Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Invertire l'amplificazione isotermica mediata da Loop-trascrizione (RT-LAMP) analisi per Virus di Zika e geni Housekeeping in urina, siero ed esempi di zanzara

doi: 10.3791/58436 Published: September 14, 2018

Summary

Questo protocollo fornisce un metodo efficiente e a basso costo per rilevare virus di Zika o controllare obiettivi in campioni di urina e del siero umano o nelle zanzare di amplificazione isotermica mediata da loop trascrizione inversa (RT-LAMP). Questo metodo non richiede isolamento del RNA e può essere fatto entro 30 min.

Abstract

L'infezione con il virus di Zika (ZIKV) può essere asintomatico negli adulti, tuttavia, l'infezione durante la gravidanza può portare a aborto spontaneo e difetti di nascita neurologici severi. L'obiettivo del presente protocollo è quello di rilevare rapidamente ZIKV nei campioni umani e di zanzara. Il gold standard attuale per il rilevamento di ZIKV è quantitativa trascrizione d'inversione PCR (qRT-PCR); amplificazione isotermica mediata da loop trascrizione inversa (RT-LAMP) può consentire per un test più efficiente e a basso costo senza la necessità di costose attrezzature. In questo studio, RT-LAMP è utilizzato per il rilevamento di ZIKV in vari campioni biologici entro 30 min, senza prima isolare il RNA dal campione. Questa tecnica è dimostrata utilizzando ZIKV infettato il paziente urina e del siero e infettati campioni di zanzara. Acido ribonucleico ribosomiale 18s e actina sono utilizzati come controlli in campioni umani e zanzara, rispettivamente.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Nel 2015, virus di Zika (ZIKV) guadagnato l'attenzione globale prominente come una malattia infettiva di preoccupazione perché l'infezione durante la gravidanza è stato collegato a aborto spontaneo, morte endouterina, gravi difetti di nascita neurologici compreso microcefalia, come pure altri congenita difetti di nascita1. In rari casi, ZIKV è stato associato con la sindrome di Guillain-Barré. ZIKV principalmente è trasmessa dalle zanzare Aedes ; Tuttavia, può anche essere sparso attraverso il contatto sessuale1. Dato che l'infezione con ZIKV è asintomatica nella maggior parte delle persone o presenta con lievi sintomi simil-influenzali che si sovrappongono con i sintomi di infezione di altri arborviruses1, ci era un'esigenza di miglioramento dei metodi per la rilevazione rapida e conveniente di ZIKV a schermo persone nonché a popolazioni di zanzare locali.

Trascrizione d'inversione quantitativa PCR (qRT-PCR) è un test affidabile per la determinazione di ZIKV; Tuttavia, questa tecnica richiede costose attrezzature specializzate, personale addestrato e l'isolamento di RNA dal campione di interesse. Amplificazione isotermica mediata da loop trascrizione inversa (RT-LAMP) è un metodo di amplificazione dell'acido nucleico di One-Step basato su tecnologia PCR che richiede solo una temperatura di incubazione dovute all'uso di una DNA polimerasi termofila con filo Proprietà di scostamento. Questo aggira la necessità per un termociclatore e diminuisce la lunghezza del tempo necessario per completare il test. Ulteriori vantaggi del RT-LAMP includono la sua alta specificità e sensibilità, robustezza ad una gamma di temperature e livelli di pH, di resistenza a molti di inibitori della PCR2. Ha un costo relativamente basso e i reagenti sono stabili a temperatura ambiente. Date queste caratteristiche, RT-LAMP può essere distribuito in un laboratorio o sul campo. Come tale, reazioni di lampada sono state sviluppate per rilevare una gamma di agenti patogeni e altri tipi di infezione3,4,5. L'obiettivo del protocollo RT-LAMP descritto in questa carta è di rilevare ZIKV senza isolamento del RNA in umani campioni di siero e urina come pure come in una singola zanzara infetta entro 30 min attraverso RT-LAMP. Questo metodo può essere utilizzato per sostituire qRT-PCR, in quanto è uno strumento diagnostico rapido, sensibile che funziona rapidamente e in contesti di fuori del laboratorio.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Tutti i metodi descritti qui sono stati approvati da istituzionale Review Board (IRB) della salute di Beaumont. Tutti gli esperimenti sono stati eseguiti conformemente alle norme e linee guida pertinenti.

Attenzione: Tutti i materiali potenzialmente infettivi devono essere manipolati secondo gli standard di livello 2 di biosicurezza compreso l'uso di dispositivi di protezione individuale. Eventuali procedure che possono produrre aerosol devono essere eseguite in una cappa di biosicurezza. Inoltre, il lavoro con le zanzare dal vivo deve essere svolto in apposito impianto di artropodi contenimento livello 1-3. Dato l'associazione dell'infezione di ZIKV con le anomalie congenite, donne che sono incinte, provando a concepire, o i partner di queste donne dovrebbero minimizzare significativamente la loro esposizione di laboratorio a ZIKV. Trasporto dei campioni ZIKV è classificato negli Stati Uniti come categoria B sostanze biologiche secondo normative dipartimento del trasporto pericolosi materiali (49 CFR parte 171-180) e pertanto i campioni di trasporto dovrebbero aderire a quelli linee guida. Importazione negli Stati Uniti di ZIKV biospecimens richiede un centri per controllo delle malattie e prevenzione (CDC) permesso di importazione. Importazione di qualsiasi artropodi che potrebbe servire come un vettore per la trasmissione ZIKV, anche se non sono infetti, richiede un permesso di United States Department of Agriculture (USDA). Queste informazioni sono aggiornate al momento della pubblicazione. Consigli sono aggiornati possono essere trovati alla https://www.cdc.gov/zika/laboratories/lab-safety.html.

Nota: Reazioni di RT-LAMP sono soggette a tassi più elevati di reazioni falsamente positive, quindi bisogna tener conto nella pianificazione sperimentale. Tutti i set-up e l'esecuzione delle reazioni di RT-LAMP dovrebbe utilizzare designati pipette e puntali con filtro. Idealmente, si dovrebbe istituire un flusso di lavoro laterale. Se possibile, analisi e imaging (sezione 5) dovrebbe verificarsi in una stanza chiusa separata per evitare la contaminazione. Apertura di provette contenenti prodotti di RT-LAMP dovrebbe essere ridotto al minimo.

1. RT-LAMP Primer preparazione

  1. Ricostituire ogni primer RT-LAMP liofilizzato in acqua di grado molecolare a una concentrazione finale di 100 µM (tabella 1). Brevemente vortex la soluzione di primer per garantire una soluzione omogenea e brevemente rotazione verso il basso la soluzione in una centrifuga di piano d'appoggio per raccogliere tutta la soluzione di primer alla massima velocità.
  2. Preparare un 10 x RT-LAMP Primer Mix dei primer FIP, BIP, F3, B3, LF e LB utilizzando i volumi nella tabella 2. Brevemente vortex la soluzione di primer per garantire una soluzione omogenea e brevemente rotazione verso il basso la soluzione in una centrifuga di piano d'appoggio per evitare qualsiasi perdita alla massima velocità.
    Nota: Il primer RT-LAMP per Ae. aegypti actina (AEDAE) non contiene un primer LB (ciclo primer non sono sempre necessari per reazioni di RT-LAMP). In questo caso, sostituire il volume di primer LB con acqua grado molecolare.
  3. Conservare i primer a-20 ° C tra un utilizzo ed evitare cicli di scongelamento gratis.

2. preparazione del campione

  1. Per i campioni di urina umana: Utilizzare l'urina fresca, congelata urina o urina in conservante. Per esempio fresco o congelato: immediatamente girare giù il campione dopo la raccolta per 10 min a 700 x ge utilizzare il surnatante per analisi o congelare a-80 ° C per un uso futuro. Scongelare i campioni congelati sul ghiaccio prima dell'uso.
  2. Per campioni di siero umano: Utilizzare entrambi i campioni di siero fresco o congelato.
  3. Per ZIKV infettato linee cellulari: utilizzare media condizionati o lisati cellulari.
    Nota: Cell-free condizionata media da Ae. Albopictus C6/36 celle 8 giorni dopo l'infezione può essere utilizzato come controlli positivi per le reazioni ZIKV RT-LAMP.
  4. Per le zanzare Ae. aegypti : utilizzare o carcasse di zanzara intero fresco o congelato. Scongelare i surgelati zanzare sul ghiaccio. Preparare una zanzara greggia lisata inserendo una zanzara individuo in 100 µ l di tampone fosfato salino (PBS) e omogeneizzare schiacciando la zanzara 10 volte con una punta di pipetta P10 (Figura 1). Centrifugare brevemente il greggio lisato a pellet eventuali detriti. Utilizzare il surnatante per analisi di RT-LAMP a valle.
    Nota: Controlli positivi possono essere generati in un ambiente di laboratorio infettando le zanzare femmina mediante microiniezione intratoracica con circa 103 equivalenti di genoma del virus in un volume di 200 nL e raccolta la zanzara 5 giorni dopo l'infezione.

3. preparare la miscela di RT-lampada Master

  1. Preparare una reazione di mix master RT-LAMP sul ghiaccio per ciascun primer impostato per essere utilizzato tramite Guida volume in tabella 3.
    Nota: L'uso di termolabile uracile DNA glicosilasi (UDG) aiuta a prevenire falsi positivi.
  2. Vortice brevemente per garantire che tutti i campioni sono ben miscelati, quindi rallentare brevemente per prevenire la perdita di volume.

4. RT-LAMP test

  1. Dispensare 23.0 µ l di master mix RT-LAMP per reazione in una provetta PCR 200 µ l. Aggiungere 2,0 µ l di campione (urina, siero o il surnatante lisato zanzara grezza come descritto nel passaggio 2). Questo porterà il volume totale a 25,0 µ l per reazione di RT-LAMP. Per il controllo negativo, usare acqua di grado molecolare. Includere un controllo positivo.
    Nota: Un scorte PCR standard o virus da supernatante di linee cellulari infettate possono essere utilizzato come controllo positivo.
    1. Opzionale: Includono una reazione di controllo di specificità di un arbovirus correlate quali virus dengue (DENV). Preparare il campione come descritto nel passaggio 2 in base al tipo di campione. Aggiungere 2,0 µ l del controllo specificità a 23.0 µ l di master mix RT-LAMP in una provetta PCR 200 µ l.
  2. Riscaldare i campioni a 61 ° C per 30 min utilizzando un blocco di calore, bagno d'acqua o termociclatore.
  3. Calore per disattivare la polimerasi riscaldamento a 80 ° C per 10 min.

5. RT-LAMP analisi

Nota: Eseguire analisi di RT-LAMP in uno spazio separato, chiuso.

  1. Dopo l'incubazione, accedere visivamente reazioni di RT-LAMP ricercando la presenza di un cambiamento di colore.
    1. Diluire l'acido nucleico fluorescente tintura 01:10 in tampone TAE (40 mM Tris, acido acetico 20 mM, 1 mM EDTA).
      Attenzione: Qualsiasi macchia di acido nucleico si lega agli acidi nucleici e quindi è un agente cancerogeno. Indossare guanti durante la manipolazione.
    2. 12 µ l del RT-LAMP, aggiungere 2 µ l di diluizione della tintura fluorescente dell'acido nucleico.
      Nota: Reazioni Negative sarà colore arancione e reazioni positive sarà di colore giallo/verde.
    3. Optional: Scattare foto di reazioni di RT-LAMP su sfondo bianco, usando una macchina fotografica.
  2. Posizionare i campioni sotto 302 nm UV luce per confermare la presenza di prodotti di RT-LAMP di fluorescenza. Scattare foto del risultato usando una macchina fotografica.
    Nota: Le reazioni Positive RT-LAMP avrà un output fluorescente.
    Attenzione: Indossare UV occhio protettivo googles o faccia scudo quando si lavora con luce UV.
  3. Optional: Confermare la presenza di prodotti di RT-LAMP eseguendo l'elettroforesi del gel sui campioni.
    1. Versare un gel di agarosio al 2% in 1 x TAE buffer con una macchia di acido nucleico per la visualizzazione.
      Attenzione: Qualsiasi macchia di acido nucleico si lega agli acidi nucleici e quindi è un agente cancerogeno. Indossare guanti durante la manipolazione.
    2. Aggiungere 5 µ l di una scala di DNA nella corsia prima di confrontare i pesi molecolari.
    3. Per ogni reazione di RT-LAMP, mescolare 13 µ l di miscela di reazione di RT-LAMP con 2 µ l di DNA della tintura di caricamento. Caricare la miscela di 15 µ l che contiene il DNA della tintura di caricamento.
    4. Eseguire il gel a 90 V per 90 min o fino a quando le bande sono separate e immagine con 302 nm di luce UV.
      Nota: Le reazioni Positive RT-LAMP avrà un modello laddering. Reazioni negative RT-LAMP non devono contenere qualsiasi bande.

6. smaltimento

  1. Smaltire le reazioni di RT-LAMP in sacchetti sigillati doppi. Non autoclavare come questo può vaporizzerai i prodotti di RT-LAMP, che portano a reazioni falsamente positive in futuro.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Reazioni di RT-lampada possono essere analizzate utilizzando tre metodi diversi. In primo luogo, con l'aggiunta di un colorante fluorescente dell'acido nucleico, reazioni positive sarà di colore giallo/verde dove reazioni negative apparirà arancione colore ad occhio nudo. In secondo luogo, l'aggiunta di coloranti fluorescenti dell'acido nucleico per reazione di RT-LAMP genera un segnale fluorescente quando i campioni sono eccitati da luce UV. Reazioni negative non avrà un segnale fluorescente rilevabile sopra qualsiasi fluorescenza di fondo che possono essere presente in piccole quantità nel controllo negativo. Infine, le reazioni di RT-LAMP possono essere eseguite su un gel di agarosio. Le reazioni positive di RT-LAMP avrà un disegno a strisce, mentre reazioni negative non avrà bande di DNA. Nella Figura 2 e 3sono riportati alcuni esempi di questo utilizzando tutti e tre questi metodi di analisi. Nessuno di questi campioni hanno avuti RNA isolato prima del RT-LAMP. Nella figura 1 viene illustrato lo schiacciamento di una zanzara tutta in PBS, che è sufficiente per l'uso nella reazione di RT-LAMP. In Figura 2, è dimostrata la specificità della reazione ZIKV RT-LAMP: solo il controllo molecolare di ZIKV, non il controllo molecolare DENV o controllo negativo, ha una reazione positiva di RT-LAMP. Inoltre, ZIKV viene rilevato nelle urine e nel siero di un paziente con l'infezione di ZIKV nota, ma non nel paziente asintomatico controllo senza infezione ZIKV (Figura 2A). Nella Figura 2B, i campioni sono testati per umano 18s rRNA usando RT-LAMP. Solo i campioni da pazienti (urina o siero), ma non i controlli molecolari o il controllo negativo, sono positivi per 18s rRNA. Di conseguenza, 18s rRNA RT-lampada può essere utilizzata come un controllo di qualità per le reazioni di RT-LAMP per i campioni da pazienti umani. Campioni di zanzara possono essere analogamente testati per ZIKV o il controllo di qualità di RT-LAMP, AEDAE (Figura 3). In questo esempio, il controllo molecolare positivo per ZIKV, come pure la zanzara infetta con ZIKV sono positive per ZIKV. Il controllo negativo, il controllo molecolare per DENV, la simulazione infetto zanzara (la zanzara microiniettata con terreni di coltura cellulare non contenente nessun virus), e la zanzara DENV infettati sono tutti negativi per ZIKV (Figura 3A). Tuttavia, tutte le zanzare sono positive per AEDAE di RT-LAMP (Figura 3B).

Quando possibile, tutti i tre metodi analitici devono essere utilizzati per confermare una reazione positiva o negativa, come a volte il segnale fluorescente può essere debole e alcuni individui possono essere daltonico, rendendo difficile determinare il cambiamento di colore di visual. Nei casi in cui il controllo negativo è positivo, l'intero set di campioni testati non è valido come contaminazione e pertanto non è possibile escludere i falsi positivi. Nei casi in cui il controllo positivo è negativo, l'intero set di campioni non è valido come la reazione di RT-LAMP non può avere lavorato. Si tratta di una lettura qualitativa, tuttavia, più copie del virus si tradurrà in un aumento dei prodotti di RT-LAMP che può essere apprezzato da intensità di fluorescenza o dall'intensità del DNA banding modello mediante elettroforesi in gel.

Figure 1
Figura 1 : Preparazione di zanzara greggio lisato. (A) posto una zanzara in 100 µ l di PBS in una microcentrifuga. (B) usando una punta di pipetta P10, schiacciare la zanzara contro i lati del tubo 10 volte. (C) questo produce un lisato di greggio che dovrebbe essere filato giù brevemente in una centrifuga di piano d'appoggio a pellet detriti. Solo il surnatante deve essere utilizzato per la reazione di RT-LAMP. Clicca qui per visualizzare una versione più grande di questa figura.

Figure 2
Figura 2 : ZIKV e rRNA 18S RT-LAMP nei campioni di urina e del siero. Campioni di urina o siero da un paziente asintomatico controllo (C01) o il paziente ZIKV infettata (Z01) sono stati sottoposti a un ZIKV (A) o reazioni di RT-LAMP specifiche 18S rRNA (B). Reazioni di RT-LAMP sono state visualizzate dopo l'aggiunta di un acido nucleico fluorescente tingere da fluorescenza occhio (pannello superiore), verde (pannello centrale), o gel elettroforesi (pannello inferiore). Lane m: DNA Marker massa; NTC: Nessun modello control (controllo negativo); ZIKV: ZIKV PCR Standard positivo di controllo; DENV: Controllo positivo DENV. Clicca qui per visualizzare una versione più grande di questa figura. 

Figure 3
Figura 3 : ZIKV e AEDAE RT-lampada in Aegypti AE. . Singola Ae. aegypti infettati con finto controllo, ZIKV o DENV sono stati sottoposti a ZIKV (A) o AEDAE (B) specifiche reazioni di RT-LAMP. Reazioni di RT-LAMP sono state visualizzate dopo l'aggiunta di un acido nucleico fluorescente tingere da fluorescenza occhio (pannello superiore), verde (pannello centrale), o gel elettroforesi (pannello inferiore). Lane m: DNA Marker massa; NTC: Nessun modello control (controllo negativo); ZIKV: ZIKV PCR Standard positivo di controllo; DENV: Controllo positivo DENV. Clicca qui per visualizzare una versione più grande di questa figura. 

Destinazione Primer Sequenza (5' - 3')
Homo sapiens 18S rRNA 18SrRNA-FIP *
18SrRNA-BIP *
18SrRNA-F3
18SrRNA-B3
18SrRNA-LF
18SrRNA-LB
TGGCCTCAGTTCCGAAAACCAACCTGGATACCGCAGCTAGG
GGCATTCGTATTGCGCCGCTGGCAAATGCTTTCGCTCTG
GTTCAAAGCAGGCCCGAG
CCTCCGACTTTCGTTCTTGA
AGAACCGCGGTCCTATTCCATTATT
ATTCCTTGGACCGGCGCAAG
ZIKV ZIKV-FIP *
ZIKV-BIP *
ZIKV-F3
ZIKV-B3
ZIKV-LF
ZIKV-LB
AACCTGAGGGCATGTGCAAACCGCGGTCAGTGGAGATGACT
CACAGGAGTGGAAACCCTCGACTGAAGTGGTGGGAGCAGAA
GCAGAGCAATGGATGGGATA
CCCATCCTTGAGGTACAGCT
TCGATTGGCTTCACAACGC
GGAGCAATTGGGAAGAAGTCC
AE. aegypti actina Ae21-FIP *
Ae21-BIP *
Ae21-LF
Ae21-F3
Ae21-B3
TGCTTGGTCCCTGCCTGGGAGACAGCCCACCAGAACGA
GAGACGAGAACGGCCCAGCGGGTCTGGTGTGTGTCTTTG
ACCGCAAGGCCAAGAACCG
CGGCGCCACCACAAGA
TCGTGCCTGTGTTTGTCG
* Primer deve essere purificato da rapido ad alte prestazioni cromatografia liquida (HPLC). Per tutti gli altri primer, condizioni standard di dissalazione sono sufficienti.

Tabella 1: Primer sequenze per reazioni di RT-LAMP. Sequenze dell'iniettore sono originariamente descritto nella precedente pubblicazione6.

Volume (µ l) Primer Concentrazione d'archivio (µM) Concentrazione finale (µM)
80 Forward Primer interno (FIP) 100 16
80 Primer interno con le versioni precedenti (BIP) 100 16
10 Forward Primer esterno (F3) 100 2
10 Primer esterno all'indietro (B3) 100 2
20 Loop in avanti (LF) 100 4
20 Ciclo con le versioni precedenti (LB) 100 4
280 acqua di grado molecolare - -
500 Totale

Tabella 2: preparazione di 10 x Mix di Primer RT-LAMP. Il primer RT-LAMP per Ae. aegypti actina non contiene un primer BF; sostituire questo volume con acqua.

1 x Volume (µ l) Componente Finale conc. Per 25 µ l di Volume
2.5 Tampone di amplificazione isotermica 10x 1 x
1.8 100 mM dU/A/T/C/GTPs 1,4 mM
2.0 100 mM MgSO4 6 + 2 mM nel buffer = 8 mM [gamma da 4-10 mM]
2.5 10 x primer 1,6 ΜM FIP/BIP, 0,2 ΜM F3/B3, 0,4 ΜM FL/BL
1.0 termofila DNA polimerasi con spostamento del filo (8.000 U/mL) 8 U
0,5 Trascrittasi inversa (15.000 U/mL) 7.5 U
0,5 UDG (1.000 U/mL) 0,5 U
12.3 acqua di grado molecolare -
23.0 Totale

Tabella 3: Preparazione di RT-lampada Master Mix.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Il dosaggio di ZIKV RT-LAMP descritto in questa carta funziona utilizzando sia umani e zanzara campioni6. Il limite di rilevazione era circa 1 genoma equivalente6, che dovrebbe essere sufficiente, poiché il carico virale tipico di un paziente sintomatico ZIKV infettata è 103 a PFU/mL 106 7. Inoltre, questo metodo può rilevare ZIKV nei campioni senza primo isolamento di RNA e senza amplificazione di virus in coltura cellulare. Questo riduce significativamente il tempo, costi e rischi per la salute di questo test rispetto al qRT-PCR.

Campioni di urina utilizzati presso il rapporto di volume indicato nel presente protocollo dovrebbero consentire reazioni di RT-LAMP avvengono senza un isolamento di RNA. Mentre uno potrebbe teoricamente aumentare la quantità del campione utilizzato in una reazione di RT-LAMP, cura dovrebbe essere esercitata quando questo campione è urina. L'urina contiene più sostanze chimiche che potrebbero inibire le reazioni di PCR; urea nell'urina è noto a degradare le polimerasi8 e utilizzando un rapporto di reazione di urina/RT-LAMP che è troppo alto impedisce la reazione di RT-LAMP. Se si prevede che una bassa quantità di virus, sarebbe meglio eseguire un isolamento di RNA usando un kit specifico per urina. Allo stesso modo, il siero può contenere inibitori della PCR che possono inibire RT-LAMP quando il siero è usato in un più alto volume8.

Incluso in questo protocollo è l'inserimento di controlli di qualità per le reazioni di RT-LAMP, simile a un controllo di carico nei protocolli macchianti occidentali. Se un campione clinico è negativo per il controllo di qualità di RT-LAMP, una reazione negativa per la ZIKV RT-lampada può essere un falso negativo come il campione può contenere un'elevata quantità di inibitori della PCR o la scarsa quantità di RNA totale. Non è necessario isolare il RNA del campione prima dell'analisi di RT-LAMP. I risultati di RT-LAMP rappresentativi in questo protocollo sono stati ottenuti senza isolamento del RNA. Tuttavia, isolamento del RNA può migliorare la rilevazione nei campioni con carica virale bassa o che possono contenere alti livelli di inibitori della PCR. Per la maggior parte dei tipi di campione tra cui siero, un kit di isolamento del RNA può essere utilizzato seguendo il protocollo suggerito dal produttore. Per campioni di urina, deve essere utilizzato un kit di isolamento del RNA specifico per campioni di urina. Per esempi di zanzara, è consigliabile per lisare la zanzara eseguendo la zanzara in 100 µ l di PBS attraverso una colonna di triturazione per 2 min a velocità massima o douncing prima di isolamento del RNA. RNA possa essere eluito in 30 µ l di tampone di eluizione e conservato a-80 ° C fino all'utilizzo.

Isolamento del RNA è quindi suggerito di rimuovere gli inibitori endogeni di PCR o concentrarsi il RNA prima del RT-LAMP. Se il controllo di qualità di RT-LAMP è ancora negativo, qRT-PCR dovrebbe essere utilizzato per il rilevamento di ZIKV.

I primer RT-LAMP in questo protocollo sono stati confermati a lavorare a una gamma di temperature (57 – 65 ° C) e l'incubazione volte (8-60 min.), così come uso non convenzionale di fonti di calore (ad es., riscaldatore di razione senza fiamma, bagnomaria) fuori standard condizioni di laboratorio. Tutte le temperature testate ha dato risultati comparabili. Basato sulla rilevazione di viraggio visivo da solo, il momento ottimale per la rilevazione dei prodotti ZIKV RT-LAMP era 30 min. Tuttavia, il rilevamento di eccitazione luce UV o disegni sui gel a strisce erano positive con appena 8 min tempo di incubazione totale. Alcuni protocolli di RT-LAMP includono DMSO, ma in questo protocollo, può provocare l'inibizione della reazione di RT-LAMP. Utilizzando una DNA polimerasi termofila che possono essere impostata a temperatura ambiente può avere vantaggi rispetto selvaggio-tipo termofila DNA polimerasi compresi i segnali di amplificazione più velocemente e hanno una maggiore stabilità a temperatura ambiente9,10 . Il bromuro di etidio può essere utilizzato invece per la visualizzazione di acido nucleico in gel di agarosio al 2%, tuttavia, altri coloranti fluorescenti dell'acido nucleico per gel di agarosio hanno basso potenziale mutageno, rendendoli una scelta più sicura. Tuttavia, opportune misure di sicurezza come ad esempio indossare guanti devono ancora essere utilizzati.

Una limitazione di questo protocollo è che è una valutazione qualitativa e non una tecnica quantitativa, tuttavia, quantificazione relativa può essere fatto6. Inoltre, primer RT-LAMP sono altamente specifici e sono stati progettati contro una sequenza altamente conservata della proteina nonstructural 5 del ZIKV che è trovato in 16 ceppi e verificato per funzionare in almeno 5 ceppi6. È possibile che mutazioni estese a ZIKV allo stato brado potrebbero non essere rilevabile da questi iniettori in futuro. Altri gruppi hanno sviluppato nuove tecnologie per il rilevamento di ZIKV che possono essere di interesse11,12,13,14,15,16,17 .

In sintesi, questo protocollo fornisce un metodo veloce, semplice e conveniente per ZIKV in una varietà di tipi di campioni che non richiede attrezzature specializzate. Questo fornisce un nuovo strumento diagnostico per la rilevazione di ZIKV in cui RNA non deve essere isolato prima della reazione di RT-LAMP.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

LEL e MBC sono proprietà intellettuale su metodi di diagnosi del virus di Zika. Gli autori restanti non hanno nessun interessi concorrenti.

Acknowledgments

Questo lavoro è stato supportato dal contributo filantropico famiglia Maureen e Ronald Hirsch e campo Neurosciences Institute, s. Maria del Michigan. I finanziatori non avevano alcun ruolo nel disegno dello studio, raccolta dati e analisi, decisione di pubblicare o preparazione del manoscritto. Ringraziamo anche Dr. Bernadette Zwaans ed Elijah Ward per la loro revisione critica del manoscritto.

Materials

Name Company Catalog Number Comments
Bst 2.0 WarmStart DNA polymerase New England Biolabs M0537S
Isothermal Amplification Buffer  New England Biolabs B0537S
WarmStart RTx Reverse Transcriptase New England Biolabs M0380S
Antarctic Thermolabile UDG New England Biolabs M0372S
MgSO4 New England Biolabs B1003S
100 mM dATP Solution New England Biolabs N0440S Deoxynucleotide Set N0446S
100 mM dCTP Solution New England Biolabs N0441S Deoxynucleotide Set N0446S
100 mM dTTP Solution New England Biolabs N0443S Deoxynucleotide Set N0446S
100 mM dGTP Solution New England Biolabs N0442S Deoxynucleotide Set N0446S
100 mM dUTP Solution Thermo Fisher Scientific R0133
SYBR Green I Nucleic Acid Gel Stain Invitrogen S7563
Nancy-520 Sigma Aldrich 01494
Low DNA Mass Ladder Invitrogen 10-068-013
Zika Postive Control Robert Koch Institute, Germany N/A
Agarose Thermo Fisher Scientific BP1600
BlueJuice Gel Loading Buffer Invitrogen 10816015
Primers Integrated DNA Technologies Custom Oligo
Nuclease-Free Water Ambion AM9938
Urine Preservative Norgen Biotek 18126
ZIKV PCR Standard Robert Koch Institute N/A Vero E6 cell supernatants
DENV2 New Guinea C Control Connecticut Agricultural Experiment Station N/A

DOWNLOAD MATERIALS LIST

References

  1. Petersen, L. R., Jamieson, D. J., Powers, A. M., Honein, M. A. Zika Virus. New England Journal of Medicine. 374, (16), 1552-1563 (2016).
  2. Francois, P., et al. Robustness of a loop-mediated isothermal amplification reaction for diagnostic applications. Federation of European Microbiological Societies Immunology and Medical Microbiology. 62, (1), 41-48 (2011).
  3. Tomita, N., Mori, Y., Kanda, H., Notomi, T. Loop-mediated isothermal amplification (LAMP) of gene sequences and simple visual detection of products. Nature Protocols. 3, (5), 877-882 (2008).
  4. Gandasegui, J., et al. The Rapid-Heat LAMPellet Method: A Potential Diagnostic Method for Human Urogenital Schistosomiasis. Public Library of Science Neglected Tropical Diseases. 9, (7), 0003963 (2015).
  5. Barkway, C. P., Pocock, R. L., Vrba, V., Blake, D. P. Loop-mediated isothermal amplification (LAMP) assays for the species-specific detection of Eimeria that infect chickens. The Journal of Visualized Experiments. (96), (2015).
  6. Lamb, L. E., et al. Rapid Detection of Zika Virus in Urine Samples and Infected Mosquitos by Reverse Transcription-Loop-Mediated Isothermal Amplification. Scientific Reports. 8, (1), 3803 (2018).
  7. Faye, O., et al. One-step RT-PCR for detection of Zika virus. Journal of Clinical Virology. 43, (1), 96-101 (2008).
  8. Schrader, C., Schielke, A., Ellerbroek, L., Johne, R. PCR inhibitors - occurrence, properties and removal. Journal of Applied Microbiology. 113, (5), 1014-1026 (2012).
  9. Poole, C. B., Tanner, N. A., Zhang, Y., Evans, T. C., Carlow, C. K. Diagnosis of brugian filariasis by loop-mediated isothermal amplification. Public Library of Science Neglected Tropical Diseases. 6, (12), 1948 (2012).
  10. Tanner, N. A., Zhang, Y., Evans, T. C. Simultaneous multiple target detection in real-time loop-mediated isothermal amplification. Biotechniques. 53, (2), 81-89 (2012).
  11. Chan, K., et al. Rapid, Affordable and Portable Medium-Throughput Molecular Device for Zika Virus. Scientific Reports. 6, 38223 (2016).
  12. Lee, D., et al. Simple and Highly Sensitive Molecular Diagnosis of Zika Virus by Lateral Flow Assays. Analytical Chemistry. 88, (24), 12272-12278 (2016).
  13. Pardee, K., et al. Low-Cost Detection of Zika Virus Using Programmable Biomolecular Components. Cell. 165, (5), 1255-1266 (2016).
  14. Song, J., et al. Instrument-Free Point-of-Care Molecular Detection of Zika Virus. Analytical Chemistry. 88, (14), 7289-7294 (2016).
  15. Yaren, O., et al. Point of sampling detection of Zika virus within a multiplexed kit capable of detecting dengue and chikungunya. BioMed Central Infectious Diseases. 17, (1), 293 (2017).
  16. Wang, X., et al. Rapid and sensitive detection of Zika virus by reverse transcription loop-mediated isothermal amplification. Journal of Virological Methods. 238, 86-93 (2016).
  17. Priye, A., et al. A smartphone-based diagnostic platform for rapid detection of Zika, chikungunya, and dengue viruses. Scientific Reports. 7, 44778 (2017).
Invertire l'amplificazione isotermica mediata da Loop-trascrizione (RT-LAMP) analisi per Virus di Zika e geni Housekeeping in urina, siero ed esempi di zanzara
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Bartolone, S. N., Tree, M. O., Conway, M. J., Chancellor, M. B., Lamb, L. E. Reverse Transcription-Loop-mediated Isothermal Amplification (RT-LAMP) Assay for Zika Virus and Housekeeping Genes in Urine, Serum, and Mosquito Samples. J. Vis. Exp. (139), e58436, doi:10.3791/58436 (2018).More

Bartolone, S. N., Tree, M. O., Conway, M. J., Chancellor, M. B., Lamb, L. E. Reverse Transcription-Loop-mediated Isothermal Amplification (RT-LAMP) Assay for Zika Virus and Housekeeping Genes in Urine, Serum, and Mosquito Samples. J. Vis. Exp. (139), e58436, doi:10.3791/58436 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter