Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

מניפולציה של פונקציית ג'ין Cavefish מקסיקני

doi: 10.3791/59093 Published: April 22, 2019

Summary

אנו מתארים גישות על המניפולציה של גנים במערכת המודל האבולוציוני Astyanax mexicanus. שלוש טכניקות שונות מתוארים: בתיווך Tol2 transgenesis, יישוב מניפולציה של הגנום באמצעות CRISPR/Cas9, ואת נוקאאוט של הביטוי תוך שימוש morpholinos. כלים אלה צריך לאפשר חקירה ישירה של גנים שבבסיס וריאציית בין פני השטח - ואת מערת המגורים טפסים.

Abstract

מערת חיות מספקים מערכת משכנעת על חקירת מנגנונים אבולוציונים ובסיסים הגנטי שבבסיס לשינויים רבים תכונות מורכבות, לרבות ניוון העין, לבקנות, אובדן שינה, hyperphagia, והעיבוד החושי. מינים של cavefish מ ברחבי העולם להציג של אבולוציה מתכנסת של מאפיינים מורפולוגיים והתנהגותיים עקב לחצים סביבתיים משותפים בין מערכות שונות מערה. מערת מגוונת מיני נחקרו בהגדרת מעבדה. טטרה מקסיקנית, Astyanax mexicanus, עם צורות רואי ועיוורת, סיפקה ייחודי תובנות ותהליכי הביולוגי המולקולרי שבבסיס האבולוציה של תכונות מורכבות, שאיזו היטב כמערכת מודל המתעוררים. בעוד גנים המועמד ויסות ההתפתחות של תהליכים ביולוגיים שונים זוהו mexicanus א, היכולת לאמת תפקיד עבור גנים יחידניים הוגבלה. היישום של transgenesis וטכנולוגיה לעריכת ג'ין יש פוטנציאל כדי להתגבר על מכשול משמעותי הזה וכדי לחקור את המנגנונים האבולוציה של תכונות מורכבות. כאן, אנו מתארים מתודולוגיה שונים מניפולציות ביטוי גנים ב- mexicanus א. גישות כוללים את השימוש morpholinos, Tol2 transgenesis, מערכות עריכה-ג'ין, בדרך כלל בשימוש דג זברה ודגים אחרים מודלים, לתמרן פונקצית ג'ין mexicanus א. פרוטוקולים אלה כוללים תיאורים מפורטים של תהליכי הרבייה מתוזמן, איסוף הביצים, זריקות, הבחירה של בעלי חיים מהונדסים. אלה גישות מתודולוגיים יאפשר לחקירת גנטי והעצבים המנגנונים האבולוציה של תכונות מגוונות ב- mexicanus א.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

מאז מוצא המיניםשל דרווין1, מדענים זכו תובנות עמוקות כמה תכונות הם בצורת אבולוציונית בתגובה מוגדר לחצים סביבתית ואקולוגית, בזכות מערת אורגניזמים2. טטרה מקסיקנית, mexicanus א, מורכב של אוכלוסיות 'משטח' אב קדמון eyed המאכלסים נהרות ברחבי מקסיקו בדרום טקסס ושל אוכלוסיות מבודדת מבחינה גיאוגרפית לפחות 29 של מערת נגזר morphs המאכלסים את אברה דל סיירה, באזורים אחרים של צפון-מזרח מקסיקו3. מספר תכונות הקשורות מערת זוהו mexicanus א, כולל צריכת החמצן מסולף, depigmentation, אובדן של העיניים, ושינינו האכלה, שיחור מזון התנהגות4,5,6, 7,8,9. מתנות mexicanus א במודל רב עוצמה עבור חוקרים מנגנונים של אבולוציה מתכנסת היסטוריה אבולוציונית מוגדרים היטב, אפיון מפורט של הסביבה האקולוגית וכתוצאה הנוכחות באופן עצמאי התפתחו המערה אוכלוסיות10,11. רבים מן התכונות הנגזרות למערה נמצאים ב- cavefish, כולל אובדן עינו, לישון אובדן, גדל האכלה, אובדן של בתי הספר, להפחית תוקפנות, ו מופחתת תגובות הלחץ, התפתחו מספר פעמים דרך מקורות עצמאיים, לעיתים קרובות ניצול מסלולים גנטיים שונים בין מערות8,12,13,14,15. זה חוזר על עצמו האבולוציה הוא היבט רב עוצמה של מערכת mexicanus א , מספקים תובנה השאלה כללית יותר של מערכות איך גנטי עשוי להיות מוטרד כדי להפיק דומה פנוטיפים.

בעת היישום של טכנולוגיה גנטיים מכניסטית חקירת פונקציה ג'ין הגביל ב מיני דגים רבים (כולל mexicanus א), התפתחויות אחרונות דג זברה לספק בסיס לפיתוח טכנולוגיה גנטיות דגים 16,17,18,19,20. כלים רבים נמצאים בשימוש נרחב דג זברה לתמרן ביטוי גנים, היישום של נהלים אלה זמן סטנדרטית. לדוגמה, ההזרקה של מורפולינו oligos (MOs) בשלב תא בודד באופן סלקטיבי חוסם RNA ומונעת תרגום עבור חלון זמן קצר במהלך פיתוח21,22. בנוסף, עריכת ג'ין גישות, כגון מקובצים באופן קבוע interspaced חזרה palindromic קצר (CRISPR) / CRISPR-הקשורים חלבון 9 (Cas9) ותמלול activator דמוי אפקטור נוקלאז (TALEN), לאפשר לדור של מחיקות מוגדר או, במקרים מסוימים, הוספות דרך רקומבינציה הגנום19,20,23,24. Transgenesis משמש כדי לתפעל ביטוי גנים יציב או הפונקציה באופן ספציפי סוג התא. מערכת Tol2 משמש ביעילות כדי ליצור חיות הטרנסגניים מאת coinjecting transposase mRNA עם פלסמיד ה-DNA Tol2 המכילה25,transgene26. מערכת Tol2 מנצל את transposase Tol2 של medaka כדי להפיק germline יציב הוספות של construct17 הטרנסגניים. יצירת Tol2 transgenics כרוך coinjecting של פלסמיד המכיל transgene ולצדו Tol2 ואתרי אינטגרציה mRNA Tol2 transposase17. מערכת זו שימש לייצר מגוון של קווים הטרנסגניים דג זברה ואת השימוש בה התרחב לאחרונה מערכות מודל מתהווים נוספים, כולל cichlids, דגים גמבוזיים, את stickleback, ו, לאחרונה, cavefish מקסיקני27, 28,29,30.

ואילו cavefish היא מערכת ביולוגית מרתק שחקרתי מנגנוני האבולוציה תכונה, יכולת מלאה שלה כמודל אבולוציונית לא היה מלא רתם. זה כבר חלקית בשל חוסר יכולת לתמרן גנטי, הסלולר יפעלו ישירות31. גנים המועמד ויסות תכונות מורכבות זוהו באמצעות תכונה כמותית אתרים כמותיים מחקרים, אך האימות של גנים אלו המועמד היה קשה32,33,34. לאחרונה, נוקאאוט ארעי באמצעות morpholinos, ג'ין עריכה באמצעות מערכות CRISPR ו- TALEN, ואת השימוש Tol2-transgenesis בתיווך שימשו כדי לחקור את הבסיס הגנטי שבבסיס מספר תכונות35,36,37 ,38. יישום והטמעה סטנדרטיזציה של טכניקות אלה יאפשר מניפולציות זה לחקור את הפסיכולוגי עצבית המולקולריים של תכונות ביולוגיות, כולל המניפולציה של תפקוד הגן, תיוג של אוכלוסיות תאים מוגדרים, ו הביטוי של עיתונאים פונקציונלי. ואילו יישום מוצלח של כלים גנטיים אלה לתמרן גן או תפקוד התאים הוכח במערכות דגם מתהווה, פרוטוקולים מפורט עדיין חסרים mexicanus א.

Mexicanus א לספק תובנות מנגנוני האבולוציה בתגובה לסביבה המשתנה הקריטי ולהציג את ההזדמנות כדי לזהות גנים הרומן ויסות תכונות מגוונות. מספר גורמים מראים כי mexicanus א הוא מודל מאוד צייתן להחלת הוקמה גנומית כלי זמין כרגע ויצר מודלים גנטי, כולל את היכולת בקלות לשמור על הדגים במעבדות, גודל שבוחרים גדול, שקיפות, הגנום ברצף וכן מבחני התנהגות מוגדרים39. כאן, אנו מתארים מתודולוגיה לשימוש של morpholinos, transgenesis, ג'ין ועריכה של אוכלוסיית השטח ומערת של mexicanus א. היישום רחבה יותר של כלים אלה ב- mexicanus א יאפשר חקירה מכניסטית התהליכים המולקולרי שבבסיס האבולוציה של הבדלים התפתחותיים, פיזיולוגיים והתנהגותיים בין cavefish לבין משטח דגים.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. מורפולינו oligo עיצוב

הערה: רצפי mexicanus א זמינים דרך המרכז הלאומי של מידע ביוטכנולוגיה (NCBI) ג'ין NCBI ההזמנות (https://www.ncbi.nlm.nih.gov), כמו גם מהדפדפן הגנום Ensembl (https://www.ensembl.org). בעת עיצוב של מורפולינו לשימוש בשתי צורות השטח - ואת מערת המגורים, חיוני כדי לזהות כל וריאציה גנטית בין morphs בשלב זה, כך ניתן להימנע אלה אזורים גנטיים כמו מטרות עבור morpholinos. כל וריאציה רב-צורתיות בתוך אתר המטרה מורפולינו יכול להוביל איגוד לא יעיל. העיצוב דומה מערכות דגים אחרים, כגון דג זברה, ולאחר שהוצג בעבר לעבוד ביעילות תוך36,21, mexicanus א40.

  1. העיצוב של חסימת-תרגום morpholinos
    הערה: חסימת-תרגום morpholinos לחסום את התרגום על-ידי איגוד לאתר התחלה אנדוגני, לעכב translational מכונות מ מחייב את רצף ה-mRNA דרך הסטריים hinderance.
    1. זיהוי האזור קידוד של הגן היעד החל האתר התחלה ATG.
    2. להקליט זוגות בסיס ראשון 25 של הרצף היעד על-ידי העתקה והדבקה הרצף במחברת עורך או מעבדה טקסט.
    3. באמצעות תוכנה באינטרנט (למשל, http://reverse-complement.com) או תרגום ידנית, ליצור המשלים הפוכה של הרצף היעד. לשמור את המשלים הפוכה וכתוצאה מכך עורך טקסט או מחברת מעבדה.
    4. להזמין את מורפולינו עם הרצף המשלים הפוכה מחברה שיוצר מורפולינו oligonucleotides. ראה טבלה של חומרים עבור חברות.
  2. העיצוב של חסימה אחוי morpholinos
    הערה: חסימה אחוי morpholinos לחסום שחבור, ובכך, למנוע היווצרות של מולקולה mRNA בוגר. זה מספק שיטה חלופית נוקאאוט כאשר האתרים התחלה אינם מוגדרים היטב, או גישה אופטימלית יותר בעת אימות של נוקאאוט באמצעות תגובת שרשרת פולימראזית (PCR) היא הרצויה. זה היתרון של חסימה אחוי morpholinos (מעל חסימת-ATG MOs) היא כי הדרה אקסון או הכללה אינטרון יכול להידרש בקלות עם רוורס טרנסקריפטאז (RT)-PCR, גודל ההבדלים דמיינו על ג'ל. RT-PCR וג'ל אלקטרופורזה כדי לקבוע יעילות מורפולינו צריך להיעשות באמצעות הליכים מעבדה סטנדרטיים.
    1. לזהות את רצף ה-pre-mRNA של הגן היעד. לנצל את המידע הזמין מן הגנום mexicanus א דרך NCBI או Ensembl כדי לקבוע גבולות אקסון-אינטרון33.
    2. יעד אקסון-אינטרון (splice התורם) או אקסון-אינטרון אתרים גבול (splice מקבל) עבור אינטרון הכללה או אקסון הרחקה.
      הערה: ספלייסוזום בדרך כלל מטרות רצף "גו" (U1 יעד) את אינטרון באתר splice 5', רצף AG" "-3' (U2) אחוי intronic אתר היעד. בתנאים רגילים, ספלייסוזום U1 ו- U2 subunits לאגד באתרים אלה יעד על הרצף pre-mRNA של שחבור ראוי להופיע. עם זאת, אם משני רצפי המטרה אלה חסומה על-ידי מורפולינו, ספלייסוזום מעביר לאתר הבא זמין U1 או U2, גורם אינטרון הדרה או אקסון ברצף ה-mRNA. זה יכלול תכנון/אופטימיזציה, בהתאם לאופי הגן מטרה21. באופן כללי, חסימת אתר U1 פנימי הפניות את splice לאתר הבא זמין U1, גורם כריתה אקסון. לחלופין, חסימת צומת splice הראשון או האחרון גורם של הכללה אינטרון כי אין אתר כדי לנתב מחדש את splice כדי. השתמש בתוכנת רצף לחזות את השפעת החרגות שונות נגד הכללות. תחזיות יכול להצביע על פוטנציאל frameshifts או עצירה מוקדמת codons, המציין את אתר יעד יעיל יותר להפרעה mRNA.
    3. ברגע אתר היעד מזוהה, להקליט רצף שלו ב- text book editor או lab. ודא אתר היעד 25 בסיס זוגות (bp) ארוך.
    4. באמצעות תוכנה באינטרנט (למשל, http://reverse-complement.com) או תרגום ידנית, ליצור המשלים הפוכה של הרצף היעד. להקליט רצף שלו ב- text book editor או lab.
    5. להזמין את מורפולינו עם הרצף המשלים הפוכה מחברה שיוצר מורפולינו oligonucleotides. ראה טבלה של חומרים דוגמת חברות.

2. Morpholinos להזרקה

הערה: מספר ריכוזים או אמצעי אחסון של הזרקת מו תצטרך להתבצע כדי לקבוע ריכוז אופטימלי להזריק. זריקות טיפוסי הכמויות נמוכות עמ' 400-800 של מו ההשפעה של נוקאאוט מורפולינו יכול להימשך עד 6 ימים postinjection.

  1. לקבל את המניות מורפולינו. מורפולינו מניות מגיע lyophilized. מימה זה עם סטרילי H2O לפני השימוש בריכוז המניות הרצוי (למשל, 4 מ מ). לאחסן ב- 20 °C עד השימוש.

3. CRISPR gRNA, תמלול במבחנה, ועיצוב הכנה

  1. CRISPR gRNA עיצוב
    הערה: gRNAs נוצרו באמצעות מחקר שפורסם בעבר על-ידי Varshney et al.40 ו- Wierson et al.41.
    1. באמצעות דפדפן הגנום, לזהות את האזור קידוד של הגן עניין. באמצעות את רצף גנומית, לזהות את רצף המטרה gRNA בתוך אקסון על-ידי חיפוש 20 bp נוקלאוטיד היעד רצף התחלה עם GG ואחריו רצף פאם (הגולה). אזור הגן אחרי ההתחלה (ATG) יהיה ממוקד.
      הערה: אם לא ניתן למצוא רצף המטרה עם GG בקצה 5' ב אקסון הרצוי של הגן, אחד או שני של הג's. הרבה מכדי הראשון והשני נוקלאוטידים בקצה 5' של הרצף. עם זאת, 2 ג'י's מעוגנת ב oligo, כמו אלה נדרשים עבור שעתוק T7.
    2. לעצב ולהזמין oligonucleotide של גנים ספציפיים (oligo ת 5'-TAATACGACTCACTATAGGNNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGAAATAGC-3... "). להוסיף את הגן הספציפי 20 bp gRNA היעד רצף (מודגש) ללא הרצף פאם בין רצף יזם T7 (אדום) רצף חפיפה נהגה anneal ל oligonucleotide השני (כחול). Anneal ומגבירים (ראה שלב 3.2.1) זה oligo A ו- oligo השני (oligo ב': 5'-GATCCGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTT AACTTGCTATTTCTAGCTCTAAAAC-3') כדי ליצור את תבנית gRNA המשמש שעתוק.
      הערה: Oligo B זהה עבור כל תגובה, צריך רק להיות הורה 1 x.
  2. תמלול והכנה gRNA
    1. Anneal ומגבירים את oligos. כוללים את תחל הבאה כדי להגביר את gRNA על מנת להגביר את התשואה: 5'-TAATACGACTCACTATA-3' (פריימר T7) ו- 5'-GATCCGCACCGACTCGGTG-3' (3' gRNA פריימר). ביצוע של PCR באמצעות פולימראז Thermococcus kodakaraensis (KOD).
      הערה: עבור שני תחל ב- oligo A ו- oligo B 10 מחזורים מומלצת עבור תשואה טובה. פרוטוקול מפורט ניתן למצוא Wierson et al.41.
    2. לתמלל את gRNA באמצעות ערכות זמינים מסחרית שעתוק במבחנה (ראה טבלה של חומרים). זה נעשה באמצעות שינויים היצרן'פרוטוקול s שפורסמו על-ידי Klaassen et al.42.
    3. לזרז, לשטוף, resuspend את gRNA כפי שתואר על ידי Klaassen et al.42.
      הערה: עליך resuspended את gRNA במים נטולי RNase כדי למנוע השפלה.
    4. להקליט את הריכוז של gRNA, אשר יכול להיקבע באמצעות ספקטרופוטומטרים. להעריך את איכות הרנ א על ידי פועל 2 µL ג'ל agarose. RNA aliquot כדי להימנע ההקפאה/ההפשרה ואחסן אותו ב- 80 °C עד מיד לפני הזריקות.
  3. תמלול והכנה Cas9
    1. Cas9 mRNA יש לשעתק באמצעות ערכות זמינים מסחרית שעתוק במבחנה (ראה טבלה של חומרים) כפי שתואר לעיל43. השתמש את הגירסה של nls-Cas9-nls43.
    2. להקליט את ריכוז gRNA, להעריך את איכותם על-ידי פועל 2 µL ג'ל agarose. RNA aliquot כדי למנוע ריקבון מתעוררת דרך מספר מחזורים ההקפאה-הפשרה, ומאחסנים את aliquots ב-80 מעלותצלזיוס.

4. הכנת מבנים Tol2, Tol2 transposase, transgenesis

  1. היכונו Tol2 transgene בונה הזרקה.
    הערה: אנחנו בהצלחה מסויימת דג זברה לאור/זמינים ובונה medaka ב mexicanus א. מבנים אלה פועלים באופן תקין ב- mexicanus א, ככל הנראה בשל רמה גבוהה של רצף הומולוגיה (עיין המאגר AddGene ומסדי נתונים ברשת מידע דג זברה [ZFIN] עבור מבנים זמינים). השברים יזם דג זברה הביעו את transgenes ברקמות הצפוי בעת שימוש ב- א mexicanus.
    1. Tol2 בונה או ליצור פלסמיד עם מקדם רקמות ספציפיות, transgene הרצוי והזרועות Tol2 (ראה קוואן ואח44). עם קבלת, רצף הבונה כדי לאמת את פלסמיד.
    2. ביצוע של midiprep עבור מבנים על פי היצרן's הנחיות. Elute את פלסמיד הסופי ללא RNase H2O, לקבוע הריכוז עם ספקטרופוטומטרים, לדלל את ריכוז עד 100300 ng /μL, ואת aliquot החנות המבנה ב-20 °C.
  2. לעכל Tol2 transposase פלסמיד, לסנתז mRNA.
    1. להשיג עותק של פלסמיד transposase Tol2 (מחשבים-zT2TP) כתבנית ליצירת Tol2 mRNA45.
    2. Midiprep המחשבים-zT2TP לבנות על פי היצרן's הנחיות. Elute זה באמצעי אחסון נמוכה של מים נטולי RNase או מאגר (~ 50 μL). לאחסן את aliquots ב-20 °C.
    3. לעכל את פלסמיד Tol2 שימוש באנזים הגבלה.
      1. מבצע תקציר הגבלת 10 µg של מחשבים אישיים מעגלית-zT2TP פלסמיד באמצעות טבלה 1.
      2. לפצל את התגובה לתוך 2μL 50 תגובות, התגובות בין לילה-37 °C ב הצנטרפוגה תרמי דגירה.
      3. למחרת, בטל את האנזים על ידי חימום זה 65 °C למשך 20 דקות.
      4. לטהר פלסמיד ליניארית מיד לאחר התקציר, באמצעות זמינים מסחרית PCR טיהור ערכות (ראה טבלה של חומרים) לפי ההנחיות יצרנים' . Elute את פלסמיד ב 15 μL נטולת RNase H2O ולקבוע את הריכוז של המוצר באמצעות ספקטרופוטומטרים.
      5. לרוץ μL 1 של פלסמיד מעוכל, μL 1 של פלסמיד נימולים על agarose 1.5% ג'ל כדי לאשר פלסמיד ליניארית.
    4. ביצוע של שעתוק במבחנה של Tol2 mRNA.
      1. לנצל את µg 1 של מחשבים אישיים ליניארית-zT2TP פלסמיד כתבנית עבור שעתוק. בצע את היצרן's הנחיות שעתוק במבחנה (ראה טבלה של חומרים) כפי שמתואר בטבלה 2.
      2. דגירה על 37 °C ב הצנטרפוגה תרמי לפי היצרן's הנחיות.
      3. להוסיף 1 µL של DNase, דגירה זה על 37 °C ב הצנטרפוגה תרמי לפי היצרן's הנחיות.
      4. לבצע ליתיום כלוריד משקעים לכל פרוטוקול ערכת שעתוק. Resuspend בגדר RNA ב ~ 20μL 30 ללא RNase H2O.
      5. לקבוע את הריכוז של המוצר על-ידי שימוש ספקטרופוטומטרים ולהקליט את איכות ה-RNA.
      6. לדלל את המוצר ~ 100300 ng/µL ו- aliquot זה לתוך 510 μL דוגמאות כדי להימנע ההקפאה חוזרות ונשנות-הפשרה. לאחסן אותם ב- 80 °C עד השימוש.
        הערה: זה אפשרי לבדוק 1µL 2 של mRNA מטוהרים Tol2 השמצות/להקה עם אלקטרופורזה בג'ל.

5. microinjections

  1. הכנת הכלים הכלליים לזריקות
    הערה: ההליכים בסעיף זה תוארו בפירוט על-ידי Kowalko et al.46, מבט כולל על שינויים מזעריים מוצג כאן.
    1. צור הזרקת צלחות על ידי שפיכת agarose 3% חם מומס במים מערכת דגים לתוך 100 מ ל צלחת פטרי. בזהירות מקום של עובש הזרקת ביצה agarose טרי יצוק כדי להפוך בארות ביצי הדג. מניחים בצד של העובש אגר בזווית של 45° , ואז הורידו אותו לאט לתוך agarose; לאט לאט הנמכת כייר בזווית מונע אוויר להילכד מתחת העובש. הסר בעדינות את התבנית, ברגע agarose פני השטח למוצק. הלוחות ניתן לאחסן, אטום, ב 4 °C עד 1 לשבוע.
    2. משיכה נידלס של נימים זכוכית בורוסיליקט להזרקה ב פולר אלקטרודה/המחט לפי היצרן's הנחיות. פרוטוקול זה ישתנו לפי פולר פיפטה; עם זאת, ניתן למצוא תוכנית משיכת מחט לדוגמה בטבלה3.
      הערה: אופטימיזציה של המחט חשוב לזריקות, כמו מחטים ארוכות מדי לכופף במקום נקי לחדור את הביצית.
    3. הופכים פיפטות זכוכית גדול נשא העברת הביצית על ידי שבירת פיפטות זכוכית רגילה אז הפתח מספיק גדול עבור הביצים. באמצעות מבער בונזן, ללטש את הקצה השבור של הזכוכית על ידי חשיפת בסוף פיפטות שבור ללהבה עד שהיא חלקה.
  2. רבייה ההתקנה
    הערה: ישנם פרוטוקולים שונים רבים המשמשים כמקום לרביית mexicanus א. ראו פרוטוקול מפורט, Borowsky39. להתחיל את ההתקנה רבייה 1 שבוע לפני הזריקות.
    1. יום 1, מקום 2-3 נקבות 3 ו- 4 זכרים בטנק יחיד גלון 10 ומתוחזק על ± 1 24 °C.
    2. בימים 17, להגדיל את ההאכלה ~ 3 2x יום. ודא שהדיאטה כוללת מזון חי, כגון תולעים שחורות, שרימפסים.
    3. יום 6, להוסיף תנור טנק בודד מוגדר 27 °ג מעבדה טמפרטורות טנק יכול להשתנות; לכן, זה יהיה גידול של2 3 °C יחסית הטמפרטורה טנק נורמלי.
    4. בערב של יום 7, אשר הערב (zeitgeber [ZT] 911) של הזרקת בלילה, ביסודיות לנקות את הטנקים עם ספוג ספוג מים ולהסיר עודפי מזון או פסולת באמצעות רשת קנס נטו או הקונכייה.
    5. בליל יום 7, להתחיל. לחפש ביצי דגים משטח-ZT15 ולהמשיך לבדוק כל 1530 דקות עד ZT18. עבור cavefish, להתחיל. לחפש ביצים-ZT17 ולהמשיך לבדוק כל 1530 דקות עד ZT20.
      הערה: הזמנים מבוססים על 14:10 מחזור אור h: אפל באמצעות zeitgeber זמן. גידול פי הערכות, מעבדות בודדות יש לקבוע באותו הזמן. . זה קריטי כדי לאסוף את הביצים בקרוב לאחר שהן שוחרר/מופרית על מנת להזריק אותם בשלב תא בודד
  3. אוסף של תא בודד שלב ביצים
    1. הלילה שבו צפוי גידול, לבחון הטנקים כל 1530 min וצג עבור הביצים בתחתית המיכל. ביצים מופיעים שקוף, מדידת כ- 1 מ מ קוטר.
    2. השתמש דג רשת קנס נטו כדי לאסוף את הביצים ולהעביר אותם לקערה כוס מלאה במים מערכת דגים טריים. לבחון את הביצים במיקרוסקופ כדי לאשר כי הביצים הן בשלב אחד-cell.
    3. באמצעות פיפטות זכוכית, להעביר תא בודד ביצים הלוחות הזרקה. פיפטות זכוכית נדרשים בשלב זה כמו הביצים ידבק פלסטיק.
    4. בזהירות בעזרת פיפטה, לשחרר את הביצים לתוך הבארות של צלחת הזרקת agarose של סעיף 5.1. למלא את השורות של צלחת הזרקת prewarmed (בטמפרטורת החדר) המספר המרבי של ביצים (3040 שורה, ועד חמש שורות). שורות מלא לסייע למנוע את הביצים לזוז במהלך זריקות. לשמור את הביצים להתייבש על הצלחת ההזרקה עם כמות קטנה של דגים מערכת מים עד בצוע של הזריקות.
  4. פיקו-הזרקת התקנה והנחיות אופטימיזציה הזרקת כללי
    1. מילוי מחטים הזרקת באמצעות פיפטה העמסה ג'ל או טיפים מתאימים בתוך נימי או שימוש רגיל micropipette טיפים הוספת2 4 µL בעירוי דרך הוריד עד הסוף. ברגע שהמחט מלא, להשתמש מלקחיים כדי לקצץ את אורך עודף של המחט הזרקה.
    2. לבצע microinjections באמצעות מחט לטעון micromanipulator, מחובר microinjector picoliter.
    3. להגדיר את הזמן הזרקת 0.03 s והלחץ החוצה בבית ~0.0 psi. הלחץ הזרקת ישתנו בהתאם עם הבדלים קלים בין מחטים, אז למטב את פעולותיי כדי להשיג מזון לעוס הזרקת nL ~1.0.
      הערה: הזרקת הלחץ הוא לעיתים קרובות בטווח של ~ 1030 psi.
    4. לתקנן את בולוס הזרקת על ידי הזרקת לתוך שמן מינרלי ומדידת בולוס את גודל עם מיקרומטר שקופית כדי להשיג ~ 11.5 נפח הזרקה nL. התאם את הלחץ הזרקה (psi) כדי להגדיל או להקטין את העוצמה בולוס.
    5. שאיבת מים מחוץ לראש הביצים בעזרת טישו מעבדה.
      הערה: chorion ביצים Astyanax זה קצת יותר קשה לחדור יותר ביצי דג זברה. אנו מוצאים כי ציור המים ליד החלק העליון של הביצים מסייע להקל על המחט חדירה לתוך הביצית. צלחת אופטימיזציה יכול לאפשר ~ 200 ביצים על לוח אחד.
    6. השתמש את micromanipulator כדי לחדור כל ביצה עם המחט, ולהזריק ישירות לתוך החלמון. ברגע בכיוון החלמון, להזריק את הביצה על ידי לחיצה על דוושת רגל הכנס כפתור או הזרקה.
      הערה: יכול להיות מוזרק צלחת מלאה בתוך ~ 15 דקות. השלב תא בודד נמשך ~ 40 דקות.
  5. הזרקה של morpholinos
    הערה: כמות מורפולינו צורך נוקאאוט מבלי לגרום רעילות יצטרכו להיות מותאם לכל הגן היעד; עם זאת, ריכוז 400 פ ג הוא מקום טוב להתחיל.
    1. להכין מורפולינו כך להיות מוזרק pg 400 של מורפולינו לכל ביצה. מורפולינו הפשרה על קרח. הפתרון הזרקת מורכבת מורפולינו (על הריכוז הרצויה), נטול RNase H2O או Danieau's פתרון, פנול אדום (10% של הכרך האחרון). לקבלת דוגמה, ראה בטבלה 4.
    2. להזריק 1 nL לכל העובר.
  6. זריקות CRISPR
    1. להכין RNA כך pg 25 של gRNA ו- 300 פ"ג של mRNA Cas9 הכולל להיות מוזרק לכל העובר. לקבלת תערובת הזרקה מדגם CRISPR/Cas9, ראה טבלה 5.
    2. להזריק 2 nL של gRNA/Cas9 ה-mRNA לכל עובר ישירות אל העובר.
  7. הזרקה של Tol2 transposase, Tol2-מלון פלסמיד עבור transgenesis
    1. הפשרת transposase mRNA, פלסמיד Tol2 על הקרח. שילוב Cas9 mRNA (ב 25 ng/µL), לבנות Tol2 הרצוי (בגיל 25 ng /μL), פנול אדום (10% של הכרך האחרון) במים נטולי RNase. לקבלת דוגמה Tol2 transgenesis הזרקת תערובת, ראה טבלה 6.
    2. שמור את הזרקת פתרון ומחטים על קרח כדי למנוע ההשפלה של mRNA. להזריק-1 nL בכרך לכל העובר.

6. לגידול וסינון מוזרק דגים

  1. גידול דגים מוזרק
    1. אחרי הביצים מוזרקים, מיד להעביר אותם מלא ~ 200 מ ל מים המערכת דגים קערות זכוכית (10 x 5 ס מ). ביצים הן לשטוף בקלות על ידי לטבול הלוחות הזרקה לתוך קערות מלאות דגים את הביצים עם פיפטה מים ושטיפה.
    2. למקם את העוברים מוזרק 80~ 50 לכל קערה, אחורי אותם על 2224 °C.
    3. לנקות את הקערות עם דגים מוזרק 2 x ליום כדי להסיר את העוברים מת ולשנות ~ 20% של המים על בסיס יומי.
    4. גידול נוספים מתבצע על פי פרוטוקולים שפורסמו בעבר39.
  2. הקרנה של יחידים המוזרק מורפולינו
    1. דמיינו את החיות תחת stereomicroscope עבור פנוטיפים מסך. ההשפעה של morpholinos יכול להימשך למעלה ל ~ 5 ימים postinjection21.
    2. למדוד פנוטיפים התנהגותיים-postinjection 4 ימים.
  3. הקרנה של CRISPR indels
    1. עיצוב תחל כדי להגביר את הדנ א מסביב למטרה. לעצב תחל כך המוצר PCR היעד הוא כ 100125 bp.
      הערה: לדוגמה, עבור מיקומה oca2 , אזור סביב אתר היעד gRNA היה מוגבר באמצעות פריימר לפנים 5'-CTCCTCTGTCAGGCTGTGC-3' ופריימר הפוכה 5'-GAAGGGGATGTTGTCTATGAGC-3' עבור המוצר PCR אורך 105 bp.
    2. להקריב את העוברים או פין קליפ דגים בוגרים לפי הפרוטוקול בעלי חיים מוסדיים.
    3. לאסוף עוברי או סנפירים ביתור לתוך המבחנות, לחלץ את הדנ א ולבצע PCR מותני. דוגמת פרוטוקולים עבור תחל גנים ספציפיים ניתן למצוא Ma et al.35.
    4. להעריך עבור מוטגנזה מכוונת, לרוץ 5 תגרום µL של מוצר ה-PCR על ג'ל 3% agarose ב 70 V עבור 3 ה DNA (nonmutagenized) פראי-סוג מוצר ה-PCR כלהקה ברורים. מוטציה DNA תגרום להקה smeary על הג'ל.
    5. כדי לקבוע את הרצף של אללים mutant, ת א לשבט את המוצר PCR על פי היצרן's הוראות, לקחת את המושבות, תרבויות miniprep. לשלוח את ה-DNA שנוצר עבור רצף.
    6. להקים ולקיים קווים של דגים משדר אללים mutant, חצו דגים מוזרק המבוגרים פראי-סוג דגים, ומסך 5עוברי 10 כדי לקבוע אם לשאת כל אחד הוא צאצא של אלל mutant של הגן בעקבות צעדים 6.3.1-6.3.6.
      הערה:1 F שונה מיחידים אותו הדג מייסד0 F יכול לשאת מוטציות שונות. ודא הקווים המוטנטים הינם וסודרו להשיג מוטציות חזה כדי לייצר אללים הנמצאים מחוץ למסגרת.
    7. זיהוי דג נושאת אלל mutant PCR באמצעות וזמינותו הלהקה smeary (צעדים 6.3.1-6.3.6) או על ידי עיצוב ספציפי אלל PCR תחל המדגישים מוטציה ולהקות פראי-סוג (איור 2C).
    8. לאחר שורה של דגים הוא הוקם, homozygose אללים mutant לבדיקת פנוטיפים רצסיבי.
  4. הקרנה של אנשים חיוביים מהונדס
    הערה: שימוש בונה המכיל מכונת פלורסנט מומלץ כדי לייעל את ההקרנה עבור הטרנסגניים אנשים חיוביים. עם זאת, תקן ה-PCR הקרנת שיטות יכול לשמש עבור שידור מסך.
    1. המחש רקמות ספציפיות חלבונים פלורסנט בדגים0 F מוקדם ככל postinjection יומיים, עם epifluorescence לנתח היקף.
      הערה: הביטוי ב- F0 הזחלים הוא פסיפס, אנשים חיוביים שיש מגוון פנוטיפים הביטוי.
    2. לשמור אנשים חיוביים כמו F0 מייסד הדגים.
    3. כאשר F0s מגיעים לבגרות, backcross דגים המייסדים ליחידים nontransgenic נגזר מן המלאי באותה אוכלוסייה/מעבדה. מסך F1 צאצאים באמצעות פרוטוקול אותה כפי שמתואר בשלב 6.2.
      הערה: הביטוי ב- F1 הזחלים אחיד ומבטיחה עקביות בין אחים1 F.
    4. מאז Tol2 אינטגרציה אינה בתיווך האתר, שילוב יכול להשתנות בין המייסדים, בחר F1 אחים נגזר למייסד0 F יחיד, interbreed לבטא חיובית אחים1 F כדי להפיק F2s. הצאצא הזה יהיה בסיס קו יציב.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

מספר אוכלוסיות של שוכני המערה mexicanus א מראים שינה מופחתת ערות/פעילות מוגברת יחסית שלהם בני מינו של השטח-דיור14. Hypocretin/orexin (HCRT) neuropeptide שנשמרת מאוד, אשר פועל להגברת ערנות, שיבושים HCRT בשביל לגרום narcolepsy בני אדם אחרים47,יונקים48. בעבר הראו המערה mexicanus א הגדילו ביטוי של פפטיד HCRT, רומז כי ביטוי מוגבר של פפטיד זה עשויה ביסוד האובדן של שינה cavefish38. נוקאאוט מו הביטוי hcrt מספקת גישה רב-עוצמה עבור ישירות בחינת השפעתם של ביטוי מוגבר hcrt תיווכה האובדן של שינה ב- cavefish.

כדי לבחון את הקשר בין הביטוי hcrt שינה, תיכננו מורפולינו של חסימת-תרגום. נקודת הרתיחה של מו מטרות 25 הראשון של אקסון אחד, כולל את ATG להתחיל באתר (איור 1 א',ב'). כפקד, אנחנו מנוצל פקד מו מקושקשות זמינים מסחרית (איור 1B). אנחנו באמצעות האלגוריתם הפיצוץ NCBI, אישר כי ישנם ללא תופעות מחוץ-יעד לתנועה או ברחבי הגנום (נתונים לא מוצג). דגים משטח א mexicanus , Pachón cavefish התרבית ואת הביצים שלהם היו שנאספו לאחר מכן מוזרק עם עמוד 400 של מו ב nL-נפח 1 בשלב אחד-תא (איור 1C,יח). הדגים היו בחזקת 4 dpf, ואז למדוד פעילות והתנהגות שינה.

מערת mexicanus א מוזרק עם הפקד מו הציג פעילות משמעותית יותר גינקולוגיות האופטימיזציות שינה במשך 24 שעות לעומת השטח דגים גם מוזרק עם הכוכבת מקושקשות (איור 1E,F), רומז אין השפעה של שליטה זריקות מורפולינו כמו התוצאות עקביים עם דפוסי פעילות ושינה שפורסמו בכל morphotype (t = 5.021, df = 88, p < 0.0001). ההזרקה של שיטת HCRT-הפעולה היתה השפעה רבה על שינה בדגים משטח לעומת דג המוזרק שליטה (t = 0.17, df = 88, p > 0.99). לעומת זאת, hcrt נוקאאוט באמצעות הזרקת מו היה אפקט משמעותי על שינה בדגים שוכני המערה. הזחלים cavefish Pachón הראו פחות הפחתה fourfold בפעילות גינקולוגיות, ולא לישון כמעט שתי פעמים יותר לשלוט הזחלים Pachón (איור 1E,F; t = 2.694, df = 88, p < 0.05). השוואה של פעילות גינקולוגיות ולישון בדגים השטח - ואת מערת המגורים מו-נוקאאוט גילה כמויות ומכניקה ולישון דומות (איור 1E, F). נתונים אלה מספקים קישור ישיר בין הביטוי hcrt ואובדן שינה ומספקים שיטה לחקור את המנגנונים הביולוגיים על האובדן שינה morphs שוכני המערה אבולוציונית נגזר.

פיגמנטציה אובדן מהווה סימן היכר של אורגניזמים במערה ולאחר מספר אוכלוסיות Astyanax שוכני המערה להדגים אובדן של פיגמנטציה. לבקנות ב- Molino ו Pachón cavefish מופה באמצעות מיפוי QTL לאזור גנומית המכילים את הגן, עינית לבקנות 2 (oca2), רומז מוטציות בגן oca2 ביסוד לבקנות cavefish6.

לאימות oca2 כמו מיקומה סיבתי עבור לבקנות בעוד morphs מערת Pachón, אנחנו מנוצל CRISPR/Cas9 ג'ין עריכה להפוך למוטציות באזור אוכלוסיות דגים משטח. מאז אקסון 21 נמחק ב- Molino דגים6, תיכננו את gRNA כדי למקד אזור זה של הגן (איור 2 א). רצף גנומית, כולל את רצף המטרה gRNA ופאם (מודגש), הוא 5'-GGTCATGTGGGTCTCAGCTTTGG-3'. רצף זה היעד (ללא הרצף פאם) נעשה שימוש כדי ליצור את gRNA עבור יישוב מוטגנזה מכוונת. מגדלים משטח נעשו להזדווג, העוברים וכתוצאה מכך שנאספו בשלב אחד-cell. שלב אחד-תא עוברי הוזרקו Cas9 mRNA, פילוח gRNA oca2, וגדל החיות מוזרק היו לבגרות43. מוזרק המבוגרים היו עשויים להזדווג פראי-סוג משטח דגים, העוברים מן חוצה אלה היו genotyped כדי לקבוע נבט-קו תמסורת, באמצעות תחל מהשלב 6.3.1. רציף של אלל mutant oca2 ואנו לזהות נבט-קו-ששודרו 2 bp מחיקה ב oca2 (איור 2B,ג). על מנת להקל על genotyping, תיכננו תחל אלל ספציפי כדי לזהות את אללים פראי-סוג של מוטציה (איור דו-ממדי) ודגים genotyped, באמצעות PCR ואחריו בג'ל (2E איור). אנחנו incrossed משפחתית ולא משפחתית הטרוזיגוטיים עבור אלל mutant הזה oca2 משטח דגים. הוא צאצא שנוצר היו פיגמנט או לבקנים (איור 2F-אני). אנשים pigmented היו פראי-סוג או משפחתית ולא משפחתית הטרוזיגוטיים-מיקומה oca2, בעוד לבקן יחידים היו homozygous מוטציה (2E איור). נתונים אלה מספקים קישור ישיר בין oca2 ג'ין לוקוס לבקנות ב mexicanus א cavefish.

התנהגויות הרבות כגון שינה, האכלה, מתח שונים mexicanus א cavefish יחסית משטח בני מינו, אך הגורמים המכריעים עצביים בין morphs אינן ברורות. דימות מוח שלם-סידן מספקת גישה לא משוחד עוצמה לבחינת מתאמים בין פעילות עצבית שינו והתנהגות שונה. אנחנו שנוצר cavefish עם ביטוי עצביים בקרבת-בכל מקום של מחוון סידן מקודדים גנטית, GCaMP6s, ודגים פני השטח בעזרת ריאגנטים בשימוש נרחב במחקר דג זברה. כמו ELAV נוירון ספציפיים מחייב RNA חלבון 3 (elavl3) endogenously מתבטאת לאחרונה הבדיל הנוירונים בכל מערכת העצבים המרכזית49 , נעשה שימוש בדג זברה לנהוג הביטוי של חלבונים לאורך רוב שנות ה50של מערכת העצבים. השגנו בונה Tol2 המכיל ~2.8 kb דג זברה elavl3 יזם שעתוק במעלה הזרם של מחוון סידן מקודדים גנטית GCaMP6s (פיוז'ן של חלבון פלואורסצנטי ירוק [GFP], קלמודולין ו- M13, רצף פפטיד מתוך צולבות הקישור חוטים שרירן אור-שרשרת קינאז), מלון בקצוות 5' ו 3' עם אתרי Tol2 (Tol2 -elavl3:GCaMP6s-Tol2)51.

Molino cavefish ודגים משטח mexicanus א התרבית, העוברים וכתוצאה מכך היו coinjected בשלב תא בודד עם 25 ng/μL של Tol2 -elavl3:GCaMP6s-Tol2 לבנות ו- 25 ng/μL Tol2 transposase mRNA (איור 3 א). -Dpf 24-48, הזחלים הוקרנו על ביטוי עצביים ארעית של GCaMP6s. אלה העוברים (F0) מוזרק בהבעה של GCaMP6s היו בחזקת לבגרות, backcrossed עם מבוגרים פראי-סוג נגזר אותה שושלת של דג משטח או cavefish. המבוגרים F1 וכתוצאה מכך הוקרנו על ביטוי יציב של ביטוי GCaMP6s, ומתוחזק הזחלים היו כדי ליצור קווים יציב (איור 3B,ג). כי כל מבוגר F1 עם ביטוי יציב ככל הנראה שילבה Tol2 -elavl3: GCaMP6s-Tol2 באתרים שונים גנומית, F1 כל המיועד של אלל שונים. באמצעות גישה זו, יש לנו שנוצר F1s יציבה עבור דגים פני אוכלוסיות cavefish מולינו (איור 3B,C), סידן בשידור חי וכך המאפשרת הדמיה לחשוף את ההבדלים בפעילות העצבית תיווכה שינויים התנהגותיים במערה סביבה (איור 3 C,D). יתר על כן, גישה זו מטילה את היסודות עבור הביטוי של רבים נוספים transgenes לאפיין ולטפל בפונקציה ג'ין mexicanus א.

Figure 1
איור 1: נוקאאוט מורפולינו של Hcrt מפחית את פעילות ומגביר לישון ב- cavefish. (א) חסימה תרגום bp מטרות 25 הראשון מורפולינו של Hcrt קידוד רצף, כולל האתר התחלה ATG. (B) Hcrt מורפולינו oligo (מו), רצפי בקרה. יישור (C) ~ 200 ביצים תא בודד על agarose ביצה תבניות הזרקה. (ד) Microinjection של 1.0 nL תערובת הזרקה בעל אינדיקטור פנול אדום עבור פריט חזותי. סרגל קנה מידה = 0.5 מ מ. (E) נוקאאוט מורפולינו של Hcrt מקטין את הפעילות (סה כ מרחק נסע) של Pachón cavefish (t = 5.021, df = 88, p < 0.0001) אך לא על פני דגים (t = 1.318, df = 88, p > 0.72). (F) נוקאאוט מגביר שינה ב Pachón cavefish (t = 2.694, df = 88, p < 0.05) אבל אין השפעה על פני דגים (t = 0.17, df = 88, p > 0.99). סרגל קנה מידה = 1 מ מ. קווי השגיאה פאנלים E ו- F מציינות את שגיאת התקן של הממוצע. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 2
איור 2: CRISPR ג'ין-עריכת oca2 מציג לבקנות בתוך השטח-דיור א mexicanus. (א) סכמטית oca2 קידוד אזורי, ו מדריך-RNA (gRNA) מיקוד אקסון 21 לעריכה בתיווך CRISPR גן. (B) רצף chromatogram של פראי-סוג Oca2 + ו- (ג) מוטציה Oca2 - אללים. התיבה האדומה בחלונית B מציין את רצף bp 2, אשר נעדרת Oca2 - אלל mutant מתואר בחלונית C. (ד) ממוקד CRISPR מציג מחיקה bp 2, הפונקציה Oca2 disrupting. תחל מיועדים הקרנת 2 מחיקת bp בצאצאים F0 genotypic. (E) PCR וג'ל אלקטרופורזה של Oca2 בדגים פני שטח פראי-סוג (להקת גודל = 134 bp) וילדייך המוזרק F0 CRISPR (להקת גודל = 133 bp). אנשים homozygous או משפחתית ולא משפחתית הטרוזיגוטיים עבור הווריאציה פראי-סוג של Oca2 (Oca2 +) נמצאים בפיגמנטים, בעוד F0s homozygous למחיקה bp 2 (Oca2 -) הנמל לבקנות. (F) לכל הגוף תמונות של פראי-סוג משטח דגים, (G) של פני השטח דגים עם לבקנות בתיווך CRISPR. סרגל קנה מידה = 5 מ מ. (H , אני) Magnified תצוגה של ראשי של אינדיבידואלים מתוארים פאנלים F ו- G, בהתאמה. סרגל קנה מידה = 2 מ מ. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 3
איור 3: Tol2 transgenesis של GCAMP6s פאן עצבית מאפשר ההדמיה בשידור חי של פעילות מוחית ב א mexicanus. (א) בתיווך Tol2 transgenesis ב mexicanus א. Coinjection של Tol2 mRNA ו Tol2 -elav3l: GCAMP6s-Tol2 פלסמיד משלב GCAMP6s transgene ב F0 המייסדים. Backcrossing את המניה המקורי של פראי-סוג דגים התשואות F1 אנשים עם ביטוי פן עצבית יציב של GCAMP6s. (B ו- C) אופספרינג וכתוצאה מכך מוקרנים עבור ביטוי יציבה באמצעות ניתוח ומיקרוסקופיה קונפוקלית. יציבה TgAsty(elav3l: GCaMP6s) F1 יחידים הוקמו גם משטח-(מתואר בחלונית B) וגם morphotypes שוכני המערה (מתואר בחלונית C). סרגל קנה מידה = 200 μm.  אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

מגיב אמצעי האחסון או כמות
Μg 10.0 של מחשבים-zT2TP פלסמיד דנ א X μl
מאגר CutSmart נב 10.0 μl
אנזים NotI-HF 2.0 μl
ללא נוקלאז H2O X μl
BSA 1.0 μl
סה 100 μl

טבלה 1: תקציר ההגבלה של פלסמיד Tol2.

מגיב אמצעי האחסון או כמות
Μg 1.0 של פלסמיד לליניארית מחשבים-zT2TP דנ א X μl
10 x תגובת מאגר 2.0 μl
2 x NTP/כיפה 10.0 μl
SP6 אנזים מיקס 2.0 μl
ללא RNase H2O X μl
סה ≤20 μl

טבלה 2: סינתזה במבחנה של Tol2 mRNA.

שם ההגדרה קביעת ערך
חום 510
משוך 55
מהירות 100
זמן 40
לחץ 500
הרמפה 534

טבלה 3: לטעום פרוטוקול משיכה פיפטה. 

מגיב אמצעי האחסון או כמות
מורפולינו (מניות מקפיא @ 4 מ מ) 1.0 μl
ללא נוקלאז H2O או הפתרון של Danieau 17.0 μl
פנול אדום 2.0 μl
סה 20 μl

טבלה 4: מורפולינו הזרקת תערובת.

מגיב נפח של כמות
gRNA (סופי ריכוז בעבודה @ 100ng/μl) 1 μl
Cas9 mRNA (סופי ריכוז בעבודה @ 1200ng/μl) 1 μl
ללא RNase H2O 2 μl
סה 4 μl

טבלה 5: מדגם CRISPR/Cas9 הזרקת תערובת.

מגיב נפח של כמות
פלסמיד Tol2 (סופי ריכוז בעבודה @ 25ng/μl) X μl
Tol2 mRNA (סופי ריכוז בעבודה @ 25ng/μl) X μl
פנול אדום 1.0 μl
ללא RNase H2O X μl
סה 15 μl

טבלה 6: Tol2 מדגם transgenesis הזרקת תערובת

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

כאן, אנחנו מסופקים מתודולוגיה מניפולציה ג'ין פונקציה באמצעות morpholinos, CRISPR/Cas9 ג'ין עריכה מתודולוגיה transgenesis. העושר של טכנולוגיה גנטית ואופטימיזציה של מערכות אלה דג זברה סביר יאפשר העברת מכלים אלה לתוך mexicanus א עם נוחות52. הממצאים האחרונים השתמשו גישות אלה ב- mexicanus א, אך הם נשארים underutilized לגבי חקירת תכונות מורפולוגי, התפתחותיות, התנהגותיות מגוונת זו מערכת30,36,42 , 53.

Morpholinos היה בשימוש נרחב במחקר דג זברה נוקאאוט הביטוי של גנים. הגישה הוא נתיישב ותוצאות נוק-אאוט. חזקים של הביטוי. עם זאת, את המטרה אפקטים היה נרחב מתועדים22,53; לפיכך, בעלי חיים שבו morpholinos יש כבר הזריקו לך צריך לפקח בקפידה עבור כל22,לא צפויה פנוטיפים55. במידת האפשר, התוצאות שהתקבלו מורפולינו נוקאאוט לאמת באמצעות שימוש בשיטות אחרות, כגון CRISPR/Cas9-מתווכת גישות נוקאאוט. בעוד morpholinos לאפשר נוקאאוט חזקים של ביטוי גנים, בתיווך מורפולינו נוקאאוט הוא ארעי. לפיכך, ניתוח פנוטיפים למבוגרים אינה אפשרית כאשר משתמשים בשיטה זו.

מוטגנזה מכוונת CRISPR/Cas9-מתווכת ' מציע טפלול ישיר של גנים ספציפיים. יתר על כן, בניגוד בתיווך מורפולינו נוק-אאוט, מוטגנזה מכוונת CRISPR/Cas9 מאפשר לניתוח של פנוטיפים מוטציה לבגרות. כדי למנוע השפעות-יעד CRISPR/Cas9, הקווים המוטנטים צריך להיות outcrossed מספר דורות, במידת האפשר, אלל אחד או יותר צריך להיות שהושג ונבדק. מערכת CRISPR/Cas9 מספק גם את הפוטנציאל עבור ניצול גנים לעריכת גישות לדפוק-אללים או לייצר שינויים גנטיים ספציפיים. מערכת CRISPR/Cas9 כבר בשימוש דג זברה כדי לייצר שילובי מדויק של ה-DNA אקסוגני וכדי ליצור מוטציות נקודה מדויקת19,20,56,57,58, 59. עם רצף הגנום cavefish, עכשיו זה אפשרי לזיהוי פולימורפיזמים נוקלאוטיד יחיד (SNPs) או אחרים שינויים גנטיים עדינים בין דגים פני אוכלוסיות cavefish33. היישום של CRISPR/Cas9 ג'ין עריכת מספק הזדמנות להחליף אללים בין משטח דגים, cavefish, או בין אוכלוסיות שונות של cavefish, כדי לבחון את התפקיד של שינויים גנטיים אלה של תהליכים התפתחותיים שונים.

הגישות transgenesis המתוארות פרוטוקול זה מספקות שיטה פשוטה ורבת -עוצמה עבור רווח-של-תפקוד לימודי, יצירת כלים לשנות תהליכים ביולוגיים גנטית. מערכת Tol2 נעשה שימוש נרחב במחקר דג זברה, הראינו כי זה דומה חזקה ב- mexicanus א. יתר על כן, אנו הפגינו בונה הטרנסגניים המופקים דג זברה מנצל מקדם דג זברה, recapitulates אנדוגני ביטוי mexicanus א. מצאנו שארבעת היזמים האחרים מבודד מן דג זברה את הביטוי רקמות ספציפיות נסיעה כצפוי ב mexicanus א (נתונים לא מוצג). מאז דג זברה היזמים לסכם על דפוסי ביטוי שנשמרת ב mexicanus, הדבר מצביע על כי רבים מן הכלים גנטי ניתן להעביר ישירות מדג זברה mexicanus ללא צורך שינוי עם א mexicanus באמרגנים. יתר על כן, עם התקדמות ב טכנולוגיות רצף ב mexicanus א33, הגישות הטרנסגניים המתוארים כאן יאפשרו עתיד רב עוצמה עבור החקירה של משפרי ואת היזמים זה עשוי לשחק תפקיד וריאציית בין משטח וטפסים המערה. לבסוף, כלים רבי-עוצמה מניפולציה גנטית של תהליכים ביולוגיים שהפכו דג זברה יקר חשובים באותה מידה mexicanus ע'60,61,62,63. הבדלי תכונות התנהגותיות מגוונים, כגון שינה, האכלה, להדגיש, תוקפנות, בין צורות השטח - ואת מערת המגורים mexicanus א היו מתועדים בהרחבה12,14,15 38, ,64, עדיין הבסיסית ה"מפה עצביים אינם מובנים היטב. כלים כגון Tg(elavl3:GCaMP6s) יאפשר ניתוח של מה הבדלים בפעילות העצבית במוח ברוחב לתאם עם הבדלים בהתנהגות ומציעים תובנה ייחודית איך למוח יש לשנותם אבולוציונית.

יחדיו, mexicanus א צפוי להיות דוגמנית מובילה עבור חוקרים את האבולוציה של מגוון רחב של מאפיינים מורפולוגיים והתנהגותיים. ההבדלים מגוונות בתהליכים ביולוגיים מורכבים ב א mexicanus מספקים פלטפורמה לחקור מנגנונים גנטיים של תכונה האבולוציה. היישום של כלים לטיפול ג'ין הפונקציה עשויה לסייע לפתח את האורגניזם הזה לתוך מודל זה יכול להיות מיושם לחקור מחלות ביולוגיים הקשורים ניוון העין, הפרעות התפתחותיות ונדודי שינה.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

המחברים אין לחשוף.

Acknowledgments

המחברים מודים Sunishka טהאקור על לה סיוע genotyping והדמיה הדג מוטציה oca2 מתואר באיור2. עבודה זו נתמכה על ידי קרן המדע הלאומית (NSF) פרס 1656574 A.C.K. פרס ה-NSF 1754321 J.K., A.C.K., פרס לאומי מכונים לבריאות (NIH) R21NS105071 A.C.K., E.R.D.

Materials

Name Company Catalog Number Comments
Fish breeding & egg supplies
Fine mesh fish net Penn Plax BN4
Fish tank heater Aqueon 100106108
Egg traps Custom made NA Design and create plastic grate to place at bottom of tank to protect eggs
Glass pipettes Fisher Scientific 13-678-20C
Pipette bulbs Fisher Scientific 03-448-21
Agarose Fisher Scientific BP160-500
Egg molds Adaptive Science Tools TU-1
Morpholino supplies
Control Morpholino Gene Tools, LLC Standard control olio
Custom Morpholino Gene Tools, LLC NA
Phenol Red Sigma Aldrich P0290-100ML
CRISPR supplies
Cas9 Plasmid AddGene 46757
GoTaq DNA Polymerase Promega M3001
KOD Hot Start Taq EMD Millipore 71-842-3
Primers Integrated DNA Technologies Custom
T7 Megascript Kit Ambion/Thermofisher AM1333
miRNeasy Kit Qiagen 217004
mMessage mMachine T3 kit Ambion/Thermofisher AM1348
MinElute Kit Qiagen 28204
Tol2 transgenesis supplies
pCS-zT2TP plasmid Kawakami et al., 2004 Request from senior author
CutSmart Buffer New England Biolabs B7204
NotI-HF Restriction Enzyme New England Biolabs R3189
PCR purification Kit Qiagen 28104
SP6 mMessenger Kit Ambion/Thermofisher AM1340
Microinjection supplies
Glass Capillary Tubes Sutter Instruments BF100-58-10
Pipette puller Sutter Instruments P-97
Picoinjector Warner Instruments PLI-100A
Micromanipulator World Precision Instruments M3301R
Micromanipulator Stand World Precision Instruments M10
Micmanipulator Base World Precision Instruments Steel Plate Base, 10 lbs

DOWNLOAD MATERIALS LIST

References

  1. Darwin, C. On the Origin of Species by Means of Natural Selection. D. Appleton and Company. (1859).
  2. Culver, D. C., Pipan, T. The Biology of Caves and Other Subterranean Habitats. Oxford University Press. New York, NY. (2009).
  3. Mitchell, R. W., Russell, W. H., Elliott, W. R. Mexican Eyeless Characin Fishes, Genus Astyanax: Environment, Distribution, and Evolution. (1977).
  4. Huppop, K. Oxygen consumption of Astyanax fasciatus (Characidae, Pisces): A comparison of epigean and hypogean populations. Environmental Biology of Fishes. 17, 299-308 (1986).
  5. Moran, D., Softley, R., Warrant, E. J. Eyeless Mexican Cavefish Save Energy by Eliminating the Circadian Rhythm in Metabolism. PLoS ONE. 9, (9), e107877 (2014).
  6. Protas, M. E., et al. Genetic analysis of cavefish reveals molecular convergence in the evolution of albinism. Nature genetics. 38, 107-111 (2006).
  7. Wall, A., Volkoff, H. Effects of fasting and feeding on the brain mRNA expressions of orexin tyrosine hydroxylase (TH), PYY and CCK in the Mexican blind cavefish (Astyanax fasciatus mexicanus). General and Comparative Endocrinology. 183, 44-52 (2013).
  8. Aspiras, A., Rohner, N., Marineau, B., Borowsky, R., Tabin, J. Melanocortin 4 receptor mutations contribute to the adaptation of cavefish to nutrient-poor conditions. Proceedings of the National Academy of Sciences. 112, (31), 9668-9673 (2015).
  9. Yoshizawa, M., Gorički, Š, Soares, D., Jeffery, W. R. Evolution of a behavioral shift mediated by superficial neuromasts helps cavefish find food in darkness. Current Biology. 20, (18), 1631-1636 (2010).
  10. Jeffery, W. R. Regressive Evolution in Astyanax Cavefish. Annual Review of Genetics. 43, 25-47 (2009).
  11. Gross, J. B. The complex origin of Astyanax cavefish. BMC Evolutionary Biology. 12, 105 (2012).
  12. Elipot, Y., Hinaux, H., Callebert, J., Rétaux, S. Evolutionary shift from fighting to foraging in blind cavefish through changes in the serotonin network. Current Biology. 23, (1), 1-10 (2013).
  13. Kowalko, J. E. J., et al. Loss of schooling behavior in cavefish through sight-dependent and sight-independent mechanisms. Current Biology. 23, (19), 1874-1883 (2013).
  14. Duboué, E. R. E. R., Keene, A. C. A. C., Borowsky, R. L. R. L. Evolutionary convergence on sleep loss in cavefish populations. Current Biology. 21, (8), 671-676 (2011).
  15. Chin, J. S., et al. Convergence on reduced stress behavior in the Mexican blind cavefish. Developmental Biology. (2018).
  16. Scheer, N., Campos-Ortega, J. A. Use of the Gal4-UAS technique for targeted gene expression in the zebrafish. Mechanisms of Development. 80, (2), 153-158 (1999).
  17. Kawakami, K., Shima, A., Kawakami, N. Identification of a functional transposase of the Tol2 element, an Ac-like element from the Japanese medaka fish, and its transposition in the zebrafish germ lineage. Proceedings of the National Academy of Sciences. 97, (21), 11403-11408 (2000).
  18. Balciunas, D., et al. Enhancer trapping in zebrafish using the Sleeping Beauty transposon. BMC Genomics. (2004).
  19. Auer, T. O., Duroure, K., De Cian, A., Concordet, J. P., Del Bene, F. Highly efficient CRISPR/Cas9-mediated knock-in in zebrafish by homology-independent DNA repair. Genome Research. 24, (1), 142-153 (2014).
  20. Kimura, Y., Hisano, Y., Kawahara, A., Higashijima, S. I. Efficient generation of knock-in transgenic zebrafish carrying reporter/driver genes by CRISPR/Cas9-mediated genome engineering. Scientific Reports. 4, (2014).
  21. Bill, B. R., Petzold, A. M., Clark, K. J., Schimmenti, L. A., Ekker, S. C. A Primer for Morpholino Use in Zebrafish. Zebrafish. 6, (1), 69-77 (2009).
  22. Nasevicius, A., Ekker, S. C. Effective targeted gene “knockdown” in zebrafish. Nature Genetics. (2000).
  23. Sander, J. D., et al. Targeted gene disruption in somatic zebrafish cells using engineered TALENs. Nature Biotechnology. (2011).
  24. Huang, P., et al. Heritable gene targeting in zebrafish using customized TALENs. Nature Biotechnology. (2011).
  25. Kawakami, K. Transposon tools and methods in zebrafish. Developmental Dynamics. 234, (2), 244-254 (2005).
  26. Urasaki, A., Morvan, G., Kawakami, K. Functional dissection of the Tol2 transposable element identified the minimal cis-sequence and a highly repetitive sequence in the subterminal region essential for transposition. Genetics. 174, (2), 639-649 (2006).
  27. Juntti, S. A., Hu, C. K., Fernald, R. D. Tol2-Mediated Generation of a Transgenic Haplochromine Cichlid, Astatotilapia burtoni. PLoS ONE. 8, (10), (2013).
  28. Harel, I., Valenzano, D. R., Brunet, A. Efficient genome engineering approaches for the short-lived African turquoise killifish. Nature Protocols. 11, (10), 2010-2028 (2016).
  29. Erickson, P. A., Ellis, N. A., Miller, C. T. Microinjection for Transgenesis and Genome Editing in Threespine Sticklebacks. Journal of Visualized Experiments. (111), e54055 (2016).
  30. Elipot, Y., Legendre, L., Père, S., Sohm, F., Rétaux, S. Astyanax transgenesis and husbandry: how cavefish enters the laboratory. Zebrafish. 11, (4), 291-299 (2014).
  31. Keene, A., Yoshizawa, M., McGaugh, S. Biology and Evolution of the Mexican Cavefish. Academic Press. New York, NY. (2015).
  32. Casane, D., Rétaux, S. Evolutionary Genetics of the Cavefish Astyanax mexicanus. Advances in Genetics. 95, 117-159 (2016).
  33. Mcgaugh, S., et al. The cavefish genome reveals candidate genes for eye loss. Nature Communications. 5, 5307 (2014).
  34. Yoshizawa, M., et al. Distinct genetic architecture underlies the emergence of sleep loss and prey-seeking behavior in the Mexican cavefish. BMC Biology. 13, (1), (2015).
  35. Ma, L., Jeffery, W. R., Essner, J. J., Kowalko, J. E. Genome editing using TALENs in blind Mexican cavefish, Astyanax mexicanus. PLoS ONE. 10, (3), (2015).
  36. Bilandzija, H., Ma, L., Parkhurst, A., Jeffery, W. A potential benefit of albinism in Astyanax cavefish: downregulation of the oca2 gene increases tyrosine and catecholamine levels as an alternative to melanin synthesis. PLoS ONE. 8, (11), e80823 (2013).
  37. Alie, A., et al. Developmental evolution of the forebrain in cavefish: from natural variations in neuropeptides to behavior. eLife. 7, e32808 (2018).
  38. Jaggard, J. B., et al. Hypocretin underlies the evolution of sleep loss in the Mexican cavefish. eLife. 7, e32637 (2018).
  39. Borowsky, R. Handling Astyanax mexicanus eggs and fry. Cold Spring Harbor Protocols. 3, (11), (2008).
  40. Varshney, G. K., Sood, R., Burgess, S. M. Understanding and Editing the Zebrafish Genome. Advances in Genetics. 92, 1-52 (2015).
  41. Wierson, W. A., et al. GeneWeld: a method for efficient targeted integration directed by short homology. BioRxiv. (2018).
  42. Klaassen, H., Wang, Y., Adamski, K., Rohner, N., Kowalko, J. E. CRISPR mutagenesis confirms the role of oca2 in melanin pigmentation in Astyanax mexicanus. Developmental Biology. (2018).
  43. Jao, L. E., Wente, S. R., Chen, W. Efficient multiplex biallelic zebrafish genome editing using a CRISPR nuclease system. Proceedings of the National Academy of Sciences of the United States of America. 110, (34), 13904-13909 (2013).
  44. Kwan, K. M., et al. The Tol2kit: A multisite gateway-based construction Kit for Tol2 transposon transgenesis constructs. Developmental Dynamics. 236, (11), 3088-3099 (2007).
  45. Kawakami, K., et al. A transposon-mediated gene trap approach identifies developmentally regulated genes in zebrafish. Developmental Cell. 7, (1), 133-144 (2004).
  46. Kowalko, J., Ma, L., Jeffery, W. Genome Editing in Astyanax mexicanus Using Transcription Activator-like Effector Nucleases (TALENs). Journal of Visualized Experiments. (112), e54113 (2016).
  47. Nishino, S., Ripley, B., Overeem, S., Lammers, G. J., Mignot, E. Hypocretin (orexin) deficiency in human narcolepsy. Lancet. (2000).
  48. Lin, L., et al. The sleep disorder canine narcolepsy is caused by a mutation in the hypocretin (orexin) receptor 2. Cell. (1999).
  49. Park, H. C., et al. Analysis of upstream elements in the HuC promoter leads to the establishment of transgenic Zebrafish with fluorescent neurons. Developmental Biology. 227, (2), 279-293 (2000).
  50. Higashijima, S., Masino, M. A., Mandel, G., Fetcho, J. R. Imaging Neuronal Activity During Zebrafish Behavior With a Genetically Encoded Calcium Indicator. Journal of Neurophysiology. (2003).
  51. Vladimirov, N., et al. Light-sheet functional imaging in fictively behaving zebrafish. Nature Methods. 11, (9), 883-884 (2014).
  52. Halpern, M. E., et al. Gal4/UAS transgenic tools and their application to zebrafish. Zebrafish. 5, (2), 97-110 (2008).
  53. Jaggard, J. B., Stahl, B. A., Lloyd, E., Prober, D. A., Duboue, E. R., Keene, A. C. Hypocretin underlies the evolution of sleep loss in the Mexican cavefish. bioRxiv. 7, e32637 (2018).
  54. Bedell, V. M., Westcot, S. E., Ekker, S. C. Lessons from morpholino-based screening in zebrafish. Briefings in Functional Genomics. (2011).
  55. Robu, M. E., et al. p53 activation by knockdown technologies. PLoS Genetics. (2007).
  56. Hisano, Y., et al. Precise in-frame integration of exogenous DNA mediated by CRISPR/Cas9 system in zebrafish. Scientific reports. 5, 8841 (2015).
  57. Prykhozhij, S., et al. Optimized knock-in of point mutations in zebrafish using CRISPR/Cas9. Nucleic Acids Res. 46, (17), (2018).
  58. Tessadori, F., et al. Effective CRISPR/Cas9-based nucleotide editing in zebrafish to model human genetic cardiovascular disorders. Disease Model Mechanisms. 11, (10), (2018).
  59. Armstrong, G., Liao, M., You, Z., Lissouba, A., Chen, B., Drapeau, P. Homology Directed Knockin of Point Mutations in the Zebrafish tardbp and fus Genes in ALS Using the CRISPR/Cas9 System. PLoS ONE. 11, (3), (2016).
  60. Friedrich, R. W., Jacobson, G. A., Zhu, P. Circuit Neuroscience in Zebrafish. Current Biology. 20, (8), (2010).
  61. Friedrich, R. W., Genoud, C., Wanner, A. A. Analyzing the structure and function of neuronal circuits in zebrafish. Frontiers in Neural Circuits. 7, (2013).
  62. Scott, E. K., et al. Targeting neural circuitry in zebrafish using GAL4 enhancer trapping. Nature Methods. 4, (4), 323-326 (2007).
  63. Asakawa, K., Kawakami, K. Targeted gene expression by the Gal4-UAS system in zebrafish. Development Growth and Differentiation. (2008).
  64. Lloyd, E., et al. Evolutionary shift towards lateral line dependent prey capture behavior in the blind Mexican cavefish. Developmental Biology. (2018).
מניפולציה של פונקציית ג'ין Cavefish מקסיקני
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Stahl, B. A., Jaggard, J. B., Chin, J. S. R., Kowalko, J. E., Keene, A. C., Duboué, E. R. Manipulation of Gene Function in Mexican Cavefish. J. Vis. Exp. (146), e59093, doi:10.3791/59093 (2019).More

Stahl, B. A., Jaggard, J. B., Chin, J. S. R., Kowalko, J. E., Keene, A. C., Duboué, E. R. Manipulation of Gene Function in Mexican Cavefish. J. Vis. Exp. (146), e59093, doi:10.3791/59093 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter