU upptäckt med lysates beredd från koinfekterade celler, jämfört med lysates från enda VSV-LUC infektioner. Ett negativt resultat skulle anges i denna analys av en coinfection underlåtenhet att ändra LU avläsningar från dem som observerats i enstaka VSV-LUC infektion behandlingar. Om så önskas, kan beredda lysates också användas för immunoblotting, bekräfta förbättrade VSV genuttryck i coinfection behandlingar. Till exempel visar figur 2 c ett typiskt immunoblot resultat för VSV-kodade LUC och matris (M) proteiner i lysates beredd från mock-, VSV-LUC, och VSV-LUC + VACV-WR behandlingar 72 hpi. Immunoblotting för VACV I3L protein tjänstgjorde som en markör för VACV infektion, och immunoblotting för cellulära aktin användes som lastning kontroll. Tydlig förbättring av VSV-kodade LUC och M proteiner i den coinfection-lysates ytterligare bekräfta VSV räddning av VACV. Slutligen, produktiva VSV replikering kan bekräftas genom att samla supernatanterna från dessa LD652 cellkulturer och titreringen ett infektiöst virus på BSC-40 enskiktslager (figur 2D). Detta resultat visar att endast under VACV coinfection gör VSV produktivt replikera.

När ett coinfecting virus visas kan rädda VSV replikering i LD652 celler, kan RNAi screening användas för att identifiera faktorer som kodas av coinfecting viruset som bidrar till VSV räddning. I detta experiment, skärm för ett RNAi-villkor som leder till en ”förlust av rescue” fenotyp under VSV-LUC coinfection med ett räddande virus. Vi har tidigare identifierat VACV A51R proteinet som en VSV rescue faktor genom en RNAi screening av dussintals VACV-kodade utskrifter13. Exempelvis har vi återgetts en mindre skala version av denna skärm (figur 3). RNAi medieras av transfection av in vitro transkriberat dsRNAs som riktar avskrifter kodad av coinfecting virus. I de data som visas här, riktade viral avskrifter kodning VACV A50R, A51R och A52R proteiner för RNAi knockdown. Som en negativ kontroll för förlust av rescue, var celler också transfekterade med dsRNAs inriktning GFP-encoding avskrifter. Som positiv kontroll för en förlust av rescue fenotyp, var celler transfekterade med dsRNAs mot LUC-encoding avskrifter. Denna behandling ger en stark förlust av LU signal under coinfection och hjälper forskare bekräftar att transfection/RNAi-protokoll fungerar. Efter 5 h av dsRNA transfection, celler var infekterad med VSV-LUC (MOI = 10) och VACV-WR (MOI = 25). Separat infektioner med endast VSV-LUC utfördes också för att upprätta en bakgrundsnivå av LU signal. Lysates var sedan skördas 72 hpi och används i en LUC-analys. Jämföra nivån på VSV räddning över dsRNA behandlingar till GFP dsRNA kontroll behandling, tyder resultaten på att överväldigande av VACV A51R producerar en stark förlust av rescue fenotyp, medan överväldigande A50R och A52R ger ett negativt resultat (ingen förlust av Rescue jämfört med GFP dsRNA).

Som ett alternativ till RNAi screening för att identifiera viral faktorer som bidrar till VSV räddning, överuttrycka kandidat viral faktorer i LD652 celler och sedan assay för VSV-LUC räddning. Detta kan åstadkommas genom kloning kandidatgener sevärdheter i lämpliga uttryck vektorer såsom p16629 och transfecting dessa plasmider i LD652 celler innan utmaningen VSV-LUC. Som ett exempel, visar figur 4A ett rescue experiment där flaggan-märkta GFP (FGFP) eller flagga-taggade A51R (FA51R) p166 vektorer var transfekterade i LD652 celler vid olika koncentrationer, följt av VSV-LUC infektion (MO = 10) 24 h senare. Som en negativ kontroll för VSV räddning, ytterligare kulturer var mock-transfekterade och fick inte plasmid DNA. Lysates samlades in från kulturer 72 hpi och utsattes för LUC analyser. FA51R behandlingar fram en positiv VSV rescue resultat framgår av förbättrad LU signaler över mock-transfekterade behandlingar vid multipla doser. Däremot var FGFP behandlingar negativa för VSV räddning vid någon testad dos. Immunoblotting av lysates från figur 4A bekräftade ett liknande uttryck av FGFP och FA51R proteiner (figur 4B).

Använder en RNAi screening av kandidaten L. dispar faktorer, vi har visat att begränsningen av VSV i LD652 celler är medierad av olika cellulära faktorer tillhör antivirala RNAi vägar (t.ex., AGO2 och Dicer-2), den Nuclear Factor kappa B (NF-κB)-relaterade IMD väg (t.ex., Relish), och den ubiquitin-proteasomsystemet (t.ex., polyubiquitin)13. Som ett exempel, vi har upprepat en mindre skala version av dessa RNAi experiment med dsRNAs inriktning L. dispar avskrifter som förbättrad VSV-LUC replikering vid knockdown (t.ex., AGO2, Dicer-2, Relish, polyubiquitin) eller hade ingen effekt (AGO1 )13. Efter 24 h av dsRNA transfection utmanades celler med VSV-LUC för 72 h att avgöra om RNAi behandlingar förbättrade LU signaler över negativ kontroll GFP dsRNA behandlingar. RNAi behandlingar som förbättrar LU signaler indikerar att den faktor som kodas av riktade avskriften begränsar VSV replikering. Som positiv kontroll för RNAi knockdown, var dsRNAs inriktning LUC-encoding avskrifter också transfekterade i parallella behandlingar. På grund av låg bakgrunden LU signaler detekteras i GFP dsRNA kontroll behandlingar, var det relativt enkelt att identifiera värd-kodade begränsning faktorer med hjälp av RNAi screening eftersom deras knockdown producerar ~ 10-till 1.000-faldig ökning av LU signaler ( Figur 5). Det är således möjligt att utnyttja relativt låga bakgrunden nivå av VSV genuttryck i LD652 celler till skärmen för värd RNAi knockdown villkor som lindra VSV begränsning.

Figure 1
Figur 1: identifiering av VSV räddning av virus coinfection av LD652 celler med hjälp av fluorescens-baserade live-cell imaging. (A) denna panel visar en schematisk bild av en VSV-DsRed arvsmassa som anger DsRed (dR) genen. (B) dessa företrädare 10 X konfokalmikroskopi bilder är tagna 60 hpi. 405 nm kanalen indikerar en fläck för viabla celler, 488-nm kanalen anger VACV-FL-GFP infektion och 568 nm kanalen anger VSV-DsRed infektion. Fas bilder med kontrast (PC) visas också. Skala barer = 100 µm. (C), denna panel visar andelen av DsRed-positiva LD652 celler under hela 65 h infektion tid. Den genomsnittliga (SD) andelen av cellerna visar en DsRed signal för varje tidpunkt visas. Klicka här för att se en större version av denna siffra.

Figure 2
Figur 2: bedömning av VSV räddning i LD652 celler med LUC analyser. (A) denna panel visar en schematisk bild av en VSV-LUC genomet. (B) i denna panel visas godtyckliga ljus enheter (LUC) analyser av lysates från mock-infekterade celler eller celler som smittats med VSV-LUC, i avsaknaden eller förekomsten av VACV-WR. (C), denna panel visar en immunoblot av LUC, VSV M, VACV I3L, och cellulära aktin proteiner i lysates från panel A samlas in 72 hpi. (D) i denna panel visas VSV-LUC titrar i cellkulturer som erhållits från panel B. Kvantitativa data i panelerna B och D representerar medel (± SD) från experiment som utförs i tre exemplar. Klicka här för att se en större version av denna siffra.

Figure 3
Figur 3: identifiering av en viralt-kodade VSV rescue faktor genom RNAi screening under coinfection av LD652 celler. Panelen visar vik förändringar i LU upptäcks i lysates från celler 72 hpi med VSV-LUC och VACV-WR efter angivna RNAi behandlingen i förhållande till LU upptäcks i lysates från celler som ensamma smittats med VSV-LUC. Uppgifterna representerar medel (± SD) från experiment som utförs i tre exemplar. Klicka här för att se en större version av denna siffra.

Figure 4
Figur 4: räddning av VSV av överuttryck av en viral immunmodulerande i LD652 celler. (A) denna panel visar en LUC assay från VSV-LUC-infekterade celler 72 hpi som mock-transfekterade (mock) eller transfekterade med antingen FGFP eller FA51R p166 uttryck plasmider. LU-signaler från varje behandling var normaliserade till signaler som upptäckts i mock-transfekterade kontroll behandlingar. Uppgifterna representerar medel (± SD) från experiment som utförs i tre exemplar. (B) denna panel visar lysates från sidopanelen A, immunoblotted med flaggan och aktin antikroppar. Klicka här för att se en större version av denna siffra.

Figure 5
Figur 5: identifiering av värd faktorer begränsar VSV replikering i LD652 celler genom RNAi screening. I denna panel visas luckan ändra i LU signaler i angivna RNAi behandlingar i förhållande till GFP dsRNA kontroll behandlingar 72 hpi med VSV-LUC. Uppgifterna representerar medel (± SD) från experiment som utförs i tre exemplar. Klicka här för att se en större version av denna siffra.

Film S1: representativa 405-nm (cell livskraft färgämne) och 568 nm (DsRed) kanal-bilder som tagits under en 65 h tid (varje bildruta = 5 h intervall) efter VSV-DsRed infektion av LD652 celler. Vänligen klicka här för att hämta den här filen.

Film S2: representativa 405-nm (cell livskraft färgämne) och 568 nm (DsRed) kanal-bilder som tagits under en 65 h tid (varje bildruta = 5 h intervall) efter coinfection av LD652 celler med VSV-DsRed och VACV-FL-GFP. Vänligen klicka här för att hämta den här filen.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Här har vi beskrivit enkel fluorescens - och luminiscens-baserade analyser till skärmen för villkor som rädda VSV replikering i restriktiva fjärilsarter cellkulturer. Den misslyckade infektionen i VSV i fjärilsarter celler skapar en utmärkt signal-brus-förhållande när testmetoder för VSV genuttryck. Till exempel de LU signaler detekteras i lysates från enda VSV-LUC infektioner var ~ 1.000-faldig högre än i mock-infekterade lysates, men dessa signaler endast ändrats ungefär dubbelt under en 72-h tid. Däremot coinfection VSV-Luc med VACV förbättrad LU signaler ~ 300-fold över inre VSV-LUC infektioner genom 72 hpi. Således, VSV rescue analyser visar en utmärkt dynamiskt omfång, som omfattar flera storleksordningar.

En av de kritiska steg att inrätta dessa analyser innebär beslutet att assay för VSV räddning med fluorescens - eller luminiscens-baserade metoder. Vi har visat exempel på hur VSV-kodade DsRed signaler kan analyseras kvantitativt med hjälp av live-cell avbildningstekniker och programvarupaket som underlättar automatiserade kvantifiering av DsRed-positiva celler i frånvaron eller närvaron av en undsättning coinfection. Om forskare har tillgång till live-cell imaging funktioner, är dessa analyser billiga att ställa och tillåta dem att fånga ett brett utbud av tidpunkter som får stöd i att upptäcka skillnader i VSV replikering kinetik som kan endast observeras i smala tid Windows. Däremot luminiscens tillvägagångssätt är i huvudsak slutpunkten analyser som kräver utarbetandet av cell lysates vid förutbestämda tidpunkter, och lysate beredning kan vara tidskrävande. Däremot, de luminescence-baserade analyserna inte kräver sofistikerade mikroskopi utrustning — endast en tallrik läsare kan läsa luminiscens signaler. Luminescence-baserade analyser har dessutom en större dynamiskt omfång än mikroskopi-baserade analyser som beräknar procentandelen av celler som smittats. Till exempel i mikroskopi analyser, DsRed-positiva celler (indikerar VSV-DsRed infektion) kan endast sträcker sig från 0 – 100% av analyserade celler i ett synfält. LU signaler mellan enda VSV-LUC och coinfection villkor (eller andra rescue villkor) kan däremot variera över flera tiopotenser.

En viktig fördel med att använda VSV -L. dispar cellen systemet presenteras här till skärmen för däggdjur virus-kodade immunomodulatorer är att den inneboende väljer för identifiering av viral faktorer som hämmar vad är benägna att bevaras och antika antivirala svar som föregår ryggradsdjur-specifika interferon svaret. Faktiskt, preliminära observationer tyder på att A51R proteiner hämma bevarade antivirala ubiquitin-proteasom-relaterade cellulära svar (se Gammon o.a. 13 och opublicerade data). Upptäckten av VACV A51R räddning av VSV var det första exemplet på en heterologa virus räddning av vertebrate virus i en ryggradslösa värd13, och det är troligt att dessa screening system kommer att avslöja ytterligare ryggradsdjur virus-kodade immunmodulerande . Det är viktigt att notera att nyckeln till använda VSV räddning som en avläsning för villkor som hämmar värd immunitet är att VSV replikering måste vara kraftigt begränsade (eller misslyckade) i den celltyp som VSV replikering behandlas i. Därför skulle mest däggdjur celltyper sannolikt vara olämpliga för dessa typer av analyser, eftersom VSV replikerar väl i däggdjursceller. Det är därför L. dispar celler användes här som ett naturligt restriktiva värd celltyp för VSV.

En tidigare studie i Drosophila celler visade att viral dämpning av antivirala RNAi svaren kunde identifieras genom cotransfection av uttrycket plasmider kodning kandidat RNAi dämpning och en självreplikerande Flock House virus genomisk RNA som kodar GFP i stället för B2, dess naturliga RNAi suppressor30. Replikering av Flock House genomisk RNA och produktion av GFP var beroende av dämpningen av RNAi cotransfected kandidat faktor och således räddningsaktionen av GFP uttryck anges RNAi dämpning30. Våra opublicerat arbete visar att överuttryck av virus-kodade RNAi-hämmare också räddar VSV-LUC genuttryck i L. dispar celler, vilket tyder på att detta system kan också användas för att identifiera dämpning av RNAi svaren i samband med infektion av bona fide virala patogener i motsats till en replicon. Faktiskt, ett konstaterande att RNAi-, IMD- och ubiquitin-proteasom-relaterade vägar bidra till begränsningen av VSV replikering i L. dispar celler13 antyder att viral antagonister av flera antivirala vägar kan identifieras genom VSV Rescue analyser presenteras här.

En potentiell begränsning av dessa screeningmetoder när det gäller identifiering av värd antivirala proteiner är att sekvensen L. dispar genomet inte är ännu tillgängliga. Men det finns allmänt tillgängliga L. dispar transcriptomes som kan användas för att identifiera kandidat värd mål för RNAi knockdown26,27,28. Dessutom har vi visat tidigare att VSV är begränsad i cellinjer som härstammar från andra lepidopterans13 och som nu har en allmänt tillgängliga genomet (t.ex., Manduca sexta)31. Cellinjer som härstammar från andra lepidopterans med sekvenserat genomet kan därför ersätta L. dispar cellerna beskrivs i protokollet här.

Med tanke på den växande ekonomiska och hot mot folkhälsan i arboviruses32, kan screening analyserna presenteras här ge nya strategier för att identifiera nya funktioner av arbovirus-värd-interaktioner som kan ha värde i utformningen av nya antivirala Therapeutics. Dessutom på grund av vår relativt begränsad förståelse för fjärilsarter mekanismer för att begränsa RNA virusreplikation, de verktyg som presenteras här ger nya möjligheter att probe de värd försvarsmekanismer som kodas av detta ekonomiskt viktiga ordning av insekter.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Författarna har något att avslöja.

Acknowledgments

D.G. stöddes av finansiering från University of Texas Southwestern Medical Centers begåvad Scholars Program. Författarna tackar Michael Whitt (University of Tennessee Health Science Center) och Sean Whelan (Harvard Medical School) för tillhandahållande av VSV-DsRed och VSV-LUC. Författarna också tacka Gary Luker (University of Michigan Medical School) för slag gåvan av VACV-FL-GFP stammen.

Materials

Name Company Catalog Number Comments
6-well tissue culture plates CELLTREAT 229106
24-well tissue culture plates CELLTREAT 229124
10 cm tissue culture dishes Corning C430167
Grace’s Insect Medium Sigma G8142
EX-CELL 420 Sigma 14420C
Fetal Bovine Serum - Optima Atlanta Biologicals S12450
Growth medium 1:1 mixture of Grace's Insect Medium and EX-Cell 420 Serum-Free Medium also containing 1% antibiotic-antimycotic solution and 10% Fetal bovine serum
Antibiotic-Antimycotic Solution (100×) Sigma A5955
Dulbecco’s Phosphate Buffered Saline (DPBS) Sigma D8662
Serum Free Media (SFM) Thermo Fisher 10902096
Cytosine arabinoside Sigma C1768
Transfection reagent Thermo Fisher 10362100
Corning cellgro DMSO (Dimethyl Sulfoxide) Corning 25950CQC
Reporter lysis buffer 5x Promega E3971
Luciferase Assay Reagent Promega E1483
96-Well Microplates Corning 3915
Mouse anti-FLAG antibody Wako 014-22383
Rabbit anti-firefly luciferase antibody Abcam ab21176
Mouse anti-actin antibody Sigma A2066
Mouse anti-VSV M N/A N/A Dr. John Connor (Boston University)
Mouse anti-VACV I3L N/A N/A Dr. David Evans (University of Alberta)
8-well Chambered dish Lab-Tek II 155409
Cell viability dye Thermo Fisher C12881
FLUOstar microplate reader BMG Labtech FLUOstar
Confocal microscope Olympus FV10i-LIV
Image analysis software Olympus v1.18 cellSens software
Eppendorf 5702 ventilated centrifuge Eppendorf 22628102
Odyssey Fc Infrared Imaging System Li-COR Biosciences Odyssey Fc
LD652 cells N/A N/A Dr. Basil Arif (Natural Resources Canada)
BSC-40 cells ATCC CRL-2761
BHK cells ATCC CCL-10
HeLa cells ATCC CCL-2
BSC-1 cells ATCC CCL-26
in vitro transcription and purification kit Thermo Fisher AM1626
PCR purification kit Qiagen 28104

DOWNLOAD MATERIALS LIST

References

  1. Nomaguchi, M., Fujita, M., Miyazaki, Y., Adachi, A. Viral tropism. Frontiers in Microbiology. 3, 281 (2012).
  2. Werden, S. J., McFadden, G. The role of cell signaling in poxvirus tropism: the case of the M-T5 host range protein of myxoma virus. Biochimica et Biophysica Acta (BBA) - Bioenergetics. 1784, (1), 228-237 (2008).
  3. McFadden, G., Mohamed, M. R., Rahman, M. M., Bartee, E. Cytokine determinants of viral tropism. Nature Reviews: Immunology. 9, (9), 645-655 (2009).
  4. Silva, J. M., et al. Second-generation shRNA libraries covering the mouse and human genomes. Nature Genetics. 37, (11), 1281-1288 (2005).
  5. Moffat, J., et al. A lentiviral RNAi library for human and mouse genes applied to an arrayed viral high-content screen. Cell. 124, (6), 1283-1298 (2006).
  6. Ma, D., Liu, F. Genome Editing and Its Applications in Model Organisms. Genomics Proteomics Bioinformatics. 13, (6), 336-344 (2015).
  7. Yin, H., Kauffman, K. J., Anderson, D. G. Delivery technologies for genome editing. Nature Reviews: Drug Discovery. 16, (6), 387-399 (2017).
  8. Hao, L., et al. Drosophila RNAi screen identifies host genes important for influenza virus replication. Nature. 454, (7206), 890-893 (2008).
  9. Houzet, L., Jeang, K. T. Genome-wide screening using RNA interference to study host factors in viral replication and pathogenesis. Experimental Biology and Medicine. 236, (8), Maywood, NJ. 962-967 (2011).
  10. Marceau, C. D., et al. Genetic dissection of Flaviviridae host factors through genome-scale CRISPR screens. Nature. 535, (7610), 159-163 (2016).
  11. Savidis, G., et al. Identification of Zika Virus and Dengue Virus Dependency Factors using Functional Genomics. Cell Reports. 16, (1), 232-246 (2016).
  12. Panda, D., Cherry, S. Cell-based genomic screening: elucidating virus-host interactions. Current Opinion in Virology. 2, (6), 784-792 (2012).
  13. Gammon, D. B., et al. A single vertebrate DNA virus protein disarms invertebrate immunity to RNA virus infection. Elife. 3, (2014).
  14. Letchworth, G. J., Rodriguez, L. L., Del cbarrera,, J, Vesicular stomatitis. Veterinary Journal. 157, (3), 239-260 (1999).
  15. Whelan, S. P., Ball, L. A., Barr, J. N., Wertz, G. T. Efficient recovery of infectious vesicular stomatitis virus entirely from cDNA clones. Proceedings of the National Academy of Sciences of the United States of America. 92, (18), 8388-8392 (1995).
  16. Cureton, D. K., Massol, R. H., Saffarian, S., Kirchhausen, T. L., Whelan, S. P. Vesicular stomatitis virus enters cells through vesicles incompletely coated with clathrin that depend upon actin for internalization. PLoS Pathogens. 5, (4), e1000394 (2009).
  17. Duntsch, C. D., et al. Recombinant vesicular stomatitis virus vectors as oncolytic agents in the treatment of high-grade gliomas in an organotypic brain tissue slice-glioma coculture model. Journal of Neurosurgery. 100, (6), 1049-1059 (2004).
  18. Li, Y., Yuan, S., Moyer, R. W. The non-permissive infection of insect (gypsy moth) LD-652 cells by Vaccinia virus. Virology. 248, (1), 74-82 (1998).
  19. Seet, B. T., et al. Poxviruses and immune evasion. Annual Review of Immunology. 21, 377-423 (2003).
  20. Cotter, C. A., Earl, P. L., Wyatt, L. S., Moss, B. Preparation of Cell Cultures and Vaccinia Virus Stocks. Current Protocols in Microbiology. 39, 11-18 (2015).
  21. Andrei, G., et al. Cidofovir resistance in vaccinia virus is linked to diminished virulence in mice. Journal of Virology. 80, (19), 9391-9401 (2006).
  22. Dascher, C., VanSlyke, J. K., Thomas, L., Balch, W. E., Thomas, G. Preparation of recombinant vaccinia virus for expression of small GTPases. Methods in Enzymology. 174-188 (1995).
  23. Martin, A., Rex, E. A., Ishidate, T., Lin, R., Gammon, D. B. Infection of Caenorhabditis elegans with Vesicular Stomatitis Virus via Microinjection. Bio-Protocol. 7, (22), (2017).
  24. Luker, K. E., Hutchens, M., Schultz, T., Pekosz, A., Luker, G. D. Bioluminescence imaging of vaccinia virus: effects of interferon on viral replication and spread. Virology. 341, (2), 284-300 (2005).
  25. Rozelle, D. K., Filone, C. M., Dower, K., Connor, J. H. Vaccinia reporter viruses for quantifying viral function at all stages of gene expression. Journal of Visualizes Experiments. (87), e51522 (2014).
  26. Cao, C., et al. Characterization of the transcriptome of the Asian gypsy moth Lymantria dispar identifies numerous transcripts associated with insecticide resistance. Pesticide Biochemistry and Physiology. 119, 54-61 (2015).
  27. Sparks, M. E., Blackburn, M. B., Kuhar, D., Gundersen-Rindal, D. E. Transcriptome of the Lymantria dispar (gypsy moth) larval midgut in response to infection by Bacillus thuringiensis. PloS One. 8, (5), e61190 (2013).
  28. Sparks, M. E., Gundersen-Rindal, D. E. The Lymantria dispar IPLB-Ld652Y cell line transcriptome comprises diverse virus-associated transcripts. Viruses. 3, (11), 2339-2350 (2011).
  29. Lin, G., Li, G., Granados, R. R., Blissard, G. W. Stable cell lines expressing baculovirus P35: resistance to apoptosis and nutrient stress, and increased glycoprotein secretion. In Vitro Cellular & Developmental Biology - Animal. 37, (5), 293-302 (2001).
  30. Li, W. X., et al. Interferon antagonist proteins of influenza and vaccinia viruses are suppressors of RNA silencing. Proceedings of the National Academy of Sciences of the United States of America. 101, (5), 1350-1355 (2004).
  31. Kanost, M. R., et al. Multifaceted biological insights from a draft genome sequence of the tobacco hornworm moth, Manduca sexta. Insect Biochemistry and Molecular Biology. 76, 118-147 (2016).
  32. Paixao, E. S., Teixeira, M. G., Rodrigues, L. C. Zika, chikungunya and dengue: the causes and threats of new and re-emerging arboviral diseases. BMJ Global Health. 3, (2018).
Arbovirus infektioner som Screening verktyg för identifiering av Viral immunmodulerande och värd antivirala faktorer
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Rex, E. A., Seo, D., Gammon, D. B. Arbovirus Infections As Screening Tools for the Identification of Viral Immunomodulators and Host Antiviral Factors. J. Vis. Exp. (139), e58244, doi:10.3791/58244 (2018).More

Rex, E. A., Seo, D., Gammon, D. B. Arbovirus Infections As Screening Tools for the Identification of Viral Immunomodulators and Host Antiviral Factors. J. Vis. Exp. (139), e58244, doi:10.3791/58244 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter