Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Genetics

3 का निर्धारण '-टर्मिनी और एचआईवी-1 संक्रमित कोशिकाओं में रिवर्स प्रतिलेखन के दौरान नवजात एकल फंसे वायरल डीएनए अणुओं के दृश्यों

doi: 10.3791/58715 Published: January 30, 2019

Summary

यहाँ हम एक गहरी sequencing दृष्टिकोण है कि नवजात 3 की एक निष्पक्ष दृढ़ संकल्प प्रदान करता है वर्तमान-टर्मिनी के रूप में के रूप में अच्छी तरह से एकल असहाय डीएनए अणुओं के उत्परिवर्तन प्रोफाइल । मुख्य आवेदन नवजात retroviral पूरक DNAs (cDNAs), retroviral रिवर्स प्रतिलेखन की प्रक्रिया के दौरान उत्पंन मध्यवर्ती के लक्षण वर्णन है ।

Abstract

वायरस प्रतिकृति के दौरान न्यूक्लिक एसिड मध्यवर्ती की निगरानी एंटीवायरल यौगिकों और वायरल डीएनए संश्लेषण पर मेजबान सेल प्रोटीन की कार्रवाई के प्रभाव और तंत्र में अंतर्दृष्टि प्रदान करता है । यहां हम एक सेल की कमी का पता आधारित, उच्च कवरेज, और उच्च संकल्प परख है कि वायरस के संक्रमण के शारीरिक संदर्भ के भीतर retroviral रिवर्स प्रतिलेखन मध्यवर्ती परिभाषित करने में सक्षम है । वर्णित विधि 3 '-नवजात पूरक डीएनए के टर्मिनी (सीडीएनए) एचआईवी के भीतर अणुओं-1 एकल न्यूक्लियोटाइड संकल्प पर संक्रमित कोशिकाओं को कब्जा । प्रोटोकॉल पूरे सेल डीएनए की कटाई शामिल है, संकर पर कब्जा, अनुकूलक बंधाव, जेल शुद्धि, पीसीआर प्रवर्धन, गहरी अनुक्रमण, और डेटा विश्लेषण द्वारा आकार अंश के माध्यम से वायरल डीएनए के संवर्धन लक्षित । एक महत्वपूर्ण कदम है अनुकूलक अणुओं के कुशल और निष्पक्ष बंधाव 3 ' खोलने के लिए-डीएनए टर्मिनी । वर्णित विधि के आवेदन एक दिए गए नमूने में प्रत्येक विशेष लंबाई की रिवर्स टेप की बहुतायत निर्धारित करता है । यह भी रिवर्स टेप में (आंतरिक) अनुक्रम भिंनता के बारे में जानकारी प्रदान करता है और इस तरह किसी भी संभावित उत्परिवर्तनों । सामांय में, परख किसी भी डीएनए से संबंधित प्रश्नों के लिए उपयुक्त है ' 3-विस्तार, बशर्ते कि टेंपलेट अनुक्रम जाना जाता है ।

Introduction

काटना और वायरल प्रतिकृति पूरी तरह से समझने के लिए, तेजी से परिष्कृत तकनीक है कि कब्जा प्रतिकृति मध्यवर्ती आवश्यक हैं । विशेष रूप से, संक्रमित कोशिकाओं के संदर्भ में वायरल न्यूक्लिक एसिड प्रजातियों की सटीक परिभाषा नई अंतर्दृष्टि प्रदान कर सकते हैं, के बाद से कई वायरल प्रतिकृति तंत्र की तारीख को अलग इन विट्रो प्रतिक्रियाओं में जांच की गई है । एक प्रमुख उदाहरण retroviruses में रिवर्स प्रतिलेखन की प्रक्रिया है, जैसे मानव इम्यूनो वायरस 1 (एचआईवी-1) । एचआईवी के विभिंन कदम-1 रिवर्स प्रतिलेखन, जिसके दौरान वायरल एंजाइम रिवर्स transcriptase (आरटी) डबल-असहाय डीएनए में एकल-असहाय आरएनए जीनोम प्रतियां, प्राइमरी विस्तार परख में शुद्ध प्रोटीन और न्यूक्लिक के साथ मुख्य रूप से अध्ययन किया गया है एसिड1,2,3,4,5। जबकि मौलिक सिद्धांतों की स्थापना की थी, ऐसे परख सभी वायरल और सेलुलर घटकों को शामिल नहीं है और शामिल कारकों के जैविक रूप से प्रासंगिक stoichiometries को प्रतिबिंबित नहीं कर सकते हैं । इसलिए, हम एक शक्तिशाली तकनीक के लिए उनके सटीक सीडीएनए 3 ' के साथ रिवर्स प्रतिलेखन मध्यवर्ती के स्पेक्ट्रा निर्धारित करने के लिए डिजाइन-टर्मिनी (यानी, उनके सटीक लंबाई का निर्धारण) और जीने के संक्रमण के संदर्भ में न्यूक्लियोटाइड दृश्यों कक्ष6. समय पाठ्यक्रम प्रयोगों से डेटा का संग्रह एंटीवायरल अणुओं या प्रोटीन की उपस्थिति के रूप में विभिन्न स्थितियों के तहत टेप के प्रोफ़ाइल की तुलना करने के लिए उपयोग किया जा सकता है, कि दक्षता और डीएनए संश्लेषण की processivity को प्रभावित कर सकते हैं और संचय. यह प्राकृतिक रोगज़नक़ जीवन चक्र, जो अक्सर लक्षित दवा डिजाइन और सफल चिकित्सीय हस्तक्षेप के लिए आधार है की एक अधिक विस्तृत समझ की अनुमति देता है ।

एचआईवी-1 उल्टा प्रतिलेखन एक tRNA प्राइमर के एनीलिंग द्वारा जीनोमिक आरएनए टेंपलेट है, जो तो आरटी द्वारा विस्तारित करने के लिए एक कम एकल-कतरा सीडीएनए प्रतिलिपि का उत्पादन किया जाता है एक शूंय-किनारा मजबूत-बंद (-एसएसएस) (देखो के लिए शुरू की घटनाओं की एक श्रृंखला शामिल चित्रा 1) । बाद में,-एसएसएस सीडीएनए 5 '-लांग टर्मिनल दोहराने (बाएं से दाएं) 3 ' जीनोमिक आरएनए, जहां यह anneals और शूंय से जारी आरटी मध्यस्थता बढ़ाव के लिए प्राइमर के रूप में कार्य करता है की लीटर के बाएं से स्थानांतरित किया जाता है (रिवर्स प्रतिलेखन पर समीक्षा देखें1 , 2 , 3 , 4). यह पहला किनारा हस्तांतरण दर-रिवर्स प्रतिलेखन के कदम को सीमित करने में से एक है; अत: sss सीडीएनए संचय करने के लिए जाना जाता है । संक्रमित कोशिकाओं में रिवर्स प्रतिलेखन उत्पादों पर कब्जा करने के लिए मूल कार्यप्रवाह और पुस्तकालय डिजाइन चित्रा 2aमें उल्लिखित है । विशिष्ट प्राइमर और विश्लेषण सेटिंग्स है कि प्रोटोकॉल में उपयोग किया जाता है और तालिका 1 लक्ष्य में सूचीबद्ध सभी जल्दी रिवर्स प्रतिलेखन सीडीएनए मध्यवर्ती की लंबाई सीमा के भीतर 23 करने के लिए ~ ६५० nt, जो शामिल है 180-182 nt-sss डीएनए । हालांकि, रणनीति के लिए उपयुक्त मामूली रूपांतरों न केवल देर प्रतिलेखन उत्पादों लेकिन यह भी अंय वायरस और प्रणालियों, जहां उद्देश्य 3 का पता लगाने के लिए है आवेदन की अनुमति देगा '-ओह युक्त डीएनए समाप्त होता है । विचार करने के लिए महत्वपूर्ण सीमाएं पुस्तकालय में अंतिम पीसीआर उत्पाद की लंबाई रेंज शामिल हैं; विशेष रूप से, टेंपलेट्स जिसमें खुले 3 ' पर अनुकूलक के बीच की दूरी-टर्मिनस और ऊपर प्राइमर साइट से अधिक ~ १००० nt की संभावना कम कुशलता से अनुक्रम होगा, संभावित पुस्तकालय की तैयारी के दौरान भ्रामक तकनीकी पूर्वाग्रह शुरू ( अधिक जानकारी और अनुकूलन सुझावों के लिए चर्चा देखें) ।

पहले 3 ' के व्यवस्थित दृढ़ संकल्प के लिए तकनीक की सूचना दी-न्यूक्लिक एसिड किस्में के टर्मिनी आरएनए पर ध्यान केंद्रित किया है, नहीं डीएनए, अणु । एक उदाहरण है 3 ' रेस (सीडीएनए समाप्त होता है की तेजी से प्रवर्धन)7, जो mRNA के polyadenylation पर निर्भर करता है । इसके अलावा, अनुकूलक बंधाव आधारित रणनीति आरएनए ligases को रोजगार विकसित किया गया है, जो RLM-दौड़ (आरएनए ligase-मध्यस्थता दौड़)8 या फीता (बंधाव आधारित प्रवर्धन के रूप में)9शामिल किया गया है. यह महत्वपूर्ण है कि बंधाव आधारित प्रवर्धन किसी भी बंधाव प्रतिक्रिया ही द्वारा शुरू पूर्वाग्रह के प्रति संवेदनशील हैं । उदाहरण के लिए, बंधाव 3 ' स्थिति, अनुक्रम, कुल अणु लंबाई, या स्थानीय संरचना में एक विशेष न्यूक्लियोटाइड के आधार पर अधिक या कम कुशल हो सकता है । इस तरह के ligase वरीयताओं को readout, जो हम और दूसरों में9,10मनाया है में अणुओं और मिथ्या छाप के अधूरा कब्जा करने के लिए सीसा । यहां वर्णित प्रोटोकॉल में एडेप्टर अतिरिक्त कदम के दौरान बंधाव पूर्वाग्रह को कम करने के लिए, हम बंधाव रणनीतियों की एक संख्या का परीक्षण किया और एक hairpin एकल असहाय डीएनए अनुकूलक के साथ टी-4 डीएनए ligase के उपयोग पाया (के रूप में Kwok एट अलद्वारा वर्णित है । 11) के पास मात्रात्मक बंधाव है कि बंधाव दक्षता में महत्वपूर्ण अंतर में परिणाम नहीं किया जब नियंत्रण oligonucleotides6के एक विशेष रूप से चयनित सेट के साथ मूल्यांकन के साथ ही प्रक्रिया हो । इस बंधाव रणनीति का विकल्प है, इसलिए, इस प्रोटोकॉल की सफलता में एक महत्वपूर्ण विशेषता है ।

तारीख करने के लिए, एचआईवी की निगरानी-1 आर टी संक्रमित कोशिकाओं में प्रगति मुख्य रूप से मात्रात्मक पीसीआर के साथ विभिंन लंबाई के रिवर्स प्रतिलेखन उत्पादों को मापने द्वारा पूरा किया गया है (qPCR) प्राइमर का उपयोग-जांच सेट है कि विशिष्ट उपाय कम या ज्यादा (जल्दी और देर से, क्रमशः) सीडीएनए उत्पाद12,13,14। हालांकि इस qPCR दृष्टिकोण सेलुलर सिस्टम में रिवर्स प्रतिलेखन प्रक्रिया के आंतरिक क्षमता निर्धारित करने के लिए उपयुक्त है, उत्पादन अपेक्षाकृत कम संकल्प का है, कोई अनुक्रम जानकारी के साथ व्युत्पंन किया जा रहा है । हमारे नए दृष्टिकोण, अनुकूलित एडेप्टर बंधाव, पीसीआर-मध्यस्थता पुस्तकालय पीढ़ी के आधार पर, और गहरी sequencing प्रौद्योगिकी गैप पते और एक को एचआईवी-1 संक्रमण मात्रा के दौरान रिवर्स प्रतिलेखन की निगरानी का अवसर प्रदान करता है और एकल न्यूक्लियोटाइड संकल्प.

हम एक अध्ययन में इस पद्धति की उपयोगिता सचित्र है कि एचआईवी की क्षमता के लिए दो प्रस्तावित मॉडलों के बीच प्रतिष्ठित-1 प्रतिबंध कारक APOBEC3G (apolipoprotein बी mRNA संपादन एंजाइम उत्प्रेरक पॉलीपेप्टाइड-3 जी की तरह) के साथ हस्तक्षेप करने के लिए वायरल रिवर्स टेप का उत्पादन6

Protocol

नोट: कृपया विशिष्ट रिएजेंट और इस प्रोटोकॉल में प्रयुक्त उपकरणों के लिए सामग्री की तालिका को देखें ।

1. वायरस उत्पादन और कोशिका संक्रमण

चेतावनी: संक्रामक एचआईवी-1 केवल अनुमोदित में सुरक्षा रोकथाम प्रयोगशालाओं में नियंत्रित किया जाना चाहिए ।

नोट: मानव भ्रूण गुर्दे (HEK) 293T कोशिकाओं के क्षणिक अभिकर्मक द्वारा एचआईवी-1 कणों का उत्पादन, चरण १.१ में उल्लिखित के रूप में, एक मानक प्रक्रिया है और पहले15,16बताया गया है । सामांय कक्ष culture कार्यविधियां पहले17बताई गई हैं ।

  1. एचआईवी-1 वायरस उत्पादन ।
    1. Dulbecco के संशोधित ईगल मध्यम (DMEM) में 293T कोशिकाओं को बनाए रखने के साथ 10% भ्रूण गोजातीय सीरम (FBS) और 1% पेनिसिलिन/streptomycin (पूर्ण DMEM) एक मानक सेल संस्कृति मशीन में ३७ ° c और 5% सह2 में पहले वर्णित के रूप में17.
    2. एक मानक लामिना प्रवाह ऊतक संस्कृति हूड में वृद्धि मीडिया को हटाने और पूर्व के 3 मिलीलीटर-गरम (३७ ° c) trypsin एक निकट-धाराप्रवाह 10 सेमी सेल संस्कृति डिश (~ १.२ x 107 कोशिकाओं) 293T कोशिकाओं के लिए जोड़ें । पकवान 2-3 मिनट के लिए मशीन में वापस रखो ।
    3. मशीन से वापस ऊतक संस्कृति हूड में पकवान ले लो और पूर्ण माध्यम के 7 मिलीलीटर जोड़ें । पिपेट ऊपर और नीचे पकवान के भीतर कई बार कोशिकाओं resuspend करने के लिए । सेल सस्पेंशन की एक नई 10 सेमी डिश के लिए २.५ मिलीलीटर जोड़कर 1:4 कोशिकाओं भाजित और यह पूर्ण माध्यम के ७.५ मिलीलीटर के साथ भरें ।
    4. अगले दिन, मिश्रण 10 के µ जी के वायरल एचआईवी-1 प्लाज्मिड डीएनए (जैसे pnl 4.3) के साथ 1 मिलीलीटर सीरम मुक्त न्यूनतम आवश्यक माध्यम और जोड़ें polyethylenimine (पी) समाधान (२५,००० मेगावाट, 1 मिलीग्राम/एमएल पीएच 7) पर ४.५ µ l प्रति 1 µ g डीएनए. आरटी पर 10 मिनट के लिए मशीन और 293T कोशिकाओं को dropwise जोड़ें ।
    5. 24 ज अभिकर्मक के बाद मीडियम को हटा दें और इसे 20 यू/एमएल मीडियम पर RNase-फ्री DNase युक्त फुल DMEM के 6 एमएल के साथ बदलें । 6 घंटे के बाद, पूर्ण DMEM के 10 मिलीलीटर के साथ मध्यम बदलें ।
    6. अभिकर्मक के बाद ४८ ज, फसल supernatant और एक ०.२२ µm फिल्टर के माध्यम से यह फिल्टर, एक 10 मिलीलीटर सिरिंज का उपयोग कर, एक 15 एमएल के ट्यूब में ।
    7. एक खुले टॉप पतली घिरी ultracentrifuge ट्यूब करने के लिए 1x फॉस्फेट बफर खारा (पंजाब) में बाँझ 20% सुक्रोज के 2 मिलीलीटर जोड़ें । धीरे से फ़िल्टर किए गए सेल supernatant के साथ सुक्रोज ओवरले ।
    8. 4 डिग्री सेल्सियस पर १३४,००० x g पर 1 घंटे 15 मिनट के लिए केंद्रापसारक एक ultracentrifuge का उपयोग कर ।
    9. ultracentrifuge से ट्यूबों को ध्यान से निकालें । धीरे से एक चूषण या एक पिपेट का उपयोग कर दोनों supernatant और सुक्रोज दूर ले । एक छोटे पिपेट का प्रयोग करें और जब पिछले सुक्रोज समाधान बाहर ले ट्यूब झुकाव । ट्यूब के नीचे में छर्रों वायरस छोड़ दें ।
      नोट: गोली दिखाई नहीं होगी ।
    10. 1x पंजाब के २०० µ एल जोड़ें, 4 से 12 घंटे के लिए फ्रिज में छोड़ दो, resuspend, और 20 µ एल aliquots में-८० डिग्री सेल्सियस में फ्रीज ।
    11. निर्धारित p24ढकोसला सामग्री का उपयोग कर एक p24 एचआईवी-1 प्रतिजन एलिसा किट (निंनलिखित निर्माता के निर्देश) ।
  2. टी सेल लाइन संक्रमण ।
    1. संस्कृति एक अमर टी सेल लाइन (जैसे, CEM-एसएस सेल) रोसवेल पार्क मेमोरियल इंस्टीट्यूट (RPMI) में १६४० मध्यम 10% FBS और 1% पेनिसिलिन/streptomycin (पूर्ण RPMI) के साथ पूरक । एक 12-अच्छी तरह से प्रारूप सेल संस्कृति प्लेट में एक hemocytometer18 और बीज 1 अच्छी तरह से 2 x 106 कोशिकाओं/एमएल के साथ पूर्ण RPMI के 1 मिलीलीटर के साथ नमूना प्रति का उपयोग कर कोशिकाओं गिनती ।
    2. जोड़ें एचआईवी-1 १५० के बराबर कणों एनजी p24झूठ और एक benchtop में 30 डिग्री सेल्सियस पर २,००० x g पर 2 घंटे के लिए केंद्रापसारक में केंद्रापसारक द्वारा-संक्रमण के साथ एक झूलते केंद्रापसारक बाल्टी में थाली जगह स्पिन करने के लिए ।
    3. केंद्रापसारक से प्लेट निकालें और यह एक मानक ऊतक संस्कृति मशीन में ३७ डिग्री सेल्सियस और 5% CO2में 1 ज के लिए आराम करो ।
    4. इनपुट वायरस से धोने के लिए, सेल सस्पेंशन को microcentrifuge ट्यूबों में स्थानांतरित करके और ५०० x g पर rt (rt) में एक microcentrifuge में 2 मिनट के लिए, कोशिकाओं को इकट्ठा करें । बंद सेल गोली परेशान बिना supernatant ले लो ।
    5. पूर्व गर्म (३७ डिग्री सेल्सियस), बाँझ 1x पंजाबियों के 1 मिलीलीटर में सेल छर्रों resuspend । , supernatant हटाने के लिए, और दो बार चरणों resuspension को दोहराएँ ।
    6. फिर से, supernatant को हटाने और पूर्ण RPMI के 1 मिलीलीटर में सेल छर्रों resuspend । एक नए 12 अच्छी तरह से थाली में एक अच्छी तरह से प्रत्येक निलंबन जोड़ें ।
    7. 6 एच के बाद में वायरस के प्रारंभिक इसके अलावा (4 एच पद-केंद्रापसारक), फसल के रूप में कदम 1.2.4 में किया केंद्रापसारक द्वारा कोशिकाओं । supernatant को निकालें और छोड़ें । सेल छर्रों-८० डिग्री सेल्सियस पर जमे हुए या डीएनए निष्कर्षण के लिए सीधे कार्रवाई कर सकते हैं ।

2. डीएनए निष्कर्षण, एचआईवी-1 डीएनए ठहराव, और संकर कब्जा द्वारा संवर्धन

  1. ऊतक संस्कृति कोशिकाओं के लिए किट मैनुअल का पालन करके एक रक्त और ऊतक कुल डीएनए निष्कर्षण किट के साथ पूरे सेल डीएनए निकालें । केवल चेंज्ड रेफरेंस बफर के बजाय nuclease-फ्री एच2ओ के २०० µ एल में रेफरेंस है ।
    नोट: chaotropic lysis बफर के अलावा (किट ' अल बफर ") और proteinase के बाद, नमूनों को सुरक्षा रोकथाम प्रयोगशाला से हटाया जा सकता है और प्रोटोकॉल के बाकी के लिए एक मानक सुरक्षा स्तर प्रयोगशाला में संभाला ।
  2. qPCR द्वारा एचआईवी-1 सीडीएनए की प्रतिलिपि संख्या निर्धारित करें ।
    1. २.१ कदम से eluate के 17 µ एल लो और DpnI प्रतिबंध एंजाइम के 1 µ एल के साथ एक साथ 10x प्रतिबंध एंजाइम बफर के 2 µ एल जोड़ें । ३७ डिग्री सेल्सियस पर 1 घंटे के लिए मशीन अभिकर्मक से किसी भी संभावित अवशिष्ट इनपुट प्लाज्मिड डीएनए को दूर करने के लिए ।
    2. ऋण के लिए बाहर ले qPCR-किनारा मजबूत रोक सीडीएनए निंनलिखित प्राइमर जांच सेट का उपयोग: oHC64 (5 '-taactagggaacccactgc-3 ′) और oHC65 (5 '-gctagagattttccacactg-3 ′) और जांच oHC66 (5 '-FAM-acacaacagacgggcacacacta-तमृ-3 ′) । qPCR सेटअप और सटीक शर्तों के संदर्भ6,13में पाया जा सकता है । सीडीएनए अणुओं की प्रतिलिपि संख्या निर्धारित करने के लिए एक मानक वक्र के रूप में pnl 4.3 वायरल प्लाज्मिड के एक धारावाहिक कमजोर पड़ने के साथ नमूनों के साथ कैर्री ।
      नोट: अपेक्षित मात्रा के लिए चर्चा देखें ।
  3. एचआईवी-1 डीएनए संवर्धन संकर कब्जा द्वारा ।
    नोट: इस कदम से आगे, यह कम न्यूक्लिक एसिड बाध्यकारी गुणों के साथ ही एयरोसोल फ़िल्टर सभी डीएनए नमूनों के लिए पिपेट सुझावों के साथ microcentrifuge ट्यूबों का उपयोग करने के लिए बेहतर है । यदि संभव हो, एक पीसीआर कार्य केंद्र में काम करते हैं । सभी कदम और रिएजेंट rt (rt) पर है जब तक अंयथा नहीं कहा गया है ।
    1. चुंबकीय streptavidin मोतियों की एक मास्टर मिश्रण तैयार करने के लिए, एक एकल microcentrifuge ट्यूब में नमूना प्रति पिपेट १०० µ एल मोती. microcentrifuge ट्यूबों के लिए उपयुक्त एक चुंबक पर ट्यूब प्लेस ।
    2. के बाद मोती ट्यूब (~ 1 मिनट) के चुंबक पक्ष की ओर बस गया है, बंद भंडारण बफर ले, चुंबक से ट्यूब हटाने और बांध और धो बफर के ५०० µ एल में मोतियों resuspend (BW बफर, 5 मिमी Tris-एचसीएल पीएच ७.५, ०.५ मिमी EDTA , 1 M NaCl) धोने के लिए ।
    3. चुंबक पर ट्यूब वापस प्लेस, supernatant निकालें और जोड़ें ५०० µ l कैसिइन समाधान । चुंबक के लो, resuspend और आरटी पर 10 मिनट के लिए गर्मी, तो BW बफर के साथ धोने ।
      नोट: एक धोने चुंबक पर ट्यूब रखने के लिए संदर्भित करता है, बंद supernatant लेने, चुंबक से ट्यूब ले, बफर जोड़ने, और resuspend ।
    4. जगह ट्यूब वापस चुंबक पर, BW बफर के ५०० µ एल में supernatant और resuspend मोतियों से ले लो । प्रत्येक कैप्चरिंग biotinylated oligonucleotides के ५० pmol जोड़ें (देखें तालिका 1, तीन ओलिगोस्पर्मिया इस मामले में) प्रति नमूना । (उदाहरण के लिए, यदि 5 डीएनए नमूने संसाधित किए जाने हैं, तो चरण 2.3.1 और प्रत्येक oligonucleotide के २५० pmol से चुंबकीय मोतियों का ५०० µ l का उपयोग करें).
    5. आरटी में 30 मिनट के लिए मशीन, जबकि एक अंत से अधिक अंत मिक्सर में कमाल ।
    6. ५०० µ एल 1x दस बफर (10 मिमी Tris एचसीएल पीएच ८.०, 1 मिमी EDTA, १०० मिमी NaCl) के साथ दो बार मैटीरियल oligonucleotides के साथ मोतियों को धोएं ।
    7. नमूना प्रति 1x दस बफर के 10 µ एल में मोती resuspend ।
    8. प्रत्येक नमूना लेबल एक microcentrifuge ट्यूब के लिए और 10 µ एल के मोती निलंबन, डीएनए के १७० µ एल जोड़ने (२.१ कदम से) और ९० 3x दस बफर के µ एल । डीएनए स्वभाव के लिए 2 मिनट के लिए ९२ ° c पर एक सूखी गर्मी ब्लॉक में मशीन ।
    9. एक अलग सूखी गर्मी ब्लॉक, जो ५२ डिग्री सेल्सियस के लिए सेट है ट्यूबों ले जाएं, और 1 घंटे के लिए नियमित रूप से मिश्रण करने के लिए (~ हर 10 मिनट) इस मशीन के दौरान मशीन पलटना ।
    10. 1x दस बफर के ५०० µ l के साथ एक बार धोएं और ३५ µ l nuclease-free H2ओ में पुनर्निलंबित करें ।
    11. elute करने के लिए, एक सूखी गर्मी ब्लॉक में ९२ ° c पर ट्यूबों 2 मिनट के लिए मशीन । तो, जल्दी चुंबक पर ट्यूबों (एक समय में एक ट्यूब) चाल । एक बार मोती ट्यूब के पक्ष के लिए बाध्य कर रहे हैं, एक ताजा ट्यूब के लिए एचआईवी युक्त supernatant-1 डीएनए में स्थानांतरण ।
    12. वैकल्पिक: दोहराएँ qPCR (के रूप में चरण -8 में किया) बरामद एचआईवी-1 सीडीएनए निर्धारित करने के लिए.
      नोट: अपेक्षित मात्रा के लिए चर्चा देखें ।

3. अनुकूलक बंधाव

  1. ढलने की तैयारी
    1. lyophilized एडेप्टर resuspend ( तालिका 1 देखें "पूर्ण Kwok + MiSeq") पर १०० µ मी मे nuclease-फ्री एचओ.
    2. प्रति नमूना प्लस एक नियंत्रण नमूना, 10x टी-4 डीएनए ligase बफर के ०.४५ µ एल का मिश्रण, अनुकूलक के ४ µ एल, और ०.०५ µ एल के nuclease-मुक्त एच2O. गर्मी के लिए ९२ ° c 2 मिनट के लिए और प्रत्येक शांत नीचे धीरे चलो ।
      नोट: यदि विकल्प उपलब्ध है समायोज्य शीतलन दर (2% की दर का उपयोग करें) के साथ एक पीसीआर मशीन का उपयोग करें । इस ९२ डिग्री सेल्सियस से 16 डिग्री सेल्सियस के बारे में 30 मिनट लगते हैं । वैकल्पिक रूप से, ९२ डिग्री सेल्सियस पर एक सूखी गर्मी ब्लॉक का उपयोग करें और बंद हो जाते हैं । जब हीट ब्लॉक आरटी पर वापस आ गया है एडेप्टर mastermix बाहर ले लो । यह बताने के लिए है अनुकूलक एक hairpin संरचना फार्म ( चित्रा 2बीदेखें) ।
  2. संश्लेषित oligonucleotides का एक सेट के साथ एक नियंत्रण प्रतिक्रिया तैयार ( तालिका 2देखें) के बजाय डीएनए कोशिकाओं से निकाले गए.
    1. प्रत्येक oligonucleotide के १०० µ मीटर के स्टॉक्स बनाएं । 17 oligonucelotides में से प्रत्येक के 1 µ l को मिलाएं और 25 µ l के अंतिम आयतन में एक equimolar अनुपात के लिए H2O के 8 µ l को जोड़ें ।
    2. मिश्रण 1 पतला: 2500 में nuclease-फ्री एच2ओ एक धारावाहिक कमजोर पड़ने में । मिश्रण के 1 µ l के साथ १७.३ µ l के nuclease-नि H2O चरण में नियंत्रण नमूना बंधाव में उपयोग करने के लिए 3.3.1 ताकि प्रत्येक oligonucleotide १.६ fmol पर मौजूद है (०.०२६ एनएम के बराबर ६० µ l reaction में).
  3. ligations की स्थापना
    1. पीसीआर ट्यूबों में ६० µ एल अंतिम मात्रा प्रतिक्रियाओं के लिए 10x टी-4 डीएनए ligase बफर के 6 µ एल गठबंधन, 24 µ l के ४०% खूंटी, 6 µ l के 5 M betaine, ४.५ µ l (४०० pmol) के अनुकूलक (प्री-annelead चरण 3.1.2 के रूप में), टी-4 डीएनए µ के १.२ ligase l (२,०००,००० इकाइयों/एमएल) और डीएनए के १८.३ µ l (से चरण 2.3.11)
      नोट: सटीक मात्रा बनाए रखने के लिए ४०% खूंटी जैसे चिपचिपा समाधान के साथ विशेष ध्यान रखना । एक mastermix मत बनाओ ।
    2. 3.3.1 चरण में प्रदर्शन के रूप में एक ही प्रतिक्रिया सेट करें, लेकिन चरण 3.2.2 में तैयार नियंत्रण oligonucleotide मिश्रण के साथ ।
    3. प्रतिक्रियाओं को अच्छी तरह से मिलाएं और 16 डिग्री सेल्सियस रात में एक पीसीआर मशीन में गर्मी ।

4. अनुकूलक हटाने और आकार जुदाई

  1. Denaturing जेल ट्रो
    1. प्रत्येक बंधाव प्रतिक्रिया करने के लिए formamide-युक्त डीएनए जेल लोडिंग बफर के 30 µ एल जोड़ें । pipetting द्वारा अच्छी तरह मिलाएं ।
    2. पीसीआर मशीन में ९४ डिग्री सेल्सियस पर 2 मिनट के लिए गर्मी, तो तुरंत बर्फ पर डाल दिया ।
    3. एक उपयुक्त जेल टैंक में एक कच्चा 6% Tris/बोराटे/EDTA (TBE) denaturing यूरिया polyacrylamide जेल (10-well कंघी) रखें । 1x TBE जोड़ें (८९ mm Tris-आधार, ८९ mm बोरिक एसिड, 2 mm EDTA) चल बफर और पूर्व जेल चलाने के लिए 20 मिनट में २५० V/अधिकतम लगातार ।
    4. एक सिरिंज और 21G सुई का उपयोग बफर चलाने के साथ जेल जेब बाहर धोने ।
    5. तीन कुओं (अच्छी तरह से प्रति 30 µ एल) में प्रत्येक ९० µ एल नमूना लोड और 20 मिनट के लिए रन (२५० V/अधिकतम) जब तक डार्क ब्लू डाई सामने के बारे में आधे रास्ते जेल के माध्यम से है ।
  2. दाग और जेल से न्यूक्लिक एसिड काटने
    1. एक 21 जी सिरिंज सुई का उपयोग नीचे में poking छेद द्वारा नमूना प्रति 3 छोटे microcentrifuge ट्यूबों (०.५ एमएल) तैयार (sharps के साथ काम करते हुए सावधानी रखना). एक २.० मिलीलीटर microcentrifuge ट्यूब में तैयार ट्यूबों के प्रत्येक डालें और उंहें नमूना नाम से अधिक "कम", "मध्य" या "उच्च" के साथ लेबल ।
    2. बाहर ले जाओ और जेल कैसेट खुला खोदकर । जेल खड़ी एक उस्तरा ब्लेड के साथ उदारता से लोड नमूनों के 3 कुओं के साथ पट्टी उत्पाद कटौती । एक कंटेनर के लिए जेल पट्टी 1x TBE के साथ जोड़ें (के बारे में 30 एमएल) और 5 cyanine न्यूक्लिक एसिड दाग के µ एल । 3-5 मिनट के लिए मशीन ।
      नोट: जेल निष्कर्षण कदम विशेष रूप से पार करने के लिए संवेदनशील है-संदूषण । यह केवल जेल प्रति 1 नमूना चलाने के लिए और प्रत्येक जेल धुंधला के लिए एक अलग, साफ कंटेनर का उपयोग करने के लिए सलाह दी जाती है । दस्ताने परिवर्तित किया जाना चाहिए यदि जेल कणों से संपर्क दस्ताने उंगलियों ।
    3. ddH2ओ के साथ एक नीली बत्ती transilluminator की सतह को अच्छी तरह साफ कर लें । जेल टुकड़ा बाहर दाग कंटेनर के ले लो और प्रकाश बॉक्स में जोड़ें ।
    4. लाइट बॉक्स चालू करें और ऑरेंज फिल्टर के माध्यम से सना हुआ न्यूक्लिक एसिड का निरीक्षण ।
      नोट: एडेप्टर आम तौर पर अतिभारित दिखाई देता है और एक लकीर के रूप में ऊपर चल ligated एचआईवी-1 डीएनए के साथ बड़ी "बूँद" के रूप में चलाता है ।
    5. एक नया उस्तरा ब्लेड का प्रयोग, दूर जेल के पक्ष में कटौती अगर कोई नमूना अभी भी मौजूद लोड के साथ क्षेत्रों रहे हैं । इसके बाद, अनुकूलक और लोअर जेल भागों को दूर करने के लिए बस एडेप्टर के ऊपर कट । अंत में, दूर जेल जेब, जो अक्सर उच्च आणविक वजन डीएनए के एक तेज तीव्र संकेत है के बारे में 1 मिमी सहित जेल के बहुत ऊपर काट दिया ।
    6. शेष जेल नमूना है, जो आम तौर पर है ~ 2 x 3 सेमी आकार में, क्षैतिज तीन भी टुकड़ों में: "कम", "मध्य" और "उच्च" आणविक वजन क्षेत्रों युक्त टुकड़ा विभाजित ।
      नोट: प्रत्येक टुकड़ा अब अलग से नियंत्रित किया जाएगा [यानी, वहां तीन ट्यूबों (कम, मध्य, और उच्च)] मूल नमूना प्रति होगा ।
    7. छोटे टुकड़ों (~ 2 x 2 मिमी कणों) में तीन जेल टुकड़े में से प्रत्येक में कटौती और prepped ०.५ मिलीलीटर microcentrifuge ट्यूबों (चरण 4.2.1) में उन्हें हस्तांतरण ।
    8. एक जेल कीचड़ बनाने के लिए 2 मिलीलीटर ट्यूब में छेद के माध्यम से जेल टुकड़े निचोड़ करने के लिए 1 मिनट के लिए खुले ढक्कन के साथ शीर्ष गति से स्पिन । किसी भी जेल कणों ०.५ मिलीलीटर ट्यूब के तल में रहते हैं, तो उन्हें 2 मिलीलीटर ट्यूब मैन्युअल रूप से एक सुई या पिपेट टिप का उपयोग करने के लिए स्थानांतरण ।
  3. डीएनए निष्कर्षण
    1. यूरिया जेल निष्कर्षण बफर के 1 मिलीलीटर जोड़ें (०.५ एम एनएच4CH3CO2, 1 mM EDTA, ०.२% एसडीएस) जेल कीचड़ के लिए । 3 घंटे की एक ंयूनतम के लिए ट्यूब घुमाएँ (रात भर स्वीकार्य है) एक अंत से अधिक अंत मिक्सर के साथ आरटी पर ।
    2. एक छोटा सा गोल ग्लास फाइबर फिल्टर फाइबर एसीटेट झिल्ली फिल्टर (०.२ µm) है, जो झिल्ली कॉलेस्ट्रॉल से बचा जाता है के साथ कॉलम बनाने के लिए जोड़ने के लिए चिमटी के एक साफ सेट का उपयोग करें । जगह में एक औंधा पिपेट टिप के साथ फिल्टर रखो ।
    3. संक्षेप में जेल कीचड़ और निष्कर्षण बफर के साथ एक microcentrifuge में 2 मिलीलीटर ट्यूबों स्पिन और ७०० µ एल तैयार फ़िल्टर कॉलम को supernatant के स्थानांतरण । जेल कीचड़ और शेष supernatant रखें ।
    4. 1 मिनट के लिए शीर्ष गति पर एक microcentrifuge में फ़िल्टर स्तंभों केंद्रापसारक. flowthrough एक नया २.० मिलीलीटर microcentrifuge ट्यूब में स्थानांतरण ।
    5. शेष supernatant के साथ स्तंभों को पुनः लोड करें । निष्कर्षण कीचड़ से जितना संभव हो उतना तरल प्राप्त करने की कोशिश करो । जेल के टुकड़ों का स्थानांतरण चिंता का विषय नहीं है । फिर से स्पिन और एक ही निष्कर्षण नमूनों की flowthroughs गठबंधन ।
  4. डीएनए वर्षण
    1. polyA आरएनए के 3 µ l को जोड़ें (1 µ g/µ l; एक वाहक के रूप में), µ के 1 ग्लाइकोजन l, और isopropanol की ०.७ मिलीलीटर flowthrough से कदम 4.3.5. भंवर संक्षेप में और रुक-८० ° c रातोंरात ।
    2. -८० डिग्री सेल्सियस फ्रीजर से बाहर नमूने ले लो और उन्हें संक्षेप में गल जाने । उन्हें एक ठंडा (4 डिग्री सेल्सियस) microcentrifuge में रखो और शीर्ष गति से 30 मिनट के लिए स्पिन ।
    3. supernatant को निकालें और छोड़ें । बहुत सावधानी से गोली नहीं हटा । छोड़ दो तरल के ५० µ एल के लिए अगर यह अनिश्चित है कि गोली अंयथा हटा दिया जाएगा ।
      नोट: आम तौर पर सभी "उच्च" नमूने "मध्य" और "कम" नमूनों की तुलना में एक अधिक दिखाई गोली दिखा.
    4. जोड़ें ८०% इथेनॉल के ८०० µ एल । ट्यूब पलटना और शीर्ष गति से 1 मिनट के लिए फिर से स्पिन । एक पिपेट के साथ इथेनॉल के बहुमत निकालें, संक्षेप में ट्यूबों फिर से स्पिन, और एक छोटी मात्रा पिपेट के साथ और अधिक इथेनॉल को हटा दें ।
    5. एक ५५ ° c सूखी गर्मी ब्लॉक में एक खुले ढक्कन के साथ ट्यूबों रखकर किसी भी शेष इथेनॉल लुप्त होने दो । जब नमूने शुष्क (2-4 मिनट) nuclease के 20 µ एल-मुफ्त एच2ओ जोड़ें और ट्यूब के नीचे चारों ओर फैल सुनिश्चित करने के लिए डीएनए गोली भंग है । डीएनए नमूना-20 डिग्री सेल्सियस पर संग्रहित किया जा सकता है ।

5. पीसीआर प्रवर्धन और पुस्तकालय की तैयारी

  1. डीएनए पोलीमरेज़ प्री-मिक्स के 20 µ l के साथ एक ४० µ l पीसीआर रिएक्शन सेट करें, 18 µ के एल और कदम से redissolved डीएनए 4.4.5, 1 µ एल के फॉरवर्ड प्राइमर "mp 1.0 + 22HIV" (10 µ मीटर) (देखें तालिका 1), और 1 µ एल के मल्टीप्लेक्स oligo प्राइमरों (सूचकांक प्राइमरों 1 से 24) (देखने की तालिका Ma terials) ।
    नोट: तीन प्रतिक्रियाओं (कम, मध्य, उच्च) अलग पीसीआर प्रतिक्रियाओं में प्रत्येक नमूने के चलाने के लिए, लेकिन एक ही अनुक्रमित प्राइमर के साथ । मूल संक्रमण नमूनों में से प्रत्येक के लिए एक अलग सूचकांक का उपयोग करें ।
    1. निंनलिखित शर्तों के तहत पीसीआर प्रतिक्रियाओं चलाएं: ९४ ° c विकार पर 2 मिनट, 3-चरण पीसीआर के 18 चक्र; 15 एस ९४ डिग्री सेल्सियस पर विकार, 15 एस ५५ डिग्री सेल्सियस पर एनीलिंग, और ६८ डिग्री सेल्सियस पर 30 एस एक्सटेंशन ।
  2. एक गुणवत्ता नियंत्रण विकल्प के रूप में, उच्च संवेदनशीलता स्वचालित जेल ट्रो प्रणाली के साथ पीसीआर प्रतिक्रियाओं का विश्लेषण । निर्माता के निर्देश के अनुसार चलाने के लिए एक कम, मध्य और उच्च नमूना के 2 µ एल ले लो ।
    नोट: दो प्राइमरों दिखाई और अक्सर के बारे में ४५ और ९५ nt की एक गणना की लंबाई में चलाने चाहिए (वास्तविक लंबाई अलग है) । साथ ही, १५० से ५०० nt के बीच डीएनए का पता लगाया जाना चाहिए । यदि कोई संकेत मौजूद नहीं है, यह सलाह दी जाती है अतिरिक्त पीसीआर चक्र जोड़ने के लिए, 2 और 10 अतिरिक्त चक्र के बीच । चरण 3.3.2 में बनाए गए oligonucleotide नियंत्रण नमूने के लिए अतिरिक्त चक्र नहीं जोड़ें ।
  3. प्राइमरों को हटाने के लिए एक paramagnetic मनका आधारित पीसीआर सफाई प्रणाली का उपयोग करें ।
    1. प्रत्येक पीसीआर प्रतिक्रिया के 20 µ एल लो और नमूने एक साथ पूल (इस बिंदु पर सभी नमूनों मिश्रण). -20 डिग्री सेल्सियस पर बैकअप के रूप में शेष 20 µ एल प्रतिक्रियाओं फ्रीज ।
    2. paramagnetic मोती RT करने के लिए आते हैं और 1.8 एक्स मनका समाधान की मात्रा के साथ परित पीसीआर प्रतिक्रियाओं मिश्रण. 5 मिनट के लिए pipetting और गर्मी से मिश्रण ।
      नोट: एक उदाहरण के रूप में, यदि 4 नमूने तैयार किए गए थे और प्रत्येक कम, मध्य, और उच्च प्रतिक्रियाओं, मात्रा 4 x 3 x 20 µ l = २४० µ l पीसीआर प्रतिक्रियाओं ४३२ µ l मनका समाधान के साथ किया जाएगा ।
    3. एक microcentrifuge ट्यूब चुंबक पर ट्यूबों रखो, मोती ~ 1 मिनट के लिए बांध, और बंद supernatant लेने के लिए छोड़ दें । चुंबक पर ट्यूबों छोड़ दो और ८०% इथेनॉल के ५०० µ एल जोड़ें ।
    4. 30 एस के लिए इथेनॉल छोड़ दो, तो बंद अच्छी तरह से ले और ~ 5 मिनट के लिए मोती airdry । जोड़ें ४० µ एल के nuclease-मुक्त एच2ओ, चुंबक से ट्यूबों ले लो, और ऊपर और नीचे कई बार पिपेट ।
    5. 5 मिनट के लिए निलंबन छोड़ दें । चुंबक पर वापस ट्यूब रखो, मोती पक्ष को व्यवस्थित, और एक नई ट्यूब के लिए supernatant हस्तांतरण । यह पुस्तकालय है । गुणवत्ता नियंत्रण के लिए एक 10 µ एल aliquot ले लो और बाकी पर फ्रीज-20 ° c.

6. पुस्तकालय का मूल्यांकन

  1. पुस्तकालय की गुणवत्ता, एकाग्रता, और molarity निर्धारित करते हैं ।
    1. एक fluorometric ठहराव विधि का प्रयोग करें । एक उच्च संवेदनशीलता dsDNA परख किट के साथ पुस्तकालय के निर्माता के निर्देशों के अनुसार 1 µ l और 3 µ l को मापने ।
      नोट: ठेठ सांद्रता 1 और 10 के बीच कर रहे है एनजी/µ एल
    2. ऊपर वर्णित के रूप में उच्च संवेदनशीलता स्वचालित जेल ट्रो द्वारा पुस्तकालय डीएनए आणविक भार स्पेक्ट्रम उपाय (५.२ कदम) ।
    3. पुस्तकालय के औसत आणविक भार का निर्धारण करने के लिए स्वचालित जेल ट्रो विश्लेषण का उपयोग करें और nuclease-फ्री एच2ओ में पुस्तकालय को पतला करने के लिए गणना 4 एनएम । कई पुस्तकालयों के रूप में सभी सूचकांक अद्वितीय है लंबे समय के रूप में जोड़ा जा सकता है ।
  2. वैकल्पिक कम प्रवाह गुणवत्ता नियंत्रण
    1. विषय डीएनए पुस्तकालय टा क्लोनिंग के लिए19 प्रवर्धन के लिए वैक्टर में पुस्तकालय अणुओं डालने के लिए । किट के निर्देशों का पालन करें, बाहर हो जाना ~ 10-20 कालोनियों और निकालने डीएनए miniprep प्रोटोकॉल के माध्यम से, के रूप में यहां वर्णित20
    2. अनुक्रम स्थानीय sequencing सेवाओं का उपयोग कर वेक्टर और जांच करें कि आवेषण वांछित एचआईवी-1 व्युत्पंन दृश्यों और पुस्तकालय विशिष्ट एडेप्टर होते हैं ।

7. उच्च-प्रवाह अनुक्रमण चलाने

  1. sequencing प्लेटफ़ॉर्म के साथ प्रदान किए गए व्यावसायिक सॉफ़्टवेयर के साथ एक sequencing नमूना पत्रक बनाएँ ।
    1. चयनित sequencing किट को इंगित करते हैं । आमतौर पर, एक १५०-साइकिल किट का चयन करें, लेकिन दूसरों को वांछित पढ़ें लंबाई के आधार पर उपयुक्त हैं ।
    2. अनुप्रयोग वर्कफ़्लो के रूप में "केवल Fastq" का चयन करें । उस टेंपलेट्स में से एक चुनें जिसमें मल्टीप्लेक्स oligonucleotide किट में मौजूद 24 सूचकांक शामिल हों (किट मैनुअल में दर्शाई गई) ।
    3. Read1 के लिए "25 nt" का चयन करें और Read2 के लिए "१२५ nt" । एकल अनुक्रमणिका पढ़ने के लिए 6 nt रखें ।
      नोट: में घर विश्लेषण में केवल Read2 विश्लेषण में प्रयोग किया जाता है । sequencing प्लेटफ़ॉर्म एल्गोरिथ्म उद्देश्यों के लिए कम से कम 25 nt पर Read1 रखें ।
  2. पूर्व-रन लाइब्रेरी तैयारी और सेटअप के लिए ठीक निर्माता के निर्देशों का पालन करें । अधिकतम 20 pM एकाग्रता के लिए ऑप्ट और एक 15% PhiX स्पाइक का उपयोग करें, के रूप में पुस्तकालय बहुत कम जटिलता का है ।

8. डेटा विश्लेषण

  1. पास फ़िल्टर प्रतिशत और औसत Q30 गुणवत्ता स्कोर sequencing प्लेटफ़ॉर्म निर्माता के दिशानिर्देशों के अनुसार स्वीकार्य हैं, तो जाँचें ।
    नोट: पास फ़िल्टर सामांयतया > ९०% है और Q30 स्कोर सामांयतया > ८०% है ।
  2. निर्माता के sequencing हब से. fastq. gz फ़ाइलें डाउनलोड करें ।
  3. sequencing स्क्रिप्ट सेट कर रहा है
    1. "AnalysisXYZ" नामक एक नई निर्देशिका (फ़ोल्डर) बनाएं और इस निर्देशिका में सभी स्रोत कोड फ़ाइलें (parse_sam. pl, rc_extract. pl, parse.sh) डाउनलोड करने के लिए https://github.com/malimlab/seqparse पर जाएं ।
    2. http://bowtie-bio.sourceforge.net/index.shtml से एक ही निर्देशिका में कम पढ़ें संरेखण Bowtie, संस्करण 1.1.2, डाउनलोड करें ।
    3. डाउनलोड "AnalysisXYZ" नाम "Bowtie-1.1.2" के भीतर एक उपनिर्देशिका बनाता है । इस निर्देशिका ओपन उपनिर्देशिका के भीतर "अनुक्रमित" और. ebwt एक्सटेंशन के साथ 6 फ़ाइलों से मिलकर प्रदान की टेम्पलेट अनुक्रम डाउनलोड.
    4. डाउनलोड FASTQ/एक छोटा पढ़ता पूर्व-संसाधन टूलकिट fastx-0.0.13 से http://hannonlab.cshl.edu/fastx_toolkit/download.html "AnalysisXYZ" निर्देशिका में ।
    5. दोनों Samtools (https://sourceforge.net/projects/samtools/files/) और bam-readcount (https://github.com/genome/bam-readcount) "दस्तावेज़" निर्देशिका में डाउनलोड करें ।
  4. कदम. fastq. gz फ़ाइलें, ८.२ चरण में डाउनलोड, सभी पढ़ें 2s के (... _R2_001. fastq. gz में समाप्त) "AnalysisXYZ" निर्देशिका में ।
  5. कमांड कंसोल/टर्मिनल खोलें । cd आदेश का उपयोग करते हुए वर्तमान निर्देशिका के रूप में "AnalysisXYZ" पर जाएं । प्रकार "./parse.sh." स्क्रिप्ट को चलाने के लिए ।
  6. कुल पढ़ें गिनती पर सभी नमूनों के लिए सारांश के साथ. csv फ़ाइलें ढूँढें, लंबाई पढ़ा गिनती समायोजित, और के रूप में अच्छी तरह से आधार भिन्नता के साथ फ़ाइलें, "विश्लेषण XYZ" निर्देशिका में parse_results नामक एक निर्देशिका में प्रत्येक नमूने के लिए सामान्य पढ़ें.
    नोट: विश्लेषण प्रक्रिया के बारे में अधिक जानकारी के लिए चर्चा देखें । स्क्रिप्ट के साथ csv फ़ाइलें देता है कुल के साथ प्रत्येक न्यूक्लियोटाइड के लिए पढ़ता है एचआईवी-1nl 4.3 मजबूत बंद करो दृश्यों और पहले किनारा हस्तांतरण न्यूक्लियोटाइड ६३५ तक । एक मार्गदर्शन के रूप में, ५०,००० करने के लिए १००,००० अद्वितीय पढ़ता आम तौर पर संकेत दिया कोशिका संख्या और वायरल inocula के साथ और एंटीवायरल प्रोटीन या यौगिकों के बिना संक्रमण से नमूनों में मनाया जाता है. oligonucleotide नियंत्रण नमूना आमतौर पर १००,००० करने के लिए २००,००० पढ़ता पैदा करता है ।

Representative Results

तकनीक इस लेख में वर्णित एक व्यापक अध्ययन के लिए लागू करने के लिए एचआईवी के अंतर्निहित निषेध तंत्र पता-1 एंटीरेट्रोवाइरल मानव प्रोटीन APOBEC3G (A3G) द्वारा उल्टा प्रतिलेखन था6चित्रा 3 प्रतिनिधि CEM से नमूनों में प्रोटोकॉल को रोजगार के बाद प्राप्त परिणामों से पता चलता है-एस टी कोशिकाओं vifकी कमी से संक्रमित--एचआईवी-1 अनुपस्थिति या A3G की उपस्थिति में । एक ही 6 nt बारकोड और एक ही लंबाई है जो किसी भी पीसीआर डुप्लिकेट को छानने के बाद प्रत्येक नमूने से प्राप्त अद्वितीय पढ़ता की कुल संख्या (प्रदान की विश्लेषण सॉफ्टवेयर द्वारा निष्पादित) चित्रा 3में रची गई हैं । A3G के स्तर में वृद्धि कुल पढ़ें संख्या RT मध्यस्थता सीडीएनए संश्लेषण पर A3G के निरोधात्मक प्रभाव को दर्शाती कम पहले वर्णित और qPCR6,13,21,22द्वारा मापा. चित्रा 3बीमें, पहले १८२ nt के भीतर प्रत्येक संभव लंबाई में अणुओं के अंश दिखाए जाते हैं । A3G के अभाव में एचआईवी-1 संक्रमण के लिए, सबसे प्रचुर प्रजातियों में मुख्य १८० nt मजबूत बंद अणु ही है, के कुछ संचय के साथ कम रेंज (23 से ४० nt) (शीर्ष ग्राफ, नीले हिस्टोग्राम) में पढ़ता है । A3G के अलावा कुछ बहुत ही विशिष्ट, reproducible पदों (मध्य और कम रेखांकन) का पता चला है पर कम, कटा हुआ सीडीएनए अणुओं की एक तेज वृद्धि के रूप में इस प्रोफ़ाइल परिवर्तन । चूंकि A3G एक cytidine deaminase है, cytosine-टू-uridine (सी के रूप में पहचाने जाने वाली टी) उत्परिवर्तनों सीडीएनए में जब A3G21,23,24संक्रमण virions में मौजूद है हो । प्राप्त sequencing जानकारी का उपयोग करना, C-to-T उत्परिवर्तनों का प्रतिशत एक ही ग्राफ (लाल बिंदीदार रेखा) पर प्लॉट किया गया था । यह ध्यान दिया जाना चाहिए कि उत्परिवर्तन प्रोफ़ाइल सभी अद्वितीय पुस्तकें संयुक्त और प्रत्येक न्यूक्लियोटाइड के कवरेज से व्युत्पंन है भिंन होगा । हालांकि, यदि आवश्यक अनुक्रम जानकारी प्रत्येक अणु के लिए वापस संबंधित हो सकता है और एक विशिष्ट 3 ' के साथ संबद्ध-टर्मिनस । प्रदान किए गए डाटा Pollpeter एट अल से लिया गया है । 6 और उत्परिवर्तन और सीडीएनए लंबाई प्रोफाइल के बीच संबंध का पता लगाने और सेलुलर डीएनए की मरंमत मशीनरी द्वारा deaminated सीडीएनए के दरार के कारण हो प्रदर्शन किया गया ।

3 ' के लिए एक सकारात्मक नियंत्रण-मानचित्रण दृष्टिकोण आसानी से ज्ञात अनुक्रम, लंबाई, और एकाग्रता के सिंथेटिक oligonucleotides के एक पूल प्रसंस्करण द्वारा उत्पादित किया जा सकता है । यह नियंत्रण एडेप्टर बंधाव चरण 3.3.2 में जोड़ा गया है और सभी मल्टीप्लेक्स पुस्तकालयों में शामिल होने की सलाह दी । एक नियंत्रण नमूना से प्राप्त डेटा अपेक्षित इनपुट अनुपात में सभी oligonucleotides, केवल बहुत छोटी पृष्ठभूमि के साथ पढ़ता होना चाहिए । चित्रा 4 17 रासायनिक संश्लेषित oligonucleotides के एक सकारात्मक नियंत्रण सेट के परिणाम दिखाता है (दृश्यों के लिए, तालिका 2देखें), जो equimolar अनुपात में मिलाया गया था । जैसा कि उंमीद थी, सभी अणुओं केवल छोटे रूपों (शीर्ष ग्राफ) के साथ बराबर बहुतायत के पास में दिखाई देते हैं । जबकि-एसएसएस डीएनए अनुक्रम है कि एक oligonucleotide द्वारा प्रतिनिधित्व नहीं कर रहे थे के भीतर सबसे पदों शूंय पढ़ें मायने रखता है, हम छोटे प्रजातियों कि 1 या 2 nt वास्तविक नियंत्रण oligonucleotides से छोटा कर रहे है मनाया । हम आगे इन छोटे प्रजातियों की जांच नहीं की है, लेकिन लगता है कि वे नीचा या अधूरा खरीद पर प्रदान की oligonucleotide शेयरों में मौजूद उत्पादों का प्रतिनिधित्व करते है (oligonucleotides के रूप में HPLC शुद्ध, जिसके लिए निर्माता > ८०% शुद्धता) इंगित करता है । नीचे ग्राफ एक अलग पुस्तकालय चलाने से नियंत्रण के नमूने से पता चलता है, जहां भिंनता 17 oligonucleotides के बीच थोड़ा अधिक है और है कि अब नियंत्रण अणुओं में समग्र लंबाई के साथ संबद्ध है और अधिक कुशलता से तो कम लोगों का पता लगाया है । यह पीसीआर प्रतिक्रियाओं में एक मामूली पूर्वाग्रह के कारण या MiSeq अनुक्रमण के दौरान clustering में, जो एक डालने का आकार इष्टतम है और विशेष रूप से व्यापक डालने पर्वतमाला ले पुस्तकालयों के साथ हो सकता है हो सकता है । इस पूर्वाग्रह का पता करने के लिए एक बुनियादी तरीका है कि अणु लंबाई (गुलाबी लाइन) करने के लिए पूर्वाग्रह correlating इंगित करता है ढलान पर आधारित एक सामान्यीकरण कारक के आवेदन है । आवश्यक परिकलन विश्लेषण प्रोग्राम में शामिल किए गए हैं (चरण ८.३ प्रोटोकॉल में देखें) ।

Figure 1
चित्रा 1: एचआईवी के पहले कदम-1 रिवर्स प्रतिलिपि दिखा आरेख । यह प्रक्रिया जीनोमिक वायरल आरएनए (चरण 1) में प्राइमरी बाइंडिंग साइट (पंजाब) के लिए tRNA (Lys, 3) (नारंगी) के एनीलिंग के साथ शुरू होता है, जो वायरल सीडीएनए (नीला, चरण 2) की दीक्षा और बढ़ाव की अनुमति देता है । Concomitantly, जीनोमिक आरएनए के खाके (चरण 3) की RNaseH गतिविधि द्वारा नीचा है । रिवर्स प्रतिलेखन की प्रक्रिया में पहली पूर्ण मध्यवर्ती ऋण-किनारा मजबूत बंद है (-) एसएसएस सीडीएनए, जो पूरा हो गया है जब आरटी catalyzed बहुलकीकरण पहुंचता है 5 '-gRNA दोहराने (आर) क्षेत्र (चरण 3) के टर्मिनस । (-) एसएसएस मध्यवर्ती 3 ' जीनोमिक आरएनए टेम्पलेट को एनीलिंग पूरक 3 '-लांग टर्मिनल दोहराने (बाएं से दाएं) आर क्षेत्र में स्थानांतरित किया गया है । यहां से, बहुलकीकरण जारी है (चरण 4) । वर्णित विधि में रिवर्स प्रतिलेखन प्रगति नवजात वायरल सीडीएनए (नीला) की सटीक लंबाई मानचित्रण द्वारा निर्धारित किया जाता है । PPT, polypurine पथ; U5, अद्वितीय 5 '-अनुक्रम; U3, अद्वितीय 3 '-अनुक्रम । यह आंकड़ा पिछले प्रकाशन6से पुनर्प्रकाशित है । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 2
चित्रा 2 : कार्यप्रवाह रूपरेखा और अनुकूलक बंधाव और पीसीआर प्रवर्धन रणनीति के योजनाबद्ध । (एक) कार्यप्रवाह वर्णित तकनीक के मुख्य कदम रेखांकित करने के लिए 3 ' निर्धारित-एचआईवी के टर्मिनी-1 संक्रमित कोशिकाओं में रिवर्स टेप । आंकड़ा पिछले6प्रकाशन से अनुकूलित है । (ख) अनुकूलक बंधाव और पीसीआर प्रवर्धन रणनीति की योजनाबद्ध । पिछले कदम में शुद्ध किया गया है कि अलग लंबाई के नवजात सीडीएनए अणुओं टी-4 डीएनए ligase का उपयोग कर एक एकल फंसे डीएनए अनुकूलक के लिए ligated हैं. hairpin अनुकूलक (नाम "पूर्ण Kwok + MiSeq", तालिका 1देखें) डिजाइन Kwok एट अलसे प्रेरित था । 11. एडेप्टर एक यादृच्छिक 6 nt बारकोड अनुक्रम, जो आधार के लिए अनुमति देता है युग्मन बंधाव की सुविधा के लिए और एक साथ अद्वितीय पढ़ता के लिए एक पहचानकर्ता के रूप में कार्य करता है । 3 '-टर्मिनी के अनुकूलक एक स्पेसर (SpC3) के लिए आत्म बंधाव को रोकने किया जाता है । Ligated उत्पादों denaturing polyacrylamide जेल ट्रो (पृष्ठ) द्वारा अतिरिक्त अनुकूलक से अलग कर रहे हैं । जेल में न्यूक्लिक एसिड दाग और तीन अलग, बराबर आकार जेल टुकड़े में अनुकूलक के ऊपर से क्षेत्र में अच्छी तरह के रूप में25में किया काट रहे हैं । रेफरेंस के बाद, वर्षण, और पुनर्निलंबन, उत्पादों को प्राइमरों के साथ परिवर्धित एनीलिंग के ज्ञात अनुक्रम (प्राइमरी 1, मल्टीप्लेक्स oligonucleotide किट, सामग्री की तालिकादेखें) और एचआईवी के पहले 22 nt-1 ले जाने के लिए एक प्राइमर है 5 '-बाएं से दाएं अनुक्रम तुरंत tRNA (प्राइमर 2, mp 1.0 + 22HIV) के बाद । 5 '-चुना प्राइमरों के टर्मिनी चुना अनुक्रमण मंच (P5 और P7) के रूप में अच्छी तरह से एक सूचकांक अनुक्रम के लिए एक ही पुस्तकालय में चलाने के व्यक्तिगत नमूने भेद करने के लिए एडेप्टर ले । sequencing पढ़ें प्राइमरों के अंक शुरू संकेत कर रहे हैं । नीले बॉक्स ब्याज के क्षेत्र को इंगित करता है कि मूल 3 '-कब्जा कर लिया अणु के टर्मिनी निर्धारित करने के लिए । यह आंकड़ा पिछले एक प्रकाशन6से अनुकूलित है । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 3
चित्रा 3 : प्रतिनिधि परिणाम । (a) वर्णित प्रोटोकॉल के साथ संसाधित प्रतिनिधि नमूनों की कुल पठन संख्या । यह सब अनुक्रम है कि एचआईवी के अद्वितीय पढ़ता के रूप में पहचाने गए-1 अणुओं के साथ उनके 3 '-टर्मिनी के पहले ६३५ शूंय के भीतर ऋण किनारा सीडीएनए (PPT तक, चित्रा 1देखें) शामिल हैं । एचआईवी के साथ संक्रमण-1 ले जा नहीं A3G पैदावार पढ़ता है, जबकि A3G सीडीएनए संश्लेषण को रोकता है और इस तरह कुल पढ़ें गिनती कम कर देता है की सबसे अधिक संख्या । संक्रमित कोशिकाओं को एक नकारात्मक नियंत्रण के रूप में सेवा की है, जबकि सिंथेटिक oligonucleotides का एक सेट एक सकारात्मक नियंत्रण प्रदान करता है । ख) nt पदों के बीच प्रत्येक लंबाई के लिए cDNAs के सापेक्ष बहुतायत 23 और १८२ (पूर्ण लंबाई-sss सीडीएनए १८० है १८२ nt) एचआईवी के-1nl 4.3 अनुक्रम (x-अक्ष) नीले हिस्टोग्राम में दिखाया गया है (बाएं y-अक्ष पर स्केल) । सीडीएनए के सापेक्ष बहुतायत सभी की राशि से विभाजित-एसएसएस सीडीएनए अनुक्रम के भीतर एक दिया न्यूक्लियोटाइड में समाप्त अनुक्रम की निरपेक्ष संख्या से गणना की गई थी 182nt या कम मापने पढ़ता है । धराशायी लाल लाइनों में दिखाया गया है सी के लिए ले जाने के प्रतिशत, संबंधित स्थिति (सही y-अक्षों पर स्केल) पर टी/ चित्रा 3 b को पिछले प्रकाशन6से पुनर्प्रकाशित किया जाता है । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 4
चित्र 4 : नियंत्रण नमूनों के प्रतिनिधि परिणाम । दिखाया 17 अलग लंबाई सिंथेटिक oligonucleotides की equimolar मात्रा युक्त पूल के लिए दो प्रोफाइल हैं । इन oligonucleotides एचआईवी से अनुक्रम है-1nl 4.3 और विभिंन लंबाई को कवर और एक 3 ' के रूप में सभी 4 कुर्सियां मौजूद-न्यूक्लियोटाइड ( 2 तालिकादेखें) का चयन किया गया । शीर्ष ग्राफ चित्रा 3से सकारात्मक नियंत्रण नमूना दिखाता है । अणु लंबाई या ओपन 3 ' के प्रति कोई महत्वपूर्ण पूर्वाग्रह-टर्मिनी का पता चला है । नीचे ग्राफ अनुक्रमण में एक छोटी सी लंबाई पूर्वाग्रह का उत्पादन किया है, जो एक अलग पुस्तकालय चलाने से पता चलता है. इस मामले में, यह एक मानकीकरण कारक है, जो ढलान से व्युत्पंन (गुलाबी में दिखाया गया है) है कि आकार पूर्वाग्रह का प्रतिनिधित्व करता है लागू करने के लिए सलाह दी जाती है । यह आंकड़ा पिछले प्रकाशन6से पुनर्प्रकाशित है । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Oligo नाम nt में लंबाई अनुक्रम उद्देश्य निर्माता (शुद्धि)
पूर्ण Kwok + MiSeq ६१ 5 '-फोटो-tgaagagcctagtcgctgttcannnnnnctgcccatagagagatcggaagagcacacgtct-SpC3-3 ' एडेप्टर IDT डीएनए टेक्नोलॉजीज (HPLC)
2xBiotin एसएस चारा ४० 5 '-बायोटिन-cagtgtggaaaatctctagcagtggcgcccgaacagggac-बायोटिन-3 ' हाइब्रिड कैप्चर MWG Eurofins (HPLC)
बायोटिन 1-16 ss 22 5 '-cagtgtggaaaatctctagcag-BiTEG-3 ' हाइब्रिड कैप्चर MWG Eurofins (HPLC
बायोटिन tRNA + CTG 16 5 '-cagtggcgcccgaaca-BITEG-3 ' हाइब्रिड कैप्चर MWG Eurofins (HPLC)
एमपी 1.0 + 22HIV ८२ 5 '-aatgatacggcgaccaccgagatctacactctttccctacacgacgctcttccgatctcactgctagagattttccacactg-3 ' पीसीआर प्रवर्धन MWG Eurofins (HPLC

तालिका 1: तालिका oligonucleotides की लंबाई, अनुक्रम, और संशोधन वर्णित प्रोटोकॉल में उपयोग किया जाता है जिसमें शामिल है। तालिका पिछले प्रकाशन6से अनुकूलित है । इस तालिका को excel फ़ाइल के रूप में डाउनलोड करने के लिए कृपया यहां क्लिक करें ।

Oligo नाम nt में लंबाई अनुक्रम निर्माता (शुद्धि)
HTP con long C १२० 5 '-ctgctagagattttccacactgactaaaagggtctgagggatctctagttaccagagtcacacaacagacgggcacacactactttgagcactcaaggcaagctttattgaggcttaagc-3 ' MWG Eurofins (HPLC)
HTP con long G ११९ 5 '-ctgctagagattttccacactgactaaaagggtctgagggatctctagttaccagagtcacacaacagacgggcacacactactttgagcactcaaggcaagctttattgaggcttaag-3 ' MWG Eurofins (HPLC)
HTP con long T ११६ 5 '-ctgctagagattttccacactgactaaaagggtctgagggatctctagttaccagagtcacacaacagacgggcacacactactttgagcactcaaggcaagctttattgaggctt-3 ' MWG Eurofins (HPLC)
HTP कांग्रेस लंबे समय से एक ११८ 5 '-ctgctagagattttccacactgactaaaagggtctgagggatctctagttaccagagtcacacaacagacgggcacacactactttgagcactcaaggcaagctttattgaggcttaa-3 ' MWG Eurofins (HPLC)
HTP con मध्य सी ७६ 5 '-ctgctagagattttccacactgactaaaagggtctgagggatctctagttaccagagtcacacaacagacgggcac-3 ' MWG Eurofins (HPLC)
HTP con mid G (a) ७१ 5 '-ctgctagagattttccacactgactaaaagggtctgagggatctctagttaccagagtcacacaacagacg-3 ' MWG Eurofins (HPLC)
HTP con mid G (b) ७२ 5 '-ctgctagagattttccacactgactaaaagggtctgagggatctctagttaccagagtcacacaacagacgg-3 ' MWG Eurofins (HPLC)
HTP con मध्य एक ६९ 5 '-ctgctagagattttccacactgactaaaagggtctgagggatctctagttaccagagtcacacaacaga-3 ' MWG Eurofins (HPLC)
HTP con मध्य टी ८५ 5 '-ctgctagagattttccacactgactaaaagggtctgagggatctctagttaccagagtcacacaacagacgggcacacactactt-3 ' MWG Eurofins (HPLC)
HTP con short A ४० 5 '-ctgctagagattttccacactgactaaaagggtctgaggga-3 ' MWG Eurofins (HPLC)
HTP con short T ३३ 5 '-ctgctagagattttccacactgactaaaagggt-3 ' MWG Eurofins (HPLC)
HTP con short G ४१ 5 '-ctgctagagattttccacactgactaaaagggtctgaggg-3 ' MWG Eurofins (HPLC)
HTP con short C ३४ 5 '-ctgctagagattttccacactgactaaaagggtc-3 ' MWG Eurofins (HPLC)
HTP Con ४६ (T) ४६ 5 '-ctgctagagattttccacactg actaaaagggtctgagggatctct-3 ' MWG Eurofins (HPLC)
HTP Con ८३ (C) ८३ 5 '-ctgctagagattttccacactg actaaaagggtctgagggatctctagttaccagagtcacacaacagacgggcacacactac-3 ' MWG Eurofins (HPLC)
HTP Con १०३ (C) १०३ 5 '-ctgctagagattttccacactg actaaaagggtctgagggatctctagttaccagagtcacacaacagacgggcacacactactttgagcactcaaggcaagc-3 ' MWG Eurofins (HPLC)
HTP Con १०७ (अ) १०७ 5 '-ctgctagagattttccacactg actaaaagggtctgagggatctctagttaccagagtcacacaacagacgggcacacactactttgagcactcaaggcaagcttta-3 ' MWG Eurofins (HPLC)

तालिका 2:17 सिंथेटिक नियंत्रण oligonucleotides की तालिका एक सकारात्मक नियंत्रण नमूना के रूप में इस्तेमाल किया । शीर्ष 13 oligonucleotides के आधार पर चुना गया आकार [लंबे (११६ से १२० nt), mid (६९ करने के लिए ८५ nt), लघु (३३ से ४१ nt)] के रूप में अच्छी तरह के रूप में उनके 3 '-टर्मिनी । तालिका पिछले प्रकाशन6से अनुकूलित है ।  इस तालिका को excel फ़ाइल के रूप में डाउनलोड करने के लिए कृपया यहां क्लिक करें ।

Discussion

तेजी से, विश्वसनीय की उपलब्धता, और लागत प्रभावी गहरी अनुक्रमण जीवन विज्ञान के क्षेत्र में कई पहलुओं में क्रांति ला दिया है, अनुक्रमण आधारित विश्लेषण में महान गहराई की अनुमति । एक शेष चुनौती अभिनव डिजाइन और प्रतिनिधि अनुक्रमण पुस्तकालयों के निर्माण में निहित है । यहां हम एक प्रोटोकॉल का वर्णन नवजात वायरल सीडीएनए अणुओं पर कब्जा करने के लिए, विशेष रूप से एचआईवी के मध्यवर्ती-1 रिवर्स प्रतिलेखन प्रक्रिया ।

इस रणनीति में सबसे महत्वपूर्ण कदम ' ओपन 3 ' के लिए एक अनुकूलक के बंधाव है-एक मात्रात्मक और निष्पक्ष तरीके से टर्मिनी । दो ssDNA टर्मिनी, दोनों अंतर और intramolecular के बीच ligations की क्षमता, जांच की गई है और विभिंन अनुप्रयोगों के लिए अनुकूलित11,26,27,28,29। ३.३ चरण में वर्णित शर्तों के तहत टी-4 डीएनए ligase के साथ एक hairpin अनुकूलक का उपयोग करने का विकल्प अनुभवजंय अनुकूलन का परिणाम है जिसमें हम सिंथेटिक बंधाव का प्रतिनिधित्व करने के oligonucleotides के लिए विभिन्न ligases, एडेप्टर और रिएजेंट का मूल्यांकन किया एचआईवी-1 अनुक्रम (तालिका 2) (डेटा नहीं दिखाया गया है) । इन इन विट्रो परीक्षण प्रतिक्रियाओं में, हम ने पुष्टि की कि टी-4 डीएनए ligase मध्यस्थता बंधाव के hairpin अनुकूलक, के रूप में Kwok एट अलद्वारा वर्णित. 11, एक बहुत कम पूर्वाग्रह है, और जब एडेप्टर अतिरिक्त में प्रयोग किया जाता है स्वीकारकर्ता अणुओं की पूरी बंधाव के पास प्राप्त करता है । बंधाव दक्षता मल्टीप्लेक्स प्राइमरी प्रणाली के लिए संगत एडेप्टर प्रदान करने के लिए न्यूक्लियोटाइड अनुक्रम के अलावा से अप्रभावित था ( चित्रा 4देखें). इसकी तुलना में हमने पाया है कि एक thermostable 5 ' डीएनए/आरएनए ligase ("ligase ए", सटीक ligases के लिए सामग्री की तालिका यहाँ देखें), जो एक इंजीनियर आरएनए ligase है कि भाग में विकसित किया गया था बंधाव के साथ ssDNA दक्षता पर सुधार करने के लिए स्वीकारकर्ता के रूप में 27, ligating पर वास्तव में अधिक प्रभावी था आरएनए ligase से दो ssDNA अणु ("ligase बी") लेकिन एक महत्वपूर्ण पूर्वाग्रह था, बंधाव दक्षता में मजबूत मतभेदों के साथ भी oligonucleotides के बीच एकल आधार लंबाई मतभेदों के साथ [तालिका 2 ; HTP con मध्य जी (a) और (b)]. इसके अलावा, हम "Ligase सी" एक ' यादृच्छिक 5 '-टर्मिनी (एक रणनीति "Ligase सी के ज्ञात न्यूक्लियोटाइड पूर्वाग्रह ऑफसेट करने के लिए इस्तेमाल किया" ले जाने के साथ संयुक्त प्रतिक्रियाओं में केवल एक ंयूनतम पूर्वाग्रह पाया; डिंग एट अलउदाहरण के लिए देखें । 30). हालांकि, "Ligase सी" मध्यस्थता आणविक ligations अपूर्ण थे, टी-4 डीएनए Ligase प्रणाली बेहतर विकल्प प्रतिपादन.

प्रोटोकॉल के पाठ्यक्रम और सकारात्मक और नकारात्मक नियंत्रण के शामिल किए जाने पर कई गुणवत्ता नियंत्रण कदम परख निरंतरता से पहले संभावित समस्याओं का पता लगाने के लिए अनुमति देते है और समस्या निवारण के प्रयासों के लिए मार्गदर्शन प्रदान करते हैं । qPCR quantifications में कदम -8 और 2.3.12 सुनिश्चित करें कि इनपुट सामग्री की मात्रा पर्याप्त है । ठेठ सीडीएनए कॉपी नंबर २०० µ एल रेफरेंस में (स्टेप २.१ से) रेंज करीब १०,००० से ३००,००० प्रति µ एल. संकर कब्जा कदम समग्र एचआईवी के कुछ नुकसान में परिणाम कर सकते है-1 सीडीएनए मात्रा लेकिन विशिष्ट एचआईवी के एक मजबूत संवर्धन में परिणाम चाहिए सेलुलर डीएनए पर 1 सीडीएनए, जो उचित प्राइमरों का उपयोग करके निर्धारित किया जा सकता है जीनोमिक डीएनए यों तो से पहले और संवर्धन के बाद qPCR या कुल डीएनए एकाग्रता को मापने के द्वारा । बरामद एचआईवी-1 सीडीएनए के बाद संकर कब्जा कदम इनपुट के कम से 10% होना चाहिए । कम शुरू सामग्री अंयथा एक सफल oligonucleotide सकारात्मक नियंत्रण (3.3.2 कदम देखें), लेकिन केवल सीमित नमूनों में प्राप्त पढ़ता है समझा सकता है । कम पढ़ें समग्र भी MiSeq एडेप्टर के बिना अप्रासंगिक डीएनए प्रजातियों की उपस्थिति के कारण पुस्तकालय एकाग्रता के अधिक आकलन द्वारा समझाया जा सकता है । यह कम क्लस्टर घनत्व में परिणाम होगा और fluorometric परख द्वारा कुल डीएनए राशि के अलावा qPCR द्वारा पुस्तकालय में एचआईवी-1 दृश्यों की एकाग्रता का निर्धारण करके सुधार किया जा सकता है । विधि की अति संवेदनशील प्रकृति के कारण, विशेष देखभाल भी निम्न स्तर के संदूषण से बचने के लिए लिया जाना चाहिए, दोनों अन्य नमूनों से (विशेष रूप से, उच्च एकाग्रता नियंत्रण oligonucleotide स्टॉक से) के रूप में अच्छी तरह से प्रयोगशाला उपकरणों से. एक यूवी बंध्याकरण पीसीआर कार्य केंद्र में काम कर इस संबंध में फायदेमंद है । अंतिम लाइब्रेरी (step 6.1.2) की ऑटोमेटेड जेल ट्रो एक और गुणवत्ता नियंत्रण उपाय है । न्यूक्लिक एसिड आकार रेंज आमतौर पर मनाया १५० ५०० nt. प्राइमरों के बीच है कि पीसीआर के बाद वैकल्पिक नियंत्रण में पाया जा सकता है और शुद्धि से पहले (नोट चरण ५.२ में देखें) अब अनुपस्थित होना चाहिए । एक प्रतिनिधि परिणाम में, नमूना तीव्रता वक्र १६० के आसपास एक चोटी है १७० nt और ३२० के आसपास एक दूसरे तेज शिखर ३५० nt के लिए । यह संभावना अक्सर दोनों अपेक्षाकृत कम में देखा उच्च बहुतायत (1 से 20 nt डालने की लंबाई) रिवर्स टेप और पूर्ण लंबाई मजबूत रोक (१८० १८२ nt डालने की लंबाई) (चित्रा 3बी) को दर्शाता है ।

जबकि प्रस्तुत प्रोटोकॉल और चयनित प्राइमरों जल्दी एचआईवी के लिए विशिष्ट है-1 रिवर्स प्रतिलेखन का निर्माण, विधि आम तौर पर किसी भी ' खुले 3 निर्धारित लक्ष्य अध्ययन के लिए लागू है '-डीएनए के टर्मिनी । मुख्य अंय संदर्भों में आवश्यक संशोधनों संकर कब्जा और प्राइमर डिजाइन रणनीति के लिए विधि होगी । उदाहरण के लिए, यदि लक्ष्य को देर से एचआईवी-1 टेप के लिए अनुकूलित किया जा रहा है, विभिंन कैप्चरिंग biotinylated oligonucleotides सीडीएनए की लंबाई भर में एनीलिंग की एक बड़ी संख्या उचित होगा और संभावना संकर पर कब्जा कदम में कमी होगी । के रूप में परिचय में उल्लेख किया है, यह सीमाओं पर विचार महत्वपूर्ण है जब सीमा पर 3 '-टर्मिनी के लिए पूर्वाग्रह के विभिंन स्रोतों से बचने का पता लगाया जा रहे है डिजाइनिंग । सबसे पहले, वहां पीसीआर प्रतिक्रियाओं में पूर्वाग्रह हो सकता है अगर अनुकूलक के साथ टेंपलेट्स काफी लंबाई बदलती हैं । दूसरा, अनुक्रमण मंच यहां इस्तेमाल किया (जैसे, MiSeq) इष्टतम clustering के लिए एक पसंदीदा डालने की लंबाई सीमा है, और काफी कम है और अब उत्पादों को एक ही दक्षता के साथ अनुक्रम नहीं किया जा सकता है । भाग में, यह अभिकलन संबोधित किया जा सकता है, के रूप में रैखिक लंबाई पूर्वाग्रह के लिए एक सुधार कारक गणना द्वारा किया गया था ( चित्रा 4, नीचे ग्राफ देखें) । हालांकि, जहां 3 ' के क्षेत्र-टर्मिनी मानचित्रण वांछित है (> १००० nt) लंबा है, यह और अधिक के लिए ligated टेप के साथ प्रतिक्रियाओं विभाजन और एकाधिक नदी के ऊपर प्राइमरों का उपयोग करने के लिए 3 ' का आकलन-टर्मिनी वर्गों में सलाह दी जाती है ।

विश्लेषण कार्यक्रम में लिखा गया था-घर में एचआईवी-1 के दोनों अंतिम न्यूक्लियोटाइड का विश्लेषण करने के विशिष्ट प्रयोजन के लिए तय एडेप्टर अनुक्रम से सटे अनुक्रम के रूप में के रूप में अच्छी तरह से सभी कुर्सियां के आधार रूपांतर के लिए किसी भी परिवर्तन की पहचान । व्यक्तिगत चरणों में निम्न शामिल हैं: पहला, एडेप्टर अनुक्रम fastx-0.0.13 टूलकिट का उपयोग कर छंटनी कर रहे हैं; फिर, डुप्लिकेट किए गए किसी भी अनुक्रम (अर्थ समान क्रम बारकोड सहित) निकाल दिए जाते हैं । सभी शेष अद्वितीय पढ़ता है तो Bowtie (http://bowtie-bio.sourceforge.net/index.shtml) अधिकतम बेमेल तीन ठिकानों पर सेट के साथ का उपयोग कर एचआईवी-1 अनुक्रम के लिए गठबंधन कर रहे हैं । टेंपलेट अनुक्रम एचआईवी के पहले ६३५ nt-1 सीडीएनए (nl 4.3 तनाव) है, जो-एसएसएस अनुक्रम और पहले किनारा हस्तांतरण उत्पाद शामिल है polypurine ट्रैक (U5-R-U3-PPT के शामिल है, चित्रा 1देखें) । इस प्रकार, प्रदान की सॉफ्टवेयर और टेंपलेट्स केवल सीधे उपयुक्त है अगर विधि एक ही आवेदन के लिए प्रयोग किया जाता है (एचआईवी के जल्दी रिवर्स टेप का पता लगाने-1nl 4.3) । समायोजन अन्य लक्ष्य अनुक्रम के लिए किया जाना होगा । प्रत्येक पढ़ने के लिए 3 '-टर्मिनी की स्थितियां संरेखण में स्थान द्वारा निर्धारित की गई थीं । प्रत्येक स्थिति के लिए आधार कॉल दर्ज की गई है और उत्परिवर्तन दरों प्रत्येक आधार है, जो बदलता है की कुल कवरेज से गणना कर रहे हैं, के रूप में पढ़ता है अलग लंबाई के होते है और लंबे आवेषण पूरी तरह से Read2 में १२५-आधार अनुक्रमण द्वारा कवर नहीं किया जा सकता है ।

समाप्त करने के लिए, हमारा मानना है कि वर्णित विधि अध्ययन के कई प्रकार के लिए एक महत्वपूर्ण उपकरण हो । स्पष्ट आवेदन एंटीरेट्रोवाइरल दवाओं या सेलुलर प्रतिबंध कारकों के माध्यम से रिवर्स प्रतिलेखन निषेध अंतर्निहित तंत्र की जांच शामिल हैं । हालांकि, केवल अपेक्षाकृत मामूली समायोजन करने के लिए सिस्टम को अनुकूलित करने के लिए आवश्यक होना चाहिए 3 '-टर्मिनी मैपिंग अन्य एकल-कतरा डीएनए वायरल मध्यवर्ती के भीतर, जो मौजूद हैं, उदाहरण के लिए, parvovirus प्रतिकृति में. इसके अलावा, विधि के सिद्धांत, विशेष रूप से अपने अनुकूलित बंधाव कदम, किसी भी 3 ' के लक्षण वर्णन के लिए पुस्तकालय की तैयारी डिजाइन का एक मुख्य हिस्सा प्रदान कर सकते हैं-डीएनए एक्सटेंशन सेलुलर डबल-कतरा डीएनए द्वारा catalyzed सहित, polymerases ।

Disclosures

लेखकों ने एलान किया कि उनका खुलासा करने के लिए कुछ नहीं है ।

Acknowledgments

लेखक मल्म प्रयोगशाला, लुइस Apolonia, Jernej उले, और रेबेका Oakey के सदस्यों से समर्थन स्वीकार करते हैं । लेखकों के राजा कॉलेज लंदन जीनोमिक सेंटर और डेबी ह्यूजेस पर विश्वविद्यालय कॉलेज लंदन (UCL), न्यूरोलॉजी अगली पीढ़ी sequencing सुविधा के लिए संस्थान में मैट Arno धंयवाद, MiSeq अनुक्रमण रन के साथ मदद के लिए । इस कार्य को यूके मेडिकल रिसर्च काउंसिल (G1000196 और MR/M001199/1 to M.M.), वेलकम ट्रस्ट (106223/z/14/z to M.M.), यूरोपीय आयोग के सातवें फ्रेमवर्क कार्यक्रम (FP7/2007-2013) के तहत ग्रांट एग्रीमेंट सं. PIIF-GA-2012-329679 (D.P. करने के लिए), और स्वास्थ्य अनुसंधान के लिए एक राष्ट्रीय संस्थान के माध्यम से स्वास्थ्य विभाग व्यापक जैव चिकित्सा अनुसंधान के लिए पुरस्कार है लड़के और सेंट थॉमस ' एन एच एस फाउंडेशन राजा कॉलेज लंदन और राजा के साथ साझेदारी में ट्रस्ट को अवार्ड कॉलेज अस्पताल एन एच एस फाउंडेशन ट्रस्ट ।

Materials

Name Company Catalog Number Comments
293T cells ATCC CRL-3216
Dulbecco's Modified Eagle's Medium Gibco 31966-021
Penicillin/Streptomycin Gibco 15150-122
Fetal Bovine Serum Gibco 10270-106
HeraCell Vios 250i CO2 Incubator Thermo Scientific 51030966
Laminar flow hood - CAS BioMAT2 Wolflabs CAS001-C2R-1800
10mm TC-treated culture dish Corning 430167
TrypLE™ Express (1x), Stable Trypsin Replacement Enzyme Gibco 12605-010
OptiMEM® (Minimal Essential Medium) Gibco 31985-047
HIV-1 NL4-3 Infectious Molecular Clone (pNL4-3) NIH Aids reagent program 114
Polyethylenimine (PEI) - MW:25000 PolySciences Inc 23966-2 dissolved at 1mg/ml and adjusted to pH7
RQ1- Rnase free Dnase Promega M6101
Filter 0.22 μm Triple Red Limited FPE404025
15 mL polypropylene tubes Corning CLS430791
Sucrose Calbiochem 573113
Phosphate Buffered Saline (1x) Gibco 14190-094
Ultracentrifuge tubes Beckman Coulter 344060
Ultracentrifuge Sorval WX Ultra Series Th-641 Rotor
Alliance HIV-1 p24 antigen ELISA kit Perkin Elmer NEK050001KT
CEM-SS cells NIH Aids reagent program 776
Roswell Park Memorial Institute Medium Gibco 31870-025
CoStar® TC treated multiple well plates Corning CLS3513-50EA
Benchtop centrifuge: Heraus™ Multifuge™ X3 FR Thermo Scientific 75004536
TX-1000 Swinging Bucket Rotor Thermo Scientific 75003017
Microcentrifuge: 5424R Eppendorf 5404000060
Total DNA extraction kit (DNeasy Blood and Tissue kit) Qiagen 69504
Nuclease free H2O Ambion AM9937
Cutsmart buffer New England Biolabs (part of DpnI enzyme) R0176S
DpnI restriction enzyme New England Biolabs R0176S
Oligonucleotides for qPCR MWG Eurofins N/A HPSF purification
TaqMan PCR Universal Mastermix Thermo 4304437
LoBind Eppendorf® tubes Eppendorf 30108078
Axygen™ aerosol filter pipette tips, 1000 μL Fisher Scientific TF-000-R-S
Axygen™ aerosol filter pipette tips, 200 μL Fisher Scientific TF-200-R-S
Axygen™ aerosol filter pipette tips, 20 μL Fisher Scientific TF-20-R-S
Axygen™ aerosol filter pipette tips, 10 μL Fisher Scientific TF-10-R-S
PCR clean hood LabCaire Model PCR-62
DynaMag™2-magnet Thermo 12321D
Streptavidin MagneSphere® paramagnetic particles Promega Z5481
Casein Thermo Scientific 37582
End over end rotator, Revolver™ 360° Labnet H5600
Tris-Base Fisher Scientific BP152-5
Hydrochloric Acid Sigma H1758-100ML
EDTA disodium salt dihydrate Electran (VWR) 443885J
Sodium Chloride Sigma S3014
Dri-Block® Analog Block Heater Techne UY-36620-13
PCR tubes and domed caps Thermo Scientific AB0266
PCR machine Eppendorf Mastercycler® series
T4 DNA ligase New England Biolabs M0202M
40% Polyethylene glycol solution (PEG) in H2O, MW: 8000 Sigma P1458-25ML
Betaine solution, 5M Sigma B0300-1VL
Gel loading buffer II (formamide buffer) Thermo Scientific AM8546G
Precast 6% TBE urea gels Invitrogen EC6865BOX
Mini cell electrophoresis system Invitrogen, Novex XCell SureLock™
Tris/Borate/EDTA solution (10x) Fisher Scientific 10031223
Needle 21 G x1 1/2 VWR 613-2022
SYBR Gold nucleic acid stain (10000x) Life Technologies S11494
Dark Reader DR46B transilluminator Fisher Scientific NC9800797
Ammonium acetate Merck 101116
SDS solution 20% (w/v) Biorad 161-0418
Centrifuge tube filter Appleton Woods BC591
Filter Glass Fibre Gf/D 10mm Whatman (VWR) 512-0427
polyadenylic acid (polyA) RNA Sigma 10108626001
Glycogen, molecular biology grade Thermo Scientific R0561
Isopropanol (2-propanol) Fisher Scientific 15809665
Ethanol, molecular biology grade Fisher Scientific 10041814
Accuprime™ Supermix I (DNA polymerase premix) Life Technologies 12342-010
NEBNext® Multiplex Oligo for Illumina (Index Primer Set 1 and 2) New England Biolabs E7335S; E7500S
Tapestation D1000 Screentape High sensitivity Agilent Technologies 5067- 5584
Tapestation D1000 Reagents Agilent Technologies 5067- 5585
2200 Tapestation - automated gel electrophoresis system Agilent Technologies G2965AA
Agencourt® AMPure® beads XP Beckman Coulter A63880
Qubit™ dsDNA HS Assay Kit Invitrogen Q32851
Qubit™ 2.0 Fluorometer Invitrogen Q32866
Topo™ TA cloning Kit Invitrogen 450071
Sequencing platform: MiSeq System Illumina
Experiment Manager (Sample sheet software) Illumina Note: Use TruSeq LT as a template
Miseq™ Reagent kit V3 (150 cycle) Illumina MS-102-3001
Sequencing hub: Basespace Illumina https://basespace.illumina.com
Ligase A: Thermostable 5’ App DNA/RNA ligase NEB M0319S Not used in this protocol, but tested in optimization process with results described in the discussion.
Ligase B: T4 RNA ligase 1 NEB M0204 Not used in this protocol, but tested in optimization process with results described in the discussion.
Ligase C: CircLigase Epicentre CL4111K Not used in this protocol, but tested in optimization process with results described in the discussion.

DOWNLOAD MATERIALS LIST

References

  1. Herschhorn, A., Hizi, A. Retroviral reverse transcriptases. Cellular and Molecular Life Sciences. 67, (16), 2717-2747 (2010).
  2. Hu, W. S., Hughes, S. H. HIV-1 reverse transcription. Cold Spring Harbor Perspectives in Medicine. 2, (10), (2012).
  3. Levin, J. G., Mitra, M., Mascarenhas, A., Musier-Forsyth, K. Role of HIV-1 nucleocapsid protein in HIV-1 reverse transcription. RNA Biology. 7, (6), 754-774 (2010).
  4. Menendez-Arias, L., Sebastian-Martin, A., Alvarez, M. Viral reverse transcriptases. Virus Research. (2016).
  5. Telesnitsky, A., Goff, S. P. Retroviruses. Coffin, J. M., Hughes, S. H., Varmus, H. E. (1997).
  6. Pollpeter, D., et al. Deep sequencing of HIV-1 reverse transcripts reveals the multifaceted antiviral functions of APOBEC3G. Nature Microbiology. 3, (2), 220-233 (2018).
  7. Frohman, M. A., Dush, M. K., Martin, G. R. Rapid production of full-length cDNAs from rare transcripts: amplification using a single gene-specific oligonucleotide primer. Proceedings of the National Academy of Sciences of the United States of America. 85, (23), 8998-9002 (1988).
  8. Liu, X., Gorovsky, M. A. Mapping the 5' and 3' ends of Tetrahymena thermophila mRNAs using RNA ligase mediated amplification of cDNA ends (RLM-RACE). Nucleic Acids Research. 21, (21), 4954-4960 (1993).
  9. Ince, I. A., Ozcan, K., Vlak, J. M., van Oers, M. M. Temporal classification and mapping of non-polyadenylated transcripts of an invertebrate iridovirus. Journal of General Virology. 94, Pt 1 187-192 (2013).
  10. Hafner, M., et al. RNA-ligase-dependent biases in miRNA representation in deep-sequenced small RNA cDNA libraries. RNA. 17, (9), 1697-1712 (2011).
  11. Kwok, C. K., Ding, Y., Sherlock, M. E., Assmann, S. M., Bevilacqua, P. C. A hybridization-based approach for quantitative and low-bias single-stranded DNA ligation. Analytical Biochemistry. 435, (2), 181-186 (2013).
  12. Abram, M. E., Tsiang, M., White, K. L., Callebaut, C., Miller, M. D. A cell-based strategy to assess intrinsic inhibition efficiencies of HIV-1 reverse transcriptase inhibitors. Antimicrobial Agents and Chemotherapy. 59, (2), 838-848 (2015).
  13. Bishop, K. N., Verma, M., Kim, E. Y., Wolinsky, S. M., Malim, M. H. APOBEC3G inhibits elongation of HIV-1 reverse transcripts. PLoS Pathogens. 4, (12), 1000231 (2008).
  14. Zack, J. A., Haislip, A. M., Krogstad, P., Chen, I. S. Incompletely reverse-transcribed human immunodeficiency virus type 1 genomes in quiescent cells can function as intermediates in the retroviral life cycle. Journal of Virology. 66, (3), 1717-1725 (1992).
  15. Adachi, A., et al. Production of acquired immunodeficiency syndrome-associated retrovirus in human and nonhuman cells transfected with an infectious molecular clone. Journal of Virology. 59, (2), 284-291 (1986).
  16. Shah, V. B., Aiken, C. In vitro uncoating of HIV-1 cores. Journal of Visualized Experiments. (57), (2011).
  17. JoVE Science Education Database. Science Education Database: Basic Methods in Cellular and Molecular Biology: Passaging Cells. Journal of Visualized Experiments. (2018).
  18. JoVE Science Education Database. JoVE Science Education Database: Basic Methods in Cellular and Molecular Biology: Using a Hemocytometer to Count Cells. Journal of Visualized Experiments. (2018).
  19. Zhou, M. Y., Gomez-Sanchez, C. E. Universal TA cloning. Current Issues in Molecular Biology. 2, (1), 1-7 (2000).
  20. Zhang, S., Cahalan, M. D. Purifying plasmid DNA from bacterial colonies using the QIAGEN Miniprep Kit. Journal of Visualized Experiments. (6), 247 (2007).
  21. Mangeat, B., et al. Broad antiretroviral defence by human APOBEC3G through lethal editing of nascent reverse transcripts. Nature. 424, (6944), 99-103 (2003).
  22. Gillick, K., et al. Suppression of HIV-1 infection by APOBEC3 proteins in primary human CD4(+) T cells is associated with inhibition of processive reverse transcription as well as excessive cytidine deamination. Journal of Virology. 87, (3), 1508-1517 (2013).
  23. Harris, R. S., et al. DNA deamination mediates innate immunity to retroviral infection. Cell. 113, (6), 803-809 (2003).
  24. Zhang, H., et al. The cytidine deaminase CEM15 induces hypermutation in newly synthesized HIV-1 DNA. Nature. 424, (6944), 94-98 (2003).
  25. Konig, J., et al. iCLIP--transcriptome-wide mapping of protein-RNA interactions with individual nucleotide resolution. Journal of Visualized Experiments. (50), (2011).
  26. Troutt, A. B., McHeyzer-Williams, M. G., Pulendran, B., Nossal, G. J. Ligation-anchored PCR: a simple amplification technique with single-sided specificity. Proceedings of the National Academy of Sciences of the United States of America. 89, (20), 9823-9825 (1992).
  27. Zhelkovsky, A. M., McReynolds, L. A. Structure-function analysis of Methanobacterium thermoautotrophicum RNA ligase - engineering a thermostable ATP independent enzyme. BMC Molecular Biology. 13, (24), (2012).
  28. Li, T. W., Weeks, K. M. Structure-independent and quantitative ligation of single-stranded DNA. Analytical Biochemistry. 349, (2), 242-246 (2006).
  29. Gansauge, M. T., et al. Single-stranded DNA library preparation from highly degraded DNA using T4 DNA ligase. Nucleic Acids Research. 45, (10), 79 (2017).
  30. Ding, Y., Kwok, C. K., Tang, Y., Bevilacqua, P. C., Assmann, S. M. Genome-wide profiling of in vivo RNA structure at single-nucleotide resolution using structure-seq. Nature Protocols. 10, (7), 1050-1066 (2015).
3 का निर्धारण '-टर्मिनी और एचआईवी-1 संक्रमित कोशिकाओं में रिवर्स प्रतिलेखन के दौरान नवजात एकल फंसे वायरल डीएनए अणुओं के दृश्यों
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Pollpeter, D., Sobala, A., Malim, M. H. Determining 3'-Termini and Sequences of Nascent Single-Stranded Viral DNA Molecules during HIV-1 Reverse Transcription in Infected Cells. J. Vis. Exp. (143), e58715, doi:10.3791/58715 (2019).More

Pollpeter, D., Sobala, A., Malim, M. H. Determining 3'-Termini and Sequences of Nascent Single-Stranded Viral DNA Molecules during HIV-1 Reverse Transcription in Infected Cells. J. Vis. Exp. (143), e58715, doi:10.3791/58715 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter