Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biochemistry

Real-time overvågning af DNA streng Exchange reaktion medieret af Rad51

Published: February 13, 2019 doi: 10.3791/59073

Summary

Fluorescens resonans energi transfer-baseret real-time observation systemer af DNA streng exchange reaktion ved Rad51 mellemkomst blev udviklet. Bruger de protokoller, der præsenteres her, er vi købedygtig opdager dannelsen af reaktion mellemprodukter og deres omdannelse til produkter, mens også analysere den enzymatiske kinetik af reaktionen.

Abstract

DNA streng exchange reaktion medieret af Rad51 er et kritisk skridt af homologe rekombination. I denne reaktion, Rad51 danner en nucleoprotein glødetråd på enkeltstrenget DNA (ssDNA) og indfanger dobbelt-strenget DNA (dsDNA) ikke-specifikt for at afhøre den for en homolog sekvens. Efter at være stødt homologi, katalyserer Rad51 DNA streng exchange for at mægle bindingen af ssDNA med de supplerende strand af dsDNA. Denne reaktion er stærkt reguleret af talrige accessary proteiner i vivo. Selv om konventionelle biokemiske undersøgelser har med held ansat til at undersøge rollen af sådanne tilbehør protein in vitro-, kinetic analyse af mellemliggende dannelse og dets progression i et endeligt produkt har vist sig udfordrende skyldes den ustabil og forbigående karakter af reaktionen mellemprodukter. At observere disse reaktion trin direkte i løsning, fluorescens resonans energioverførsel (FRET)-baseret real-time observation systemer af denne reaktion blev etableret. Kinetic analyse af realtids observationer viser, at DNA streng exchange reaktion ved Rad51 mellemkomst adlyder en tre-trins reaktion model der involverer dannelsen af en tre-strenget DNA mellemliggende, modning af dette mellemprodukt, og frigivelsen af ssDNA fra de modne mellemliggende. Swi5-Sfr1-kompleks, en accessary protein bevaret i eukaryoter, øger kraftigt de anden og tredje trin af denne reaktion. FRET-baserede assays præsenteres her muligt at afdække de molekylære mekanismer gennem hvilke rekombination accessary proteiner stimulere DNA streng exchange aktivitet af Rad51. Hovedformålet med denne protokol er at forbedre repertoire af teknikker til rådighed for forskere inden for homologe rekombination, især dem, der arbejder med proteiner fra andre arter end Schizosaccharomyces pombe, således at den evolutionære bevarelse af resultaterne præsenteres heri kan bestemmes.

Introduction

Homologe rekombination (HR) letter blander af genetiske oplysninger mellem to forskellige DNA molekyler. HR er afgørende for to grundlæggende biologiske fænomener: generation af genetisk mangfoldighed under gametogenesis1 og reparation af DNA dobbelt-strenget pauser (DSBs)2 under mitosen. DSBs er den mest alvorlige form for DNA-skader og udgør et brud i kromosom. Forkert reparation af DSBs kan forårsage omfattende kromosomale rearrangementer og genomisk ustabilitet, som er både kendetegnende for kræft3.

DNA streng exchange reaktion er den centrale fase af HR. Rad51 protein, som er medlem af den yderst velbevarede RecA-type familie af recombinases, er det vigtigste protein, der katalyserer denne reaktion i eukaryoter4,5. I denne reaktion, Rad51 binder til enkeltstrenget DNA (ssDNA) genereret af nucleolytic behandling af DSB slutningen og former en spiralformet nucleoprotein komplekse betegnes den præsynaptiske glødetråd. Denne endeløse fangster intakt dobbelt-strenget DNA (dsDNA) nonspecifically til at søge efter en homolog sekvens. Når glødetråden finder en homolog sekvens, en mellemliggende indeholdende tre-strenget DNA reaktion er dannet og Rad51 glødetråden medierer strand udveksling inden for denne struktur6,7,8. For at opnå denne reaktion effektivt, kræver Rad51 flere slags tilbehør proteiner som BRCA1 og BRCA2, produkter af bryst kræft modtagelighed gener9,10.

Forståelse er hvordan tilbehør faktorer regulere Rad51 en integreret skridt i afdække årsagerne til genomisk ustabilitet under tumordannelse. Selv om meget forskning beskæftiger sig med virkningerne af disse faktorer på præsynaptiske glødetrådens dannelse og stabilitet11,12,13,14,15,16, den bidrag af disse faktorer til dannelsen af de tre-strenget mellemliggende og dets forarbejdning til det færdige produkt er stadig uklart. Observere disse reaktion trin gennem konventionelle biokemiske eksperimenter er meget vanskeligt, fordi de tre-strenget mellemliggende er ustabil og udsat for sammenbrud af fælles eksperimentelle manipulationer såsom deproteinization af prøver eller elektroforese.

For at overvinde dette problem har vi tilpasset to tidligere udviklet real-time observationssystemer af DNA streng exchange reaktion ved hjælp af fluorescens resonans energioverførsel (FRET): DNA streng parring og DNA streng forskydning assays17, 18 (figur 1). I DNA streng parring assay, Rad51 former en præsynaptiske glødetråd med fluorescein tilføjes amidite (FAM) - mærket ssDNA og derefter homologe carboxy-x-rodamin (ROX) - mærket dsDNA indlede strand exchange reaktion. Når glødetråden fangster den ROX-mærket dsDNA og danner de tre-strenget mellemliggende, de to fluorophores kommer ind i umiddelbar nærhed og fluorescens emission af FAM er slukket af ROX (figur 1A). I DNA streng forskydning assay inkuberes en præsynaptiske glødetråd dannet på umærkede ssDNA med FAM og ROX dobbelt-mærket dsDNA. Når strand exchange er afsluttet og FAM mærket ssDNA er frigivet fra tre-strenget mellemliggende, skal emissionen af FAM stiger fordi FAM er ikke længere i umiddelbar nærhed af ROX (figur 1B). Disse analyser gør det muligt at observere dannelsen af tre-strenget mellemprodukter og deres behandling i færdigvarerne i realtid uden eventuelle forstyrrelser til reaktionen.

Med denne real-time observationssystem, fandt at DNA streng exchange reaktion medieret af Rad51 forløber i tre trin herunder dannelsen af den første reaktion mellemliggende (C1), overgang af de første mellemliggende i en anden mellemliggende (C2), og frigivelsen af ssDNA fra C219. Vi fandt også denne fission gær (S. pombe) Swi5-Sfr1, som er en evolutionært bevarede Rad51 tilbehør protein kompleks13,16,20,21,22, stimulerer C1-C2 skiftes og frigivelse af ssDNA fra C2 på en måde, der er afhængige af ATP-hydrolyse af Rad5119.

Om disse resultater er evolutionært bevaret forbliver ukendt. Denne protokol er leveret med håbet om, at forskere inden for HR, især dem, der arbejder med proteiner fra organismer end S. pombe, kan anvende disse teknikker for at afgøre, i hvilket omfang den molekylære mekanisme af Rad51-drevet strand exchange er bevaret. Desuden, disse teknikker har vist sig meget vellykket i bestemmelse af S. pombe Swi5-Sfr1 betydning. Det er således en rationel forudsigelse om at disse teknikker vil være uvurderlig i afdække de præcise roller af anden HR tilbehør faktorer.

Protocol

1. forberedelse af proteiner og DNA substrater

  1. Rense S. pombe Rad51 og Swi5-Sfr1 proteiner til ensartethed (bedømt af Coomassie farvning), som tidligere rapporteret13,21.
  2. Forberede oligonukleotid DNA substrater anført i tabel 118.
    Bemærk: Oligonukleotider blev købt (Se Tabel af materialer) og syntetiseret på HPLC renhed. For DNA streng parring reaktion, oligonukleotider 16FA(-), 16A (-) _40bp og 16AR (+) _40bp er påkrævet. For DNA forskydning assay, oligonukleotider 16A(-), 16FA (-) _40bp og 16AR (+) _40bp er påkrævet (figur 1 og tabel 1). Alle DNA koncentrationer i denne protokol henvise til at fragmentere koncentrationer i modsætning til nukleotid koncentrationer.
  3. For at danne donor dsDNA, bland equimolar mængder af supplerende tråde i en tyndvægget PCR rør med optimerende buffer (10 mM Tris-HCl pH 7,5, 100 mM NaCl, 10 mM MgCl2), at sikre et samlet volumen på mere end 20 µL. udføre denne blanding på en prechilled metal rack på is (mellem 2 ° C og 4 ° C).
    Bemærk: Kombinationen af oligonukleotider for parring analysen er 16A (-) _40bp og 16AR (+) _40bp. Til forskydning assay, anneal oligonukleotider 16FA (-) _40bp og 16AR (+) _40bp.
  4. Varme udgloedning blandingen ved 90 ° C i 5 min og køle ned over 3 h til 30 ° C ved hjælp af en PCR-maskine. Butik udglødet DNA ved-20 ° C.

2. DNA streng parring og forskydning Assays

  1. Udføre DNA streng parring assay.
    1. Forberede 1,6 mL reaktion buffer A (30 mM HEPES-KOH pH 7,5, 1 mM dithiothreitol [DTT], 15 mM MgCl2, 0,25 mM ATP, 0,1 mg/mL bovint serumalbumin [BSA] og 0.0075% polyoxyethylenesorbitan monolaurate) indeholdende 36 nM 16FA(-) i en 2,0 mL micro-centrifuge plastikrør (polypropylen) og pre inkuberes ved 37 ° C i 5 min.
    2. Til at danne Rad51-ssDNA filamenter, tilføje Rad51 protein til en endelig koncentration på 1,5 µM i pre rugede reaktion buffer og der inkuberes ved 37 ° C i 5 min.
    3. Tilføje Swi5-Sfr1 protein til blandingen til en endelig koncentration på 0,15 µM og der inkuberes ved 37 ° C i en yderligere 5 min.
    4. Tage 1,5 mL af blandingen og overføre det til en 1,0 x 1,0 cm kvarts kuvette indeholdende en magnetomrører og sætte kuvette i en spectrofluorometer. Konfigurere den peltier temperatur controller spektrofotometrets til 37 ° C og indstille magnetomrøreren 450 omdrejninger til at sikre hurtig blanding af den injicerede prøve.
    5. Kan måle fluorescens emission af FAM på 525 nm (båndbredde: 20 nm) ved excitation på 493 nm (båndbredde: 1 nm). Indsamle data hvert sekund.
    6. Efter start måling for 100 s, injicere ROX-mærket donor dsDNA til en endelig koncentration på 36 nM i blandingen ved hjælp af en sprøjte og måle ændringen i emissioner med 1 s intervaller for en yderligere 30 min.
  2. Udføre DNA streng forskydning assay.
    1. Forberede 1,6 mL reaktion buffer A indeholdende 36 nM 16A(-) i en 2,0 mL micro-centrifuge plast rør og pre inkuberes ved 37 ° C i 5 min.
    2. Udgør Rad51-ssDNA filamenter i nærværelse af Swi5-Sfr1 ved 37 ° C, som beskrevet i trin 2.1.2. og 2.1.3.
    3. Tage 1,5 mL af blandingen og overføre det til kvarts kuvette indeholdende en magnetomrører og sætte kuvette i spektrofotometrets som beskrevet i trin 2.1.4.
    4. Kan måle fluorescens emission og efter 100 s, injicere FAM - og ROX-mærket donor dsDNA som beskrevet i trin 2.1.6. Måle ændringen i fluorescens emission med 1 s intervaller for en yderligere 30 min.

3. analyse af eksperimentelle Data fra bindingen og forskydning Assays

  1. Anslå højst FRET effektivitet.
    1. Forberede 16FA(-) udglødet med 16AR (+) _40bp og 16FA (-) _40bp udglødet med 16AR (+) _40bp ved hjælp af den samme procedure beskrevet i trin 1.3 og 1.4.
    2. Forberede 130 μL reaktion buffer A indeholdende 36 nM af enten 16FA(-), 16FA(-) udglødet med 16AR (+) _40bp, 16FA (-) _40bp udglødet med 16AR (+) _40bp eller 16FA (-) _40bp i en 0,2 x 1,0 cm kvarts kuvette.
    3. Sæt kuvette i spectrofluorometer og inkuberes ved 37 ° C i 5 min.
    4. Måle fluorescens-spektre fra 500 til 600 nm ved excitation på 493 nm.
    5. For at teste effekten af Rad51 på emission af FAM og dæmper af FAM af ROX, føje Rad51 til en endelig koncentration på 1,5 μM til blandingen og inkuberes ved 37 ° C i 5 min.
    6. Måle fluorescens-spektre fra 500 til 600 nm ved excitation på 493 nm.
    7. Beregne højst FRET effektivitet (Emaksimale) ved hjælp af ligningen, der er beskrevet nedenfor:
      Emaksimale = (Fluorescens intensitet på 525 nm af dsDNA mærket med såvel FAM og ROX) / (Fluorescens intensitet på 525 nm af FAM mærket ssDNA)
  2. Analysere forsøgsdata fra forskydning assay.
    1. At konvertere ændringen i fluorescens observeret i forskydning assay til ændring i mængden af slutproduktet, normalisere rå eksperimentelle data indhentet fra denne analyse ved hjælp af ligningen, der er beskrevet nedenfor, hvor F er fluorescens intensitet fra rådata og Fnormaliseret er ændringen i fluorescens beregnes ved følgende ligning.
      Fnormaliseret = ([F dengang x]-[F på tidspunkt 0]) / (([F på tidspunkt 0] / Emaksimale)-[F på tidspunkt 0])
      F på tidspunkt 0 er den gennemsnitlige fluorescens overvåges for de første 5 s efter den døde tid (dvs.den tid, der kræves til at blande efter en injectant føres ind i kuvette).
    2. For at udelukke virkningerne af photobleaching og spontane fordrivelse, subtrahere Fnormaliseret uden protein fra Fnormaliseret prøve at opnå FD, som er ændringen i mængden af slutproduktet i denne analyse.
      FD = [Fnormaliseret prøve] - [Fnormaliseret uden protein]
  3. Analysere forsøgsdata fra parring analysen.
    1. Normalisere rå eksperimentelle data indhentet fra parring analysen ved hjælp af ligningen, der er beskrevet nedenfor, hvor F er fluorescens intensitet fra rådata og Fnormaliseret er ændringen i fluorescens beregnes ved følgende ligning.
      Fnormaliseret = (F dengang x) / (F på tidspunkt 0)
      F på tidspunkt 0 er den gennemsnitlige fluorescens overvåges for de sidste 20 s inden reaktionen ved at indsprøjte dsDNA substrat.
    2. For at konvertere ændring i fluorescens i ændring i mængden af substrat og udelukke virkningerne af photobleaching og spontane parring, normalisere Fnormaliseret af prøven ved hjælp af ligningen, der er beskrevet nedenfor, hvor FP er ændringen i mængden af substrat i denne analyse.
      FP = 1 - (([Fnormaliseret uden protein] - [Fnormaliseret prøve]) / [1-Emaksimale])
    3. For at undersøge reaktion kinetik af udveksling af DNA-strand, udføre ikke-lineære sidste-pladsen regressionsanalyse af parring reaktion ved hjælp af analysis program23 (Se Tabel af materialer).
      1. Forberede en fil i .txt-format indeholder tid kursus data af FP.
      2. Start programmet og indsætte scriptet i den Supplerende kodefil i et vindue i programmet:
      3. Starte ikke-lineære sidste-pladsen regressionsanalyse. Resultaterne af denne analyse vil blive vist i det samme vindue.

Representative Results

For at effektivt analysere forsøgsdata fra parring og fordrivelse assays, er det nødvendigt at definere, hvordan en ændring i fluorescens emission af FAM svarer til en omdannelse af DNA substrater til produkter. For at opnå dette, skal de relevante række fluorescens intensitet bestemmes. Den parring assay, fluorescens emission af 16FA(-), som svarer til ssDNA substratet, sammenlignes med emission af 16FA(-) udglødet med 16AR (+) _40bp, som svarer til de endelige produkter af denne reaktion (figur 2A). Dette svarer til højst FRET effektivitet og dermed den maksimale reduktion i fluorescens intensitet der ville kunne forventes, hvis alle ssDNA substrat blev omdannet til dsDNA produkt. Til forskydning assay, udstødningen af 16FA (-) _40bp udglødet med 16AR (+) _40bp, hvilket svarer til underlaget, sammenlignes med emission af 16FA (-) _40bp, som svarer til det endelige produkt (figur 2B). I dette tilfælde formidler den maksimale stigning i fluorescens intensiteten af FAM et scenario, hvor alle dsDNA substrat omdannes til ssDNA produkt. S. pombe Rad51 påvirkede ikke fluorescens emission af FAM eller dæmper effektivitet af FAM af ROX i begge assays (figur 2). Den højst FRET effektivitet bør igen målt med hver ny forberedelse af oligonukleotider, som det er afhængig af oligonukleotider mærkning effektivitet.

Repræsentative data af DNA streng parring og fordrivelse reaktioner er vist i figur 3. Virkningerne af spontane reaktioner mellem substrat DNAs og photobleaching var små i begge assays, som afsløres af de ubetydelige ændringer i emission af FAM uden Rad51 i forhold til de væsentlige ændringer, set med Rad51 (figur 3A og Figur 3B). Baseret på de data, der er vist i figur 3A eller figur 3B, blev ændringen i fluorescens omdannet til ændringen i mængden af substrat (FP) eller endelige produkt (FD), henholdsvis ved hjælp af de ligninger, der er beskrevet i trin 3.2.2 eller 3.3.2 ( Figur 3 c og figur 3D).

Den parring reaktion blev simuleret med en sekventiel tre-trins reaktion model, bestående af dannelsen af de første tre-strenget mellemliggende (C1), overgang af de første mellemliggende i den anden mellemliggende (C1 til C2), og frigivelsen af ssDNA fra den anden mellemliggende at danne de to produkter (D + E) (figur 3). At teste, om simulering ved hjælp af en sekventiel tre-trins reaktion model passer eksperimentelle data, residualer mellem forsøgsdata af DNA streng parring assay og en teoretisk kurve fremstillet af simuleringen blev beregnet (figur 3F). Derudover var residualer mellem den parring reaktion og en teoretiske kurven genereret ved hjælp af en sekventiel totrins reaktion model også beregnede (figur 3 g). Residualer efter parring reaktionen og to-trins model viser en systematisk afvigelse i den tidlige fase, mens residualer efter parring reaktionen og tre-trins model ikke viser sådan en afvigelse. Dette indikerer, at den tre-trins model er en bedre pasform end to-trins model for simulering af parring reaktion.

For at teste, om tre-trins model er i overensstemmelse med den forskydning reaktion, der registrerer det sent trin i DNA streng exchange, skabt vi en teoretisk kurve af fordrivelse reaktion ved hjælp af de kinetiske parametre fra simulering af bindingen reaktion vist i figur 3 c og sammenlignet det med forsøgsdata forskydning reaktion vist i figur 3D (figur 3 H). Den teoretiske kurven passer forsøgsdata af fordrivelse assay. Fra disse resultater konkludere vi, at simulering ved hjælp af tre-trins modellen er i stand til rimeligt evaluere DNA streng exchange reaktion ved Rad51 mellemkomst.

Repræsentative data af DNA streng parring reaktion der indeholder Rad51 og Swi5-Sfr1-kompleks, en accessary protein af Rad51, er vist i figur 4A. Swi5-Sfr1-kompleks stimuleret kraftigt parring aktiviteten af Rad51. Som blev set i mangel af Swi5-Sfr1, passer den parring reaktion bedre tre-trins model end to-trins model i nærværelse af Swi5-Sfr1 (figur 4B). Gennem simulering af reaktionen ved hjælp af tre-trins model, blev reaktion ligevægt konstanter for hvert reaktion trin med eller uden Swi5-Sfr1 beregnet. Reaktion ligevægt konstanter er angivet Swi5-Sfr1-kompleks ikke stimulerer det første skridt i reaktion (figur 4 c, panel en), hvor en tre-strenget mellemliggende er dannet, men kraftigt stimulerer C1-C2 skiftes ( Figur 4 c, bedømmelseskomite b) og frigivelse af ssDNA fra C2 mellemprodukt (figur 4 c, bedømmelseskomite c).

Figure 1
Figur 1: eksperimenterende design DNA streng parring og fordrivelse assays. Skemaer af DNA streng parring (A) og undersøgelser, deplacement (B). Gule cirkler repræsenterer Rad51 monomerer. Grønne cirkler indeholdende "F" og røde cirkler, der indeholder "R" repræsentere fluorescein amidite (FAM) og carboxy-X-rodamin (ROX), henholdsvis. Sort DNA-strenge er identiske i sekvens og supplerer blå DNA-strenge. Tynde sorte streger med pilespidser pege på navnet på hver oligonukleotid, som afbildet i tabel 1. Dette tal er blevet tilpasset fra Ito et al. 19 og modificeret. Venligst klik her for at se en større version af dette tal.

Figure 2
Figur 2: målinger af højst FRET effektiviteten af parring og fordrivelse assays. (A) sammenligning af fluorescens-spektre mellem ssDNA substrat, 16FA(-) og dsDNA produkt, 16FA(-) parret med 16AR (+) _40bp af parring analysen. Blå og røde linjer repræsenterer fluorescens-spektre af substrat uden og med Rad51, henholdsvis. Grøn og lilla linjer viser fluorescens-spektre af det endelige produkt uden og med Rad51, henholdsvis. (B) sammenligning af fluorescens-spektre mellem dsDNA substrat, 16FA (-) _40bp parret med 16AR (+) _40bp og ssDNA produkt, 16FA (-) _40bp, deplacement assay. Blå og røde linjer repræsenterer fluorescens-spektre af det endelige produkt uden og med Rad51, henholdsvis. Grøn og lilla linjer viser fluorescens-spektre af substrat uden og med Rad51, henholdsvis. Dette tal er tilpasset fra Ito et al. 19 og modificeret. Venligst klik her for at se en større version af dette tal.

Figure 3
Figur 3: DNA streng parring og fordrivelse reaktioner medieret af Rad51. (A) tidsforløb af de normaliserede fluorescens parring reaktion med eller uden Rad51. (B) tidsforløb af de normaliserede fluorescens af fordrivelse reaktion med eller uden Rad51. (C) Tidsforløb for ændring i mængden af substrat i parring reaktionen med Rad51. (D) gang løbet af ændring i mængden af substrat i forskydning reaktionen med Rad51. (E) A skematisk af den sekventielle tre-trins reaktion model. A og B svarer til den præsynaptiske glødetråd og donor dsDNA. C1 svarer til den første (umodne) tre-strenget mellemprodukt. C2 svarer til den anden (modne) tre-strenget mellemprodukt. D og E svarer til en heteroduplex og ssDNA frigives fra C2. (F og G) residualer mellem forsøgsdata af DNA streng parring assay og en teoretisk kurve fremstillet ved simulering ved hjælp af enten tre-trins (F) eller to-trins (G) model. (H) røde prikker angiver forsøgsdata fra forskydning reaktion med Rad51 vist i panelet D. blå linje angiver den teoretiske kurven af de endelige produkter. Den teoretiske kurven blev genereret af simulering ved hjælp af reaktion hastighed konstanter fremstillet af parring analysen vist i panelet C. Dette tal er tilpasset fra Ito et al. 19 og modificeret. Venligst klik her for at se en større version af dette tal.

Figure 4
Figur 4: Swi5-Sfr1 stimulerer andet og tredje trin af DNA streng exchange reaktion. (A) tid løbet af ændring i mængden af substrat i parring reaktion med eller uden Swi5-Sfr1 (S5S1). (B) restprodukter mellem forsøgsdata DNA streng parring assay med Swi5-Sfr1 og en teoretisk kurve fremstillet ved simulering ved hjælp af to-trins (blå linje) eller tre-trins (rød linje) model. (C) den parring reaktion vist i figur 4A blev simuleret af den tre-trins model ved hjælp af analysis program23 (Se Tabel af materialer). Reaktion ligevægt konstanter for hvert reaktion trin, K1 (en), K2 (b), og K3 (c), blev fremstillet af simuleringen. Dette tal er tilpasset fra Ito et al. 19 og modificeret. Venligst klik her for at se en større version af dette tal.

Oligonukleotider for DNA streng parring assay
16FA(-) 5'-[FAM] - AAATGAACATAAAGTAAATAAGTATAAGGATAATACA
AAATAAGTAAATGAATAAACATAGAAAATAAAGTAAAGGATAT AAA -3 '
16a (-) _40bp 5'-AAATGAACATAAAGTAAATAAGTATAAGGATAATACAAAA-3'
16AR (+) _40bp 5 '- TTTTGTATTATCCTTATACTTATTTACTTTATGTTCATTT-[ROX] -3'
Oligonukleotider for DNA streng forskydning assay
16A(-) 5'-AAATGAACATAAAGTAAATAAGTATAAGGATAATACAAAATA
AGTAAATGAATAAACATAGAAAATAAAGTAAAGGATAT AAA -3 '
16FA (-) _40bp 5'-[FAM] - AAATGAACATAAAGTAAATAAGTATAAGGATAATACAAAA-3'
16AR (+) _40bp 5 '- TTTTGTATTATCCTTATACTTATTTACTTTATGTTCATTT-[ROX] -3'

Tabel 1: en liste over oligonukleotider bruges i DNA streng parring og fordrivelse assays. I givet fald holdninger af fluorophores (fluorescein amidite, FAM, carboxy-x-rhodaminfilteret, ROX) er angivet i firkantede parenteser.

Discussion

Her har vi beskrevet en detaljeret protokol, der udnytter FRET for at måle Rad51-drevet DNA streng exchange i realtid. Vigtigere, tillade disse målinger til bestemmelse af reaktion kinetik. Mens beskrivelserne angivet ovenfor er tilstrækkelige til at genskabe vores offentliggjorte resultater, er der flere kritiske punkter, der vil blive beskrevet i dette afsnit. Desuden, fordele og ulemper af FRET-baserede metoder til at studere DNA streng udveksling vil blive drøftet, samt anvendelse af sådanne teknikker til at studere andre aspekter af DNA stofskifte.

Som med alle biokemiske reconstitutions, er sikrer, at alle reaktion substrater af høj renhed afgørende. Det er uagtsom at antage mangel af forurenende aktiviteter baseret udelukkende på den tilsyneladende renhed af en protein forberedelse bedømt af Coomassie farvning. Især kan tilstedeværelsen af spormængder af nukleaser eller helicases drastisk påvirke resultaterne af parring og fordrivelse assays. Dermed, vi vil stærkt opfordre testning for sådanne aktiviteter hver gang et nyt parti af protein er renset. Derudover er det klogt at tjekke renheden af syntetiseret DNA substrater af indfødte polyacrylamid gelelektroforese. Trods mange virksomheder sikrer renheden af oligonukleotider, har vi ofte fundet gennem vores egen testning, renheden af syntetiseret DNA kan variere mellem partier.

Det er vigtigt at overveje følgende to punkter, når der udføres eksperimenter med kvarts kuvetter. For det første, nogle proteiner er tilbøjelige til at binde kvarts kuvetter nonspecifically. For at imødegå dette, BSA og polyoxyethylenesorbitan monolaurate er inkluderet i reaktion buffere. For det andet, temperatur har en drastisk effekt på reaktion hastighed og fluorescens intensitet. For at minimere denne effekt, bør kvarts kuvette præ inkuberes ved 37 ° C før brug.

Selv om konventionelle biokemiske analyser har været enormt nyttigt i at studere DNA streng udveksling, har de flere ulemper. I et typisk tidsforløb eksperiment, en reaktion er inkuberes ved en bestemt temperatur og delprøver er trukket tilbage på ønskede timepoints og proteinfrit ved behandling med rengøringsmiddel og protease at opsige reaktionen. Ved afslutningen af tidsforløb udsættes prøver derefter for elektroforese at adskille DNA substrater fra produkter. Den største fordel ved metoden beskrevet her er, at det giver mulighed for real-time observation af reaktion uden forstyrrelser. Ethvert tidspunkt under reaktionen kan kontrolleres uden afbrydelse af reaktionen, sig selv og der er ingen grund til deproteinize prøver eller udsætte dem for de potentielt forstyrrende kræfter af elektroforese. Dette er især relevant, når overvågning labile DNA strukturer.

Trods disse styrker over konventionelle assays har metoden beskrevet her nogle ulemper. Mens brugen af oligonukleotid DNA substrater til strand exchange forenkler fortolkning af resultaterne, er det vigtigt at huske, at sådanne substrater ikke ligner DNA substrater involveret i HR i cellen. Nogle konventionelle assays udnytte plasmid mellemstore DNA substrater, som er mere tilbøjelige til at afspejle antallet basepar, der er udvekslet in vivo. Derudover kan brugen af topologisk begrænsede cirkulære dsDNA substrater i en delmængde af konventionelle assays i det mindste delvist genskabe spændinger i fysiologiske DNA.

Anvendelsen af metoden beskrevet her er begyndt at trævle de molekylære mekanismer til Rad51-drevet DNA strand udveksling. Der er dog mange interessante spørgsmål, der mangler at blive besvaret. Der er klare beviser for at HR under meiose kræver både Rad51 og Dmc1, meiose-specifikke RecA-type recombinase i eukaryoter24. Men manglen på væsentlige biokemiske forskelle mellem disse to recombinases har forvirret forskere i feltet i år. Derudover roller af mange forskellige grupper af rekombination tilbehør faktorer har været et omdrejningspunkt emne af forskning inden for HR. Ud over at belyse biokemiske forskellene mellem Rad51 og Dmc1, vi sigter mod at undersøge og sammenligne effekter af forskellige rekombination tilbehør faktorer på kinetik af DNA streng udveksling i den nærmeste fremtid. Endelig er det vigtigt at understrege, at de FRET-baseret metode beskrevet her ikke er begrænset til undersøgelse af DNA streng exchange. Med relativt mindre ændringer forestiller vi mange former for ansøgninger om denne teknik i efterforskningen af funktionelt mangfoldigt proteiner involveret i DNA stofskifte25,26,27,28. Vi håber, at den udvikling, der er beskrevet her vil give yderligere muligheder for forskere, tilhører mange forskellige discipliner.

Disclosures

Forfatterne har ikke noget at oplyse.

Acknowledgments

Dette arbejde blev finansieret af Grants-in-Aid for videnskabelig forskning (a 18H 03985) og på Innovative områder (15H 05974) til HI, for unge forskere (B) (17K 15061) til BA, og for videnskabelig forskning (B) (18H 02371) til HT fra Japan-samfund til fremme af videnskab ( JSP'ER).

Materials

Name Company Catalog Number Comments
0.2 x 1.0 cm quartz cuvette Hellma Analytics 105-250-15-40
1.0 x 1.0 cm quartz cuvette Hellma Analytics 101-10-40
adenosine triphosphate (ATP) Sigma A2383
DynaFit BioKin, Ldt. DynaFit is a program to analyze kinetics of biochemical reactions.
Fluorescent labeled and non-labeled oligonucleotides Eurofins Genomics The sequences of oligos are listed in Table. 1.
Magnetic stirrer Aisis (Japan) CM1609
PCR machine TAKARA (Japan) TP600 TAKARA PCR Thermal Cycler Dice
Spectrofluorometer JASCO FP8300 Contains a peltier temperature controller and magnetic stirrer system
Syringe HAMILTON 1702RN 25ul SYR (22s/2"/2)

DOWNLOAD MATERIALS LIST

References

  1. Camerini-Otero, R. D., Hsieh, P. Homologous recombination proteins in prokaryotes and eukaryotes. Annual Review of Genetics. 29, (1), 509-552 (1995).
  2. Cromie, G. A., Connelly, J. C., Leach, D. R. Recombination at double-strand breaks and DNA ends: conserved mechanisms from phage to humans. Molecular Cell. 8, (6), 1163-1174 (2001).
  3. Pierce, A. J., et al. Double-strand breaks and tumorigenesis. Trends in cell biology. 11, (11), S52-S59 (2001).
  4. Haber, J. E. Genome Stability. Garland Science. (2013).
  5. Kowalczykowski, S. C. An Overview of the Molecular Mechanisms of Recombinational DNA Repair. Cold Spring Harbor perspectives in biology. 7, (11), a016410 (2015).
  6. Bianco, P. R., Tracy, R. B., Kowalczykowski, S. C. DNA strand exchange proteins: a biochemical and physical comparison. Frontiers in bioscience: a journal and virtual library. 3, D570-D603 (1998).
  7. Renkawitz, J., Lademann, C. A., Jentsch, S. Mechanisms and principles of homology search during recombination. Nature Reviews Molecular Cell Biology. 15, (6), 369-383 (2014).
  8. Greene, E. C. DNA Sequence Alignment during Homologous Recombination. The Journal of biological chemistry. 291, (22), 11572-11580 (2016).
  9. Sung, P., Krejci, L., Van Komen, S., Sehorn, M. G. Rad51 recombinase and recombination mediators. Journal of Biological Chemistry. 278, (44), 42729-42732 (2003).
  10. Prakash, R., Zhang, Y., Feng, W., Jasin, M. Homologous recombination and human health: the roles of BRCA1, BRCA2, and associated proteins. Cold Spring Harbor perspectives in biology. 7, (4), a016600 (2015).
  11. Sung, P. Function of yeast Rad52 protein as a mediator between replication protein A and the Rad51 recombinase. Journal of Biological Chemistry. 272, (45), 28194-28197 (1997).
  12. Sung, P. Yeast Rad55 and Rad57 proteins form a heterodimer that functions with replication protein A to promote DNA strand exchange by Rad51 recombinase. Genes & Development. 11, (9), 1111-1121 (1997).
  13. Kurokawa, Y., Murayama, Y., Haruta-Takahashi, N., Urabe, I., Iwasaki, H. Reconstitution of DNA strand exchange mediated by Rhp51 recombinase and two mediators. PLoS biology. 6, (4), e88 (2008).
  14. Jensen, R. B., Carreira, A., Kowalczykowski, S. C. Purified human BRCA2 stimulates RAD51-mediated recombination. Nature. 467, (7316), 678-683 (2010).
  15. Liu, J., et al. Rad51 paralogues Rad55-Rad57 balance the antirecombinase Srs2 in Rad51 filament formation. Nature. 479, (7372), 245-248 (2011).
  16. Lu, C. -H., et al. Swi5-Sfr1 stimulates Rad51 recombinase filament assembly by modulating Rad51 dissociation. Proceedings of the National Academy of Sciences of the United States of America. (2018).
  17. Bazemore, L. R., Takahashi, M., Radding, C. M. Kinetic analysis of pairing and strand exchange catalyzed by RecA. Detection by fluorescence energy transfer. Journal of Biological Chemistry. 272, (23), 14672-14682 (1997).
  18. Gupta, R. C., Bazemore, L. R., Golub, E. I., Radding, C. M. Activities of human recombination protein Rad51. Proceedings of the National Academy of Sciences. 94, (2), 463-468 (1997).
  19. Ito, K., Murayama, Y., Takahashi, M., Iwasaki, H. Two three-strand intermediates are processed during Rad51-driven DNA strand exchange. Nature Structural & Molecular Biology. 25, (1), 29-36 (2018).
  20. Akamatsu, Y., Dziadkowiec, D., Ikeguchi, M., Shinagawa, H., Iwasaki, H. Two different Swi5-containing protein complexes are involved in mating-type switching and recombination repair in fission yeast. Proceedings of the National Academy of Sciences. 100, (26), 15770-15775 (2003).
  21. Haruta, N., et al. The Swi5-Sfr1 complex stimulates Rhp51/Rad51- and Dmc1-mediated DNA strand exchange in vitro. Nature Structural & Molecular Biology. 13, (9), 823-830 (2006).
  22. Argunhan, B., Murayama, Y., Iwasaki, H. The differentiated and conserved roles of Swi5-Sfr1 in homologous recombination. FEBS Letters. 591, (14), 2035-2047 (2017).
  23. Kuzmic, P. Program DYNAFIT for the analysis of enzyme kinetic data: application to HIV proteinase. Analytical biochemistry. 237, (2), 260-273 (1996).
  24. Brown, M. S., Bishop, D. K. DNA strand exchange and RecA homologs in meiosis. Cold Spring Harbor perspectives in biology. 7, (1), a016659 (2014).
  25. Rudert, W. A., et al. Double-labeled fluorescent probes for 5' nuclease assays: purification and performance evaluation. BioTechniques. 22, (6), 1140-1145 (1997).
  26. Xiao, J., Singleton, S. F. Elucidating a key intermediate in homologous DNA strand exchange: structural characterization of the RecA-triple-stranded DNA complex using fluorescence resonance energy transfer. Journal of Molecular Biology. 320, (3), 529-558 (2002).
  27. Grimme, J. M., et al. Human Rad52 binds and wraps single-stranded DNA and mediates annealing via two hRad52-ssDNA complexes. Nucleic Acids Research. 38, (9), 2917-2930 (2010).
  28. Algasaier, S. I., et al. DNA and Protein Requirements for Substrate Conformational Changes Necessary for Human Flap Endonuclease-1-catalyzed Reaction. The Journal of biological chemistry. 291, (15), 8258-8268 (2016).
Real-time overvågning af DNA streng Exchange reaktion medieret af Rad51
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Ito, K., Argunhan, B., Tsubouchi, H., Iwasaki, H. Real-time Observation of the DNA Strand Exchange Reaction Mediated by Rad51. J. Vis. Exp. (144), e59073, doi:10.3791/59073 (2019).More

Ito, K., Argunhan, B., Tsubouchi, H., Iwasaki, H. Real-time Observation of the DNA Strand Exchange Reaction Mediated by Rad51. J. Vis. Exp. (144), e59073, doi:10.3791/59073 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter