Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Manipulação de função do Gene em Cavefish mexicano

Published: April 22, 2019 doi: 10.3791/59093

Summary

Descrevemos abordagens para a manipulação de genes no sistema modelo evolucionista Astyanax mexicanus. São descritas três técnicas diferentes: transgênese mediada por Tol2, alvo de manipulação do genoma usando CRISPR/Cas9 e nocaute de expressão usando morpholinos. Essas ferramentas devem facilitar a investigação direta de genes subjacentes a variação entre as formas de superfície - e caverna-moradia.

Abstract

Caverna de animais fornecem um sistema convincente para investigar os mecanismos evolucionários e bases genéticas subjacentes alterações em numerosos traços complexos, incluindo a degeneração do olho, albinismo, perda do sono, hiperfagia e processamento sensorial. Espécie de cavefish de todo o mundo exibe uma evolução convergente de características morfológicas e comportamentais devido a pressões ambientais compartilhadas entre sistemas diferentes de caverna. Caverna de diversas espécies foram estudadas na configuração de laboratório. O tetra mexicano, Astyanax mexicanus, com formas de videntes e cegas, forneceu insights exclusivas em processos biológicos e moleculares subjacentes a evolução dos traços complexos e é bem preparado como um sistema modelo emergente. Enquanto genes candidatos regulamenta a evolução de diversos processos biológicos foram identificados na. mexicanus, a capacidade de validar um papel para genes individuais tem sido limitada. A aplicação de transgênese e gene-edição tecnologia tem o potencial para superar este obstáculo significativo e investigar os mecanismos subjacentes a evolução dos traços complexos. Aqui, descrevemos uma metodologia diferente para manipular a expressão gênica na . mexicanus. Abordagens incluem o uso de morpholinos, Tol2 transgênese, e sistemas de edição de gene, comumente usados em zebrafish e outros peixes de modelos, para manipular a função do gene na . mexicanus. Estes protocolos incluem descrições detalhadas dos procedimentos de reprodução programada, a coleção de ovos fertilizados, injeções e a seleção de animais geneticamente modificados. Permitirão que estas abordagens metodológicas para a investigação dos mecanismos genéticos e neurais subjacentes a evolução dos diversos traços na . mexicanus.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Desde a Origem das espéciesde Darwin1, cientistas ganharam profundos insights sobre como traços são dados forma evolutivamente em resposta a pressões ecológicas e ambientais definidas, graças a caverna organismos2. O tetra mexicano, a. mexicanus, consiste em olhos populações 'superfície' ancestrais que habitam rios em todo o México e sul do Texas e pelo menos 29 populações geograficamente isoladas da caverna derivada morfos que habitam a Sierra del Abra e outras áreas do México nordeste3. Foram identificados vários traços associada a caverna em a. mexicanus, incluindo o consumo de oxigênio alterados, despigmentação, perda de olhos e alterada a alimentação e forrageamento comportamento4,5,6, 7,8,9. A. mexicanus apresenta um poderoso modelo para investigar mecanismos de evolução convergente, devido a uma história evolutiva bem definida, uma caracterização detalhada do ambiente ecológico e a presença de forma independente evoluiu caverna populações de10,11. Muitos dos traços que estão presentes no cavefish, incluindo perda de olhos, dormir perda, aumentaram a alimentação, perda de escolaridade, reduziram a agressão e reduziram respostas de estresse, evoluíram várias vezes através de origens independentes, muitas vezes utilizando derivados de caverna diferentes vias genéticas entre cavernas8,12,13,14,15. Esta evolução é um aspecto poderoso do sistema da . mexicanus e pode fornecer insights sobre a questão mais geral de sistemas como a genéticas podem ser perturbado para gerar fenótipos similares repetida.

Enquanto a aplicação da tecnologia genética para a investigação mecanicista da função dos genes tem sido limitada em muitas espécies de peixes (incluindo a. mexicanus), avanços recentes no zebrafish fornecem uma base para o desenvolvimento de tecnologia genética em peixes 16,17,18,19,20. Inúmeras ferramentas são amplamente utilizadas no zebrafish para manipular a expressão gênica, e a implementação desses procedimentos há muito tempo tem sido padronizado. Por exemplo, a injeção de Morpholinos oligos (MOs) na fase de célula única seletivamente bloqueia RNA e impede que a tradução para uma janela temporal breve durante desenvolvimento21,22. Além disso, gene-edição abordagens, tais como agrupados regularmente intercaladas curtas palíndromos repetições (CRISPR) / CRISPR-associados proteína 9 (Cas9) e nuclease efetoras como ativador de transcrição (TALEN), que permite a geração de exclusões definidas ou, em alguns casos, inserções através de uma recombinação em genomas19,20,23,24. Transgênese é usada para manipular a expressão de gene estável ou função de uma maneira específica do tipo de célula. O sistema Tol2 é utilizado com eficácia para gerar animais transgénicos por coinjecting transposase mRNA com um plasmídeo de DNA Tol2 contendo um transgene25,26. O sistema Tol2 utiliza o transposase Tol2 de medaka para gerar inserções germline estável de construct17 transgénicos. Gerar Tol2 transgênicos envolve coinjecting um plasmídeo contendo um transgene ladeado por sites de integração Tol2 e mRNA para Tol2 transposase17. Este sistema tem sido usado para gerar uma matriz de linhas transgénicas no zebrafish e seu uso se expandiu recentemente para sistemas modelo emergente adicionais, incluindo ciclideos, killies, o pauzinho e, mais recentemente, o mexicano cavefish27, 28,29,30.

Enquanto o cavefish é um fascinante sistema biológico para elucidar os mecanismos da evolução do traço, sua capacidade plena como um modelo evolucionista não tem sido totalmente aproveitada. Isto tem sido parcialmente devido a uma incapacidade de manipular genética e celular funcionar diretamente31. Genes candidatos regulação complexos traços foram identificados usando estudos de loci (QTL) característica quantitativa, mas a validação destes genes candidatos tem sido difícil32,33,34. Recentemente, nocaute transiente usando morpholinos, gene edição usando sistemas CRISPR e TALEN e o uso do Tol2-transgênese mediada têm sido usados para investigar a base genética subjacente a um número de traços,35,36,37 ,38. A implementação e padronização destas técnicas permitirá manipulações que interrogar os fundamentos moleculares e neurais de traços biológicos, incluindo a manipulação da função do gene, a rotulagem de populações de células definidos, e a expressão de repórteres funcionais. Considerando que o sucesso da implementação destas ferramentas genéticas para manipular o gene ou função celular tem sido demonstrada em sistemas modelo emergente, protocolos detalhados ainda são carentes da . mexicanus.

A. mexicanus fornecem a introspecção crítica dos mecanismos da evolução em resposta a um ambiente em mudança e a oportunidade de identificar novos genes regulando diversos traços do presente. Um número de fatores sugere que a. mexicanus é um modelo extremamente tractable para aplicar ferramentas genómicas estabelecidas atualmente disponíveis em modelos genéticos estabelecidos, incluindo a capacidade de facilmente manter peixes nos laboratórios, tamanho grande ninhado, transparência, um genoma sequenciado e ensaios comportamentais definidos39. Aqui, descrevemos uma metodologia para o uso de morpholinos, transgênese e gene edição na superfície e caverna populações da . mexicanus. A aplicação mais ampla dessas ferramentas na . mexicanus permitirá uma investigação mecanicista sobre os processos moleculares subjacentes a evolução das diferenças de desenvolvimento, fisiológicas e comportamentais entre cavefish e peixes de superfície.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Morpholinos oligo projeto

Nota: As sequências para a. mexicanus estão disponíveis através do centro nacional de Biotechnology Information (NCBI) Gene e NCBI SRA (https://www.ncbi.nlm.nih.gov), bem como a partir do navegador de genoma de Ensembl (https://www.ensembl.org). Ao projetar um Morpholinos para uso em ambas as formas da superfície - e caverna-moradia, é crítico para identificar qualquer variação genética entre o morfos nesta fase, para que estas regiões genéticas podem ser evitadas como alvos de morpholinos. Qualquer variação polimórfica dentro de um site de destino Morpholinos pode levar a vinculação ineficaz. O projeto é similar a outros sistemas de peixe, como o peixe-zebra e anteriormente foi mostrado para trabalhar eficazmente na . mexicanus21,36,40.

  1. Projeto de tradução-bloqueio morpholinos
    Nota: Tradução-bloqueio morpholinos bloquear tradução ligando-se o local de início endógeno e dificultar translacional máquinas de vinculação a sequência do mRNA através de impedimento estérico hinderance.
    1. Identifica a região codificante do gene do alvo, começando com o site de início ATG.
    2. Registre os primeiros 25 pares de bases da sequência de destino por copiar-e-colar a sequência em um caderno de laboratório ou editor de texto.
    3. Usando o software on-line (por exemplo, http://reverse-complement.com) ou tradução manual, gere o complemento reverso da sequência de destino. Salve o complemento inverso resultante em um editor de texto ou um caderno de anotações.
    4. Encomendar um Morpholinos com a sequência inversa de complemento de uma empresa que gera Morpholinos oligonucleotides. Consulte Tabela de materiais para empresas.
  2. Design de bloqueio da tala morpholinos
    Nota: Splice-bloqueio morpholinos bloquear o splicing e, assim, evitar a formação de uma molécula de mRNA maduro. Isto fornece um método alternativo para nocaute quando os locais de início não estão bem definidos, ou uma abordagem mais ideal quando se deseja uma validação de nocaute através da reação em cadeia da polimerase (PCR). Este benefício do bloqueio da tala morpholinos (sobre bloqueio de ATG MOs) é essa exclusão exon ou inclusão intrão pode ser prontamente avaliada com transcriptase reversa (RT)-PCR e visualizadas em um gel de diferenças de tamanho. Eletroforese de gel e RT-PCR para determinar a eficácia de Morpholinos deve ser feita usando os procedimentos padrão do laboratório.
    1. Identifica a sequência de pre-mRNA do gene do alvo. Utilize a informação disponível do genoma da . mexicanus via NCBI ou Ensembl para determinar os limites de intron-exon33.
    2. Exão-intron (tala doador) ou sites de limite (acceptor splice) intron-exon para exclusão de inclusão ou exon intrão de alvo.
      Nota: O spliceossoma normalmente metas uma sequência de "GU" (alvo de U1) no intrão no local da tala 5' e uma sequência de AG' 'no 3' (U2 local de destino) intrônicas da tala. Em condições normais, o spliceossoma U1 e U2 subunidades vinculam esses sites de destino na sequência pre-mRNA para a emenda adequada para ocorrer. No entanto, se qualquer dessas sequências alvo é bloqueada por um Morpholinos, o spliceossoma vai passar a próxima disponível U1 e U2 site, causando uma exclusão intrão ou exon na sequência do mRNA. Isso envolverá planejamento/otimização, dependendo da natureza do gene alvo21. Geralmente, bloquear um site interno de U1 redireciona a tala para o próximo site disponível U1, causando uma excisão exon. Alternativamente, bloquear a primeiro ou último da tala junção faz com que uma inclusão intrão porque não há nenhum outro site para redirecionar a tala para. Use software de sequência para prever o efeito de várias exclusões e inclusões. Previsões podem indicar potenciais frameshifts ou códons de parada prematuro, indicando um site de destino mais eficaz para interrupção de mRNA.
    3. Uma vez que o local de destino é identificado, registre sua sequência em um livro de laboratório ou editor de texto. Verifique se que o local de destino é 25 pares de bases (bp) longos.
    4. Usando o software on-line (por exemplo, http://reverse-complement.com) ou tradução manual, gere o complemento reverso da sequência de destino. Registre sua sequência em um livro de laboratório ou editor de texto.
    5. Encomendar um Morpholinos com a sequência inversa de complemento de uma empresa que gera Morpholinos oligonucleotides. Consulte Tabela de materiais para as empresas da amostra.

2. Morpholinos para injeção

Observação: Várias concentrações ou volumes de injeção MO precisará ser realizada para estabelecer a concentração ideal para injetar. Quantidades típicas injeções são 400 – 800 pg do MO. O efeito de Morpholinos nocaute pode persistir por até 6 postinjection dias.

  1. Obter o estoque Morpholinos. O estoque Morpholinos chega liofilizado. Hidratá-lo com estéril antes do2O H uso na concentração estoque desejada (por exemplo, 4 mM). Armazenar a-20 °C até o uso.

3. CRISPR gRNA design, in vitro a transcrição e preparação

  1. Projeto de gRNA CRISPR
    Nota: gRNAs foram gerados usando pesquisa publicada anteriormente por Vieira et al40 e Wierson et al.41.
    1. Usando um navegador de genoma, identifica a região codificante do gene de interesse. Usando a sequência genômica, identificar a sequência de destino gRNA dentro de um exão procurando por um 20 bp nucleotídeos alvo sequenciamento que começa com GG e seguido por uma sequência de PAM (NGG). Uma região do gene após o início (ATG) será orientado.
      Nota: Se uma sequência do alvo com GG na extremidade 5' não pode ser encontrada no desejado exon do gene, um ou ambos o G's pode ser substituído para os primeiros e o segundo nucleotídeos na extremidade 5' da sequência. No entanto, o dois G ''s devem ser incorporados em oligo, como estes são necessários para a transcrição de T7.
    2. Projetar e encomendar um gene específico do oligonucleotide (oligo r: 5'-TAATACGACTCACTATAGGNNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGAAATAGC-3'). Adicione o gene-específico 20 bp gRNA sequência de destino (em negrito) sem a sequência de PAM entre uma sequência de promotor T7 (vermelha) e uma sequência de sobreposição costumava recoze a um segundo do oligonucleotide (azul). Recoze e amplificar (ver passo 3.2.1) este oligo A e um segundo oligo (oligo b: 5'-GATCCGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTT AACTTGCTATTTCTAGCTCTAAAAC-3') para gerar o modelo de gRNA usado para a transcrição.
      Nota: Oligo B é a mesma para cada reação e só precisam ser encomendado 1x.
  2. transcrição e preparação de gRNA
    1. Recoze e amplificar os oligos. Incluem os seguintes primers para amplificar a gRNA para aumentar o rendimento: 5'-TAATACGACTCACTATA-3' (T7 primer) e 5'-GATCCGCACCGACTCGGTG-3' (3' gRNA cartilha). Realize uma PCR utilizando polymerase de Thermococcus kodakaraensis (código).
      Nota: Para as duas primeiras demão em oligo A e B de oligo, 10 ciclos é recomendado para um bom rendimento. Um protocolo detalhado pode ser encontrado no Wierson et al.41.
    2. Transcreva a gRNA usando kits de transcrição in vitro comercialmente disponíveis (ver Tabela de materiais). Isto é feito através de modificações para o fabricante'protocolo s publicado pela Klaassen et al.42.
    3. Precipitar, lavar e ressuspender a gRNA conforme descrito por Klaassen et al.42.
      Nota: A gRNA deve ser resuspended em água livre de RNase para evitar a degradação.
    4. A concentração da gRNA, que pode ser determinado usando um Espectrofotômetro de registro. Avalie a qualidade do RNA executando 2 µ l em um gel de agarose. Alíquota RNA para evitar o congelamento/descongelamento e armazená-lo a-80 °C até imediatamente antes das injecções.
  3. Transcrição e preparação Cas9
    1. Cas9 mRNA pode ser transcrito usando kits de transcrição in vitro comercialmente disponíveis (ver Tabela de materiais) conforme descrito anteriormente,43. Use a versão nls-Cas9-nls43.
    2. Gravar a concentração da gRNA e avaliar sua qualidade executando 2 µ l em um gel de agarose. Alíquota RNA para evitar a decomposição que surge através de vários ciclos de congelamento e descongelamento e armazenar as alíquotas a-80 °C.

4. preparação de construções Tol2 Tol2 transposase e transgênese

  1. Prepare Tol2 transgene construções para injeção.
    Nota: Nós têm utilizado com sucesso zebrafish publicados/disponíveis e medaka constrói na . mexicanus. Essas construções são totalmente funcionais em a. mexicanus, provavelmente por causa do elevado nível de homologia de sequência (consulte o repositório de AddGene e a rede de informação do Zebrafish [ZFIN] bases de dados para construções disponíveis). Os fragmentos de promotor zebrafish expressaram os transgenes nos tecidos esperados quando usado em a. mexicanus.
    1. Tol2 construções de adquirir ou gerar plasmídeo com um promotor de tecido-específica, o transgene desejado e braços Tol2 (veja Kwan et al.44). Após a recepção, Sequencie o construção para validar o plasmídeo.
    2. Executar um midiprep para construções de acordo com o fabricante de'diretrizes de s. Eluir o plasmídeo final em livre de RNase H2O, determinar a concentração com um espectrofotômetro, diluir a concentração de 100300 ng /μL e a alíquota e a loja as construções entre-20 °C.
  2. Tol2 transposase plasmídeo de digerir e sintetizar o mRNA.
    1. Obtenha uma cópia do plasmídeo de transposase do Tol2 (pCS-zT2TP) como um modelo para a geração de mRNA Tol245.
    2. Midiprep o pCS-zT2TP construir de acordo com o fabricante de'diretrizes de s. Elui-lo em um volume baixo de água livre de RNase ou buffer (~ 50 μL). Armazenar as alíquotas a-20 °C.
    3. Digeri o plasmídeo Tol2 usando uma enzima de restrição.
      1. Execute um digest de restrição em 10 µ g de plasmídeo circular pCS-zT2TP usando a tabela 1.
      2. Dividir a reação em 250 μL as reações e incubar as reações durante a noite a 37 °C em um termociclador.
      3. No dia seguinte, inativar a enzima aquecendo a 65 °C por 20 min.
      4. Purifica o plasmídeo linear imediatamente após o resumo, usando comercialmente disponível do PCR purificação kits (ver Tabela de materiais) pelas orientações de fabricantes' . Eluir o plasmídeo em 15 μL de livre de RNase H2O e determinar a concentração do produto utilizando um espectrofotômetro.
      5. Executar 1 μL do plasmídeo digerido e 1 μL do plasmídeo sem cortes em um agarose 1,5% gel para confirmar o plasmídeo linear.
    4. Execute uma in vitro a transcrição do mRNA Tol2.
      1. Utilize 1 µ g de plasmídeo linear pCS-zT2TP como um modelo para a transcrição. Siga o fabricante'diretrizes de s para in vitro a transcrição (ver Tabela de materiais), conforme descrito na tabela 2.
      2. Incube a 37 °C em um termociclador pelo fabricante'diretrizes de s.
      3. Adicionar 1 µ l de DNase, incubar a 37 °C em um termociclador pelo fabricante'diretrizes de s.
      4. Execute a precipitação de cloreto de lítio por protocolo do kit de transcrição. Resuspenda o pellet de RNA em ~ 2030 μL de livre de RNase H2O.
      5. Determinar a concentração do produto usando um espectrofotômetro e gravar a qualidade do RNA.
      6. Diluir o produto de 100 ~ 300 ng / µ le alíquota em 5 amostras de 10 μL de, para evitar o congelamento e descongelamento repetido. Armazená-los a-80 °C até o uso.
        Nota: É possível verificar 12 µ l de mRNA de Tol2 purificado para esfregaço/banda com eletroforese em gel.

5. microinjeções

  1. Preparação de ferramentas gerais para injeções
    Nota: Os procedimentos nesta seção têm sido descritos em detalhe por Kowalko et al.46, e uma visão geral com pequenas modificações é aqui apresentada.
    1. Gere placas de injeção derramando quente agarose a 3% dissolvido na água do sistema de peixe em um prato de Petri de 100 mL. Cuidadosamente coloque um molde de injeção de ovo o agarose recém derramado para fazer poços para os ovos de peixe. Coloque o lado do molde em ágar em um ângulo de 45° e, em seguida, abaixe lentamente no agarose; lentamente, diminuir o molde em um ângulo evita ar ficando preso por baixo do molde. Retire com cuidado o molde, uma vez que a agarose é solidificado. As placas podem ser armazenadas, selado, a 4 °C por até 1 semana.
    2. Puxe agulhas de capilares de vidro de borosilicato para injeção em um extrator de eletrodo/agulha de acordo com o fabricante de'diretrizes de s. Este protocolo irá variar por extrator de pipeta; no entanto, um programa de puxar a agulha de amostra pode ser encontrado na tabela 3.
      Nota: Otimizando a agulha é importante para injeções, como agulhas, que são muito longas vão dobrar ao invés de limpa penetrar o óvulo.
    3. Fazer pipetas de vidro de grande diâmetro para a transferência do ovo quebrando pipetas de vidro padrão para que a abertura é grande o suficiente para os ovos. Usando um bico de Bunsen, polonês final do vidro quebrado, expondo o fim das pipetas quebrados da chama até que esteja lisa.
  2. Configuração de reprodução
    Nota: Existem muitos diferentes protocolos utilizados para reprodução a. mexicanus. Para um protocolo detalhado, consulte Borowsky39. Inicie a instalação do reprodução 1 semana antes as injeções.
    1. No dia 1, coloque duas ou três fêmeas e três ou quatro machos em um tanque único galão 10 mantido 24 ± 1 °C.
    2. Nos dias 1,7, aumente a alimentação de ~ 3x por dia. Assegurar que a dieta inclui alimentos vivos, tais como larvas pretas e artémia.
    3. No dia 6, adicionar um aquecedor de tanque único conjunto a 27 °C. Lab pode variar a temperatura do tanque; Portanto, este será um aumento de 2parente de 3 °C para a temperatura do tanque normal.
    4. Na noite do dia 7, que é a noite (zeitgeber [ZT] 911) da noite de injeção, cuidadosamente limpar os tanques com uma esponja embebida em água e retire qualquer excesso de comida ou detritos usando uma rede de malha fina ou um sifão.
    5. Na noite do dia 7, começar a olhar para ovos de peixes de superfície no ZT15 e continuar a verificar a cada 1530 min até ZT18. Para cavefish, começar a olhar para ovos em ZT17 e continuar a verificar a cada 1530 min até ZT20.
      Nota: Os tempos são baseados em um 14:10 ciclo h luz: escuro usando zeitgeber tempo. Tempos de reprodução são estimativas e laboratórios individuais devem determinar exatamente em quantas vezes. É fundamental para recolher os ovos logo depois de serem liberados/fertilizados para injetá-las na fase de célula única.
  3. Coleção de ovos de célula única fase
    1. Na noite em que a reprodução é esperada, examine os tanques cada 1530 min e monitor para os ovos na parte inferior do tanque. Ovos aparecem translúcidos, medindo aproximadamente 1 mm de diâmetro.
    2. Use uma rede de pesca de malha fina para recolher os ovos e transfira para uma tigela de vidro cheia de água do sistema de peixe fresco. Examine os ovos sob um microscópio para confirmar que os ovos estão na fase de uma célula.
    3. Usar pipetas de vidro, transferi ovos de célula única para as placas de injeção. Pipetas de vidro são necessárias nesta fase, como os ovos vão ficar com o plástico.
    4. Utilizando uma pipeta, cuidadosamente liberar os ovos nos poços da placa de injeção de agarose da seção 5.1. Preencher as linhas da placa de injeção escaldadas (à temperatura ambiente) com o número máximo de ovos (3040 por linha e até cinco linhas). Total de linhas ajuda a manter os ovos de movimentação durante as injeções. Mantenha os ovos hidratados na placa de injeção com uma pequena quantidade de água do sistema de peixes até o desempenho das injeções.
  4. Instalação de pico-injeção e diretrizes de otimização de injeção geral
    1. As agulhas de injeção com pipeta ou gel de carregamento dicas que cabem dentro do capilar ou usando pontas de micropipeta padrão e adicionar um bólus de 4 µ l de2 ao final de aterramento. Uma vez que a agulha está cheio, use fórceps para aparar o excesso de comprimento da agulha da injeção.
    2. Execute usando uma agulha montada em um micromanipulador, conectado a um microinjector de picoliter de alevinos.
    3. Definir o tempo de injeção para 0,03 s e a pressão para fora a ~0.0 psi. A pressão de injeção varia em conformidade com pequenas diferenças entre as agulhas, então otimizar para alcançar um bólus de injeção ~1.0 nL.
      Nota: A pressão de injeção é frequentemente no intervalo de ~ 1030 libras por polegada quadrada.
    4. Padronizar o bólus de injeção injetando óleo mineral e medindo o bólus de tamanho com um micrômetro de slide para alcançar um ~ 11.5 volume de injeção de nL. Ajuste a pressão de injeção (psi) para aumentar ou diminuir o volume em bolus.
    5. Tirar água do topo dos ovos usando um tecido de laboratório.
      Nota: O córion de ovo de Astyanax é ligeiramente mais difícil de penetrar que ovos de zebrafish. Achamos que a água da parte superior dos ovos de desenho ajuda a facilitar penetração de agulha dentro do ovo. Pode permitir a otimização da placa ~ 200 ovos em um prato único.
    6. Use o micromanipulador para penetrar cada ovo com a agulha e injetar diretamente a gema. Uma vez posicionada a gema, injete o ovo pressionando o pedal do pé inject botão ou injeção.
      Nota: Um prato cheio pode ser injetado dentro de ~ 15 min. O estágio de célula única dura ~ 40 min.
  5. Injeção de morpholinos
    Nota: A quantidade de Morpholinos necessárias por nocaute sem causar toxicidade precisará ser otimizado por destino do gene; no entanto, uma concentração de 400 pg é um bom lugar para começar.
    1. Prepare Morpholinos para que 400 pg de Morpholinos será injetado por ovo. Degelo Morpholinos no gelo. A solução da injeção é composta de Morpholinos (na concentração desejada), livre de RNase H2O ou Danieau'solução de s e vermelho de fenol (10% do volume final). Para obter um exemplo, consulte a tabela 4.
    2. Injectar 1 nL por embrião.
  6. Injeções de CRISPR
    1. Preparação do RNA pg 25 de gRNA e 300 pg de Cas9 mRNA total serão injetados por embrião. Para uma mistura de injeção de amostra CRISPR/Cas9, consulte a tabela 5.
    2. Injetar 2 nL de gRNA/Cas9 mRNA por embrião diretamente para o embrião.
  7. Injeção de Tol2 transposase e plasmídeo Tol2-ladeado por transgênese
    1. Descongelar o transposase mRNA e Tol2 plasmídeo no gelo. Combinam Cas9 mRNA (a 25 ng / µ l), construção de Tol2 desejada (25 ng /μL) e vermelho de fenol (10% do volume final) em água livre de RNase. Para uma mistura de injeção de transgênese Tol2 de amostra, consulte a tabela 6.
    2. Mantenha a solução da injeção e agulhas no gelo para evitar a degradação do mRNA. Injetar na 1 nL em volume por embrião.

6. criação e seleção de peixes injetados

  1. Criação de peixes injetado
    1. Depois que os ovos são injetados, imediatamente transferi-los para taças de vidro (10 x 5 cm) cheias ~ 200 mL de água do sistema de peixe. Ovos são facilmente lavados por mergulhando as placas injeção taças cheias de peixe água e enxaguar os ovos com uma pipeta.
    2. Coloque ~ 5080 embriões injetados por tigela e traseiro-los 22, 24 °C.
    3. Limpe as tigelas com peixe injetado 2 x por dia para remover os embriões mortos e alterar ~ 20% da água diariamente.
    4. Criação de adicional é efectuado de acordo com protocolos previamente publicados39.
  2. Triagem de indivíduos Morpholinos-injetado
    1. Visualize os animais sob um estereomicroscópio para triagem de fenótipos. O efeito de morpholinos pode persistir até a ~ 5 dias postinjection21.
    2. Medida fenótipos comportamentais em postinjection de 4 dias.
  3. Triagem para CRISPR puntuais
    1. Desenho de primers para amplificar DNA genômico em torno do local de destino. Projetar as primeiras demão para que o produto PCR do alvo é de aproximadamente 100125 bp.
      Nota: por exemplo, para o locus de oca2 , a região que circunda o local de destino de gRNA foi amplificado utilizando a cartilha frente 5'-CTCCTCTGTCAGGCTGTGC-3' e o reverso da primeira demão 5'-GAAGGGGATGTTGTCTATGAGC-3' para um comprimento de produto PCR de 105 PA.
    2. Sacrificar os embriões ou barbatana de peixe adulto de clip de acordo com o protocolo institucional animal.
    3. Coletar embriões ou barbatanas dissecadas em cadeia da polimerase e extrair DNA e executar os protocolos PCR PCRs. amostra para primeiras demão gene-específico podem ser encontradas em Ma et al.35.
    4. Para avaliar para mutagénese, executar 5 µ l de produto PCR em um gel de agarose a 3% em 70 V para h. 3 tipo selvagem (nonmutagenized) DNA resultará em um produto PCR como um grupo distinto. DNA mutante resultará numa banda manchada no gel.
    5. Para determinar a sequência de alelos mutantes, TA clonar o produto do PCR de acordo com o fabricante de'instruções de s, escolher as colónias e culturas de miniprep. Envie o DNA resultante para o sequenciamento.
    6. Para estabelecer e manter as linhas de transmissão de alelos mutantes de peixe, Cruz adulto injetado peixe peixe selvagem-tipo e tela 510 embriões para determinar se qualquer um dos descendentes carregam um alelo mutante do gene 6.3.1-6.3.6 passos a seguir.
      Nota: Indivíduos de1 F diferentes do mesmo peixe F0 fundador podem transportar diferentes mutações. Certifique-se de linhas mutantes são sequenciadas para obter mutações previstas para produzir alelos que estão fora do quadro.
    7. Identifica peixes portadores de um alelo mutante por PCR usando o ensaio da banda manchada (passos 6.3.1-6.3.6) ou através da concepção de iniciadores de PCR alelo-específico que amplificarão mutante e bandas de tipo selvagem (Figura 2).
    8. Quando é estabelecida uma linha de peixe, homozygose alelos mutantes para testar fenótipos recessivos.
  4. Triagem para indivíduos positivos transgênicos
    Nota: Usando construções contendo um fabricante fluorescente é recomendado para agilizar a triagem para indivíduos positivos transgénicos. No entanto, PCR padrão métodos de triagem pode ser usado para triagem de transmissão.
    1. Visualize o tecido-específica proteínas fluorescentes em peixes de F0 logo em postinjection de 2 dias, com uma escopo de dissecação de epifluorescência.
      Nota: A expressão em larvas de F0 é mosaico, e os indivíduos positivos podem ter uma variedade de fenótipos de expressão.
    2. Manter os indivíduos positivos como F0 fundador peixes.
    3. Quando F0s atingem a maturidade, retrocruzamiento fundador peixe para indivíduos nontransgenic derivados o mesmo estoque de população/laboratório. Tela F1 prole usando o mesmo protocolo, conforme descrito na etapa 6.2.
      Nota: A expressão em larvas de1 F é uniforme e garante a consistência entre irmãos de1 F.
    4. Desde Tol2 integração não é mediada por local e integração pode variar entre os fundadores, selecione irmãos de F1 derivado de um único fundador de0 F e produz híbridos positivo-expressando os irmãos1 F para gerar F2s. Esta prole será a base para uma linha estável.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Várias populações da caverna-moradia a. mexicanus mostram redução de sono e vigília/atividade aumentada em relação à sua superfície-moradia coespecíficos14. Hipocretina/Hipocretina (HCRT) é um neuropeptídeo altamente conservado, que atua para aumentar a vigília, e aberrações na via HCRT causam narcolepsia em humanos e outros mamíferos47,48. Nós demonstramos anteriormente naquela caverna a. mexicanus aumentaram a expressão do peptídeo HCRT, sugerindo que um aumento da expressão deste peptídeo pode fundamentam a perda de sono no cavefish38. O nocaute de MO de expressão hcrt fornece uma abordagem poderosa para examinar diretamente o efeito do aumento hcrt expressão mediando a perda de sono no cavefish.

Para examinar a relação entre a expressão de hcrt e sono, nós projetamos um Morpholinos bloqueio de tradução. A bp de alvos os primeiros 25 MO do exon, incluindo o ATG iniciar site (figura 1A,B). Como um controle, utilizamos um controle comercialmente disponível de MO mexido (figura 1B). Usando o algoritmo de explosão no NCBI, confirmamos que não há efeitos fora do alvo para qualquer MO durante todo o genoma (dados não mostrados). A. mexicanus peixe de superfície e Pachón cavefish foram criados e seus ovos eram coletados e injetou com 400 pg de MO em um 1 nL-volume na fase de uma célula (Figura 1,D). Os peixes foram levantados para dpf 4 e então medidos por atividade e comportamento de sono.

Caverna a. mexicanus injetado com o controle MO exibida atividade significativamente mais locomotor e reduzido o sono durante um período de 24 h em relação ao peixe de superfície também injetados com a MO mexido (Figura 1E,F), sugerindo que não há efeito do controlar Morpholinos injeções como os resultados são consistentes com padrões de atividade e sono publicados anteriormente em cada Morfotipo (t = 5.021, df = 88, p < 0,0001). A injeção de HCRT-MO tinha pouco efeito sobre o sono em peixes de superfície em relação ao controle-injetado peixe (t = 0.17, df = 88, p > 0,99). Em contraste, hcrt nocaute através da injeção de MO teve um efeito significativo sobre o sono em peixes de cavernas. Pachón cavefish larvas mostraram menos do que uma redução de quatro vezes na atividade locomotora e dormir quase duas vezes mais do que controlar Pachón larvas (Figura 1E,F; t = 2.694, df = 88, p < 0,05). Uma comparação da atividade locomotora e sono em peixes de superfície - e caverna-moradia MO-nocaute revelou quantidades comparáveis de locomoção e sono (figura 1E, F). Estes dados fornecem uma ligação directa entre a expressão de hcrt e perda de sono e fornecem um método para interrogar os mecanismos biológicos para a perda de sono no morfos evolutivamente derivado de cavernas.

Perda de pigmentação é uma característica dos organismos de caverna e várias populações de Astyanax cavernas demonstram perda de pigmentação. Albinismo em Molino e Pachón cavefish foi mapeado usando mapeamento de QTL para uma região genômica contendo o gene, albinismo ocular 2 (oca2), sugerindo que mutações em oca2 fundamentam albinismo em cavefish6.

Para validar o oca2 como o locus causal para albinismo em Pachón caverna morfos, utilizamos o CRISPR/Cas9 gene edição para transformar esta região em populações de peixes de superfície. Desde que o exon 21 é excluído no Molino peixe6, nós projetamos uma gRNA para atingir esta região do gene (Figura 2A). A sequência genômica, incluindo a sequência do alvo de gRNA e o PAM (em negrito), é 5'-GGTCATGTGGGTCTCAGCTTro-3 '. Esta sequência de destino (sem a sequência de PAM) foi usada para gerar uma gRNA para mutagénese alvo. Criadores de superfície foram feitos para acasalar, e os embriões resultantes foram coletados na fase de uma célula. Uma célula estágio foram injetados com Cas9 mRNA e direcionamento de gRNA- oca2, e os animais injetados foram levantados a idade adulta,43. Os adultos injetados foram feitos para acasalar para peixes de superfície tipo selvagem, e os embriões de cruzes foram genótipo para determinar a transmissão de germinal, usando as primeiras demão da etapa 6.3.1. Nós sequenciado um alelo mutante oca2 e identificou uma exclusão de bp 2 germe-linha-transmitida em oca2 (Figura 2B,C). Para facilidade de genotipagem, nós projetamos primers alelo-específico para identificar os alelos selvagem-tipo e do mutantes (Figura 2D) e genótipo peixe, usando PCR seguido por eletroforese em gel (Figura 2E). Nós incrossed superfície peixes heterozigotos para o alelo mutante oca2. A descendência resultante foram pigmentada ou albino (Figura 2F-eu). Indivíduos pigmentados eram selvagem-tipo ou heterozigotos para o locus oca2, enquanto indivíduos albinos eram homozigoto mutante (Figura 2E). Estes dados fornecem uma ligação directa entre o locus do gene oca2 e albinismo na . mexicanus cavefish.

Inumeráveis comportamentos tais como sono, alimentação e estresse diferem na . mexicanus cavefish em relação à superfície coespecíficos, contudo os determinantes neuronais subjacentes entre morfos permanecem obscuros. Imagem latente do cérebro de todo o cálcio fornece uma poderosa abordagem imparcial para examinar as correlações entre a atividade neural alterada e comportamento modificado. Geramos peixe de superfície e cavefish com uma expressão neuronal próximo-ubiquitous do indicador de cálcio geneticamente codificado, GCaMP6s, usando reagentes amplamente utilizados na investigação de zebrafish. DROSÃ-como neurônio-específico do RNA - proteína obrigatória 3 (elavl3) é expresso endogenamente em neurônios recém diferenciados em todo o sistema nervoso central49 e tem sido usado no zebrafish para dirigir a expressão de proteínas durante todo a maioria do sistema nervoso50. Obtivemos uma construção Tol2 contendo ~2.8 kb zebrafish elavl3 promotor transcrição acima do indicador de cálcio geneticamente codificado GCaMP6s (uma fusão de proteína verde fluorescente [GFP] e calmodulina M13, uma sequência de peptídeo de miosina quinase de cadeia leve), flanqueado nas extremidades 5' e 3' com sites Tol2 (Tol2 -elavl3:GCaMP6s-Tol2)51.

A. mexicanus peixe de superfície e Molino cavefish foram criados, e os embriões resultantes foram coinjected na fase de célula única com 25 ng/μL de Tol2 -elavl3:GCaMP6s-Tol2 construção e 25 ng/μL Tol2 transposase mRNA (Figura 3A). Em 24 – 48 dpf, as larvas foram projectadas para uma expressão neuronal transitória de GCaMP6s. Esses embriões (F0) injetados com uma expressão de GCaMP6s foram levantados até à idade adulta e retrocruzados com adultos selvagem-tipo derivados da mesma linhagem de peixes de superfície ou cavefish. Os adultos de F1 resultantes foram projectados para uma expressão estável de expressão GCaMP6s, e as larvas foram mantidas para gerar linhas estáveis (Figura 3B,C). Porque cada adulto de F1 com um expressao provavelmente tem integrado Tol2 -elavl3: GCaMP6s-Tol2 em diferentes locais de genômicas, cada F1 é designado um alelo diferente. Usando essa abordagem, geraram F1s estável para peixe de superfície e Molino cavefish populações (Figura 3B,C), permitindo, assim, cálcio ao vivo de imagens para descobrir diferenças na atividade neuronal mediando mudanças comportamentais na caverna ambiente (Figura 3 C,D). Além disso, esta abordagem estabelece as bases para a expressão de muitos transgenes adicionais para caracterizar e manipular a função do gene na. mexicanus.

Figure 1
Figura 1: Morpholinos knockdown de Hcrt reduz a actividade e aumenta o sono no cavefish. (A) bloqueio tradução Morpholinos alvos os primeiros 25 bp do Hcrt sequência, incluindo o local de início do ATG de código. (B) Hcrt Morpholinos oligo (MO) e sequências de controle. (C) alinhamento de ~ 200 ovos de célula única em moldes de ovo agarose para injeção. (D) Microinjection de 1.0 nL de mistura de injeção com indicador vermelho de fenol para visualização. Barra de escala = 0.5 mm. (E) Morpholinos nocaute de Hcrt reduz a atividade (distância total percorrida) de Pachón cavefish (t = 5.021, df = 88, p < 0,0001) mas não de peixe de superfície (t = 1.318, df = 88, p > 0.72). Knockdown (F) aumenta o sono em Pachón cavefish (t = 2.694, df = 88, p < 0,05), mas não tem efeito sobre os peixes de superfície (t = 0.17, df = 88, p > 0,99). Barra de escala = 1 mm. As barras de erro em painéis E e F indicam o erro padrão da média. Clique aqui para ver uma versão maior desta figura.

Figure 2
Figura 2: Gene CRISPR-edição de oca2 apresenta albinismo na superfície-moradia a. mexicanus. (A) esquema do oca2 codificação de regiões e RNA guia (gRNA) visando exon 21 para edição de gene CRISPR-mediada. (B) cromatograma do selvagem-tipo Oca2 + e (C) mutante Oca2 - alelos de sequenciamento. A caixa vermelha no painel B indica a sequência 2, que está faltando no alelo mutante Oca2 - retratado no painel C. (D) alvo CRISPR introduz uma exclusão de 2 bp, desreguladoras Oca2 função. Cartilhas são projetadas para a seleção genotípica de 2 exclusão de bp na prole de F0. (E) PCR e gel de electroforese de Oca2 na superfície peixe selvagem-tipo (banda tamanho = 134 bp) e prole F0 CRISPR-injetado (banda tamanho = 133 bp). Indivíduos homozigotos ou heterozigotos para a variante selvagem-tipo de Oca2 (Oca2 +) são pigmentados, enquanto F0s homozigotos para a exclusão de bp 2 (Oca2 -) abrigam albinismo. (F) imagens do corpo inteiro do selvagem-tipo de superfície, de superfície peixe com albinismo CRISPR-mediada, peixe e (G). Barra de escala = 5 mm. (H e I) Magnified exibição das cabeças dos indivíduos retratados em painéis F e G, respectivamente. Barra de escala = 2 mm. clique aqui para ver uma versão maior desta figura.

Figure 3
Figura 3: Tol2 transgênese de pan-neuronal GCAMP6s permite que a imagem ao vivo da atividade cerebral em a. mexicanus. (A) mediada por Tol2 transgênese na . mexicanus. Coinjeção de mRNA Tol2 e Tol2 -elav3l: GCAMP6s-Tol2 plasmídeo integra GCAMP6s transgene em F0 fundadores. Retrocruzamento ao estoque original de peixe selvagem-tipo produz indivíduos de F1 com um expressao pan-neuronal de GCAMP6s. (B e C) a prole resultante é selecionada para uma expressão estável usando dissecação e microscopia confocal. Estável TgAsty(elav3l: GCaMP6s) F1 indivíduos foram estabelecidos em superfície (descrito no painel B) ou morfotipos de cavernas (descritos no painel C). Barra de escala = 200 μm.  Clique aqui para ver uma versão maior desta figura.

Reagente Volume ou quantidade
10,0 μg de pCS-zT2TP do plasmídeo X μl
NEB CutSmart Buffer Μl de 10,0
Enzima NotI-HF 2.0 μl
Livre de nuclease H2O X μl
BSA 1,0 μl
Total 100 μl

Tabela 1: Resumo de restrição do plasmídeo Tol2.

Reagente Volume ou quantidade
1,0 μg linearizada pCS-zT2TP do ADN do plasmídeo X μl
10 x amortecedor da reação 2.0 μl
2 x NTP/CAP Μl de 10,0
Mistura de enzima SP6 2.0 μl
Livre de RNase H2O X μl
Total ≤20 μl

Tabela 2: síntese In vitro de mRNA Tol2.

Nome da configuração Valor de ajuste
Calor 510
Puxe 55
Velocidade 100
Tempo 40
Pressão 500
Rampa 534

Tabela 3: Amostra pipeta-puxando o protocolo. 

Reagente Volume ou quantidade
Morpholinos (estoque de congelador @ 4mM) 1,0 μl
Livre de nuclease H2O ou solução do Danieau Μl de 17,0
Vermelho de fenol 2.0 μl
Total 20 μl

Tabela 4: Morpholinos mistura de injeção.

Reagente Volume de quantidade
gRNA (concentração final de trabalho @ 100ng/μl) 1 μl
Cas9 mRNA (concentração final de trabalho @ 1200ng/μl) 1 μl
Livre de RNase H2O 2 μl
Total 4 μl

Tabela 5: Amostra CRISPR/Cas9 mistura de injeção.

Reagente Volume de quantidade
Tol2 plasmídeo (concentração final de trabalho @ 25ng/μl) X μl
Tol2 mRNA (concentração final de trabalho @ 25ng/μl) X μl
Vermelho de fenol 1,0 μl
Livre de RNase H2O X μl
Total 15 μl

Tabela 6: Amostra Tol2 transgênese mistura de injeção

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Aqui, nós fornecemos uma metodologia para manipular a função dos genes usando morpholinos, gene CRISPR/Cas9 edição e metodologia de transgênese. A riqueza da tecnologia genética e a otimização desses sistemas no zebrafish provavelmente permitirá a transferência dessas ferramentas para a. mexicanus com facilidade52. Descobertas recentes têm usado essas abordagens na . mexicanus, mas eles permanecem subutilizados na investigação de diversas características morfológicas, comportamentais e do desenvolvimento neste sistema30,36,42 , 53.

Morpholinos têm sido amplamente utilizados na investigação de zebrafish para nocaute a expressão dos genes. A abordagem é superficial e resulta em um "knockdown" robusto de expressão. No entanto, efeitos fora do alvo têm sido amplamente documentados22,,53; assim, os animais em que foram injetados morpholinos para devem ser cuidadosamente monitorados por qualquer inesperado fenótipos22,55. Quando possível, resultados obtidos Morpholinos nocaute devem ser validados através da utilização de outros métodos, tais como abordagens de nocaute CRISPR/Cas9-mediada. Enquanto morpholinos permitir o nocaute robusto de expressão gênica, mediada por Morpholinos nocaute é transitório. Assim, analisar fenótipos adultos não é possível ao usar esse método.

CRISPR/Cas9-mediada mutagênese oferece a manipulação direta de genes específicos. Além disso, ao contrário de Morpholinos mediada por nocaute, mutagênese CRISPR/Cas9 permite a análise de fenótipos mutantes na idade adulta. Para evitar efeitos fora do alvo de CRISPR/Cas9, linhas mutantes devem ser outcrossed várias gerações, e quando possível, mais de um alelo deve ser obtido e testado. O sistema CRISPR/Cas9 também fornece o potencial para utilizando abordagens edição de gene a bater-nos alelos ou produzir alterações genéticas específicas. O sistema CRISPR/Cas9 tem sido usado no zebrafish para produzir integrações precisas de DNA exógeno e gerar mutações de ponto exato19,20,56,57,58, 59. com o sequenciamento do genoma cavefish, agora é possível identificar polimorfismos de nucleotídeo único (SNPs) ou outras alterações genéticas sutis entre os peixes de superfície e de populações cavefish33. O aplicativo de edição de gene CRISPR/Cas9 fornece a oportunidade de trocar alelos entre cavefish e peixes de superfície, ou entre diferentes populações de cavefish, para examinar o papel dessas alterações genéticas em diferentes processos de desenvolvimento.

As abordagens de transgênese descritas neste protocolo fornecem um método simples e poderoso para estudos de ganho-de-função e para a geração de ferramentas para alterar processos biológicos geneticamente. O sistema Tol2 é amplamente utilizado na investigação de zebrafish, e mostramos que é da mesma forma poderosa na . mexicanus. Além disso, temos demonstrado uma construção transgênica gerada no zebrafish que utiliza um promotor de zebrafish e recapitula a expressão endógena na . mexicanus. Encontramos que quatro outros promotores isolaram do zebrafish essa expressão tecido-específica de unidade como esperado em a. mexicanus (dados não mostrados). Desde que os promotores zebrafish recapitular seus padrões de expressão conservada na . mexicanus, isto sugere que muitas das ferramentas genéticas podem ser transferidas diretamente do zebrafish para . mexicanus sem a necessidade de modificação com A. mexicanus promotores. Além disso, com o avanço em tecnologias de sequenciamento na . mexicanus33, as abordagens transgênicas aqui descritas permitirá um futuro poderoso para a investigação de enhancers e promotores que podem desempenhar um papel na variação entre formas de superfície e a caverna. Por último, as ferramentas poderosas para a manipulação genética dos processos biológicos que fizeram zebrafish valiosos são igualmente importantes na . mexicanus60,61,62,,63. Diferenças em diversas características comportamentais, tais como sono, alimentação, stress, e agressão, entre as formas de superfície - e caverna-moradia da . mexicanus têm sido amplamente documentados12,14,15 ,38,64, ainda à base neuronais correlações não são bem compreendidas. Ferramentas como Tg(elavl3:GCaMP6s) permitirá uma dissecação de como diferenças na atividade neuronal todo o cérebro se correlacionam com as diferenças no comportamento e oferecem uma perspectiva única sobre como o cérebro tem ser modificados evolutivamente.

Tomados em conjunto, a. mexicanus está prestes a se tornar um líder modelo para investigar a evolução de uma variedade de características morfológicas e comportamentais. As diversas diferenças em processos biológicos complexos na . mexicanus fornecem uma plataforma para a investigação de mecanismos genéticos de evolução do traço. A aplicação de ferramentas para manipulação de função do gene pode ajudar a desenvolver este organismo em um modelo que pode ser aplicado para investigar doenças biológicas relacionadas à degeneração do olho, anomalias de desenvolvimento neurológico e insônia.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Os autores não têm nada para divulgar.

Acknowledgments

Os autores agradecer Sunishka Thakur pela sua assistência na genotipagem e imagem os peixes mutantes oca2 , representados na Figura 2. Este trabalho foi financiado pela National Science Foundation (NSF) prêmio 1656574 para A.C.K., prêmio NSF 1754321 a J.K. e A.C.K. e prêmio do National Institutes of Health (NIH) R21NS105071 para A.C.K. e E.R.D.

Materials

Name Company Catalog Number Comments
Fish breeding & egg supplies
Fine mesh fish net Penn Plax BN4
Fish tank heater Aqueon 100106108
Egg traps Custom made NA Design and create plastic grate to place at bottom of tank to protect eggs
Glass pipettes Fisher Scientific 13-678-20C
Pipette bulbs Fisher Scientific 03-448-21
Agarose Fisher Scientific BP160-500
Egg molds Adaptive Science Tools TU-1
Morpholino supplies
Control Morpholino Gene Tools, LLC Standard control olio
Custom Morpholino Gene Tools, LLC NA
Phenol Red Sigma Aldrich P0290-100ML
CRISPR supplies
Cas9 Plasmid AddGene 46757
GoTaq DNA Polymerase Promega M3001
KOD Hot Start Taq EMD Millipore 71-842-3
Primers Integrated DNA Technologies Custom
T7 Megascript Kit Ambion/Thermofisher AM1333
miRNeasy Kit Qiagen 217004
mMessage mMachine T3 kit Ambion/Thermofisher AM1348
MinElute Kit Qiagen 28204
Tol2 transgenesis supplies
pCS-zT2TP plasmid Kawakami et al., 2004 Request from senior author
CutSmart Buffer New England Biolabs B7204
NotI-HF Restriction Enzyme New England Biolabs R3189
PCR purification Kit Qiagen 28104
SP6 mMessenger Kit Ambion/Thermofisher AM1340
Microinjection supplies
Glass Capillary Tubes Sutter Instruments BF100-58-10
Pipette puller Sutter Instruments P-97
Picoinjector Warner Instruments PLI-100A
Micromanipulator World Precision Instruments M3301R
Micromanipulator Stand World Precision Instruments M10
Micmanipulator Base World Precision Instruments Steel Plate Base, 10 lbs

DOWNLOAD MATERIALS LIST

References

  1. Darwin, C. On the Origin of Species by Means of Natural Selection. D. Appleton and Company. (1859).
  2. Culver, D. C., Pipan, T. The Biology of Caves and Other Subterranean Habitats. Oxford University Press. New York, NY. (2009).
  3. Mitchell, R. W., Russell, W. H., Elliott, W. R. Mexican Eyeless Characin Fishes, Genus Astyanax: Environment, Distribution, and Evolution. (1977).
  4. Huppop, K. Oxygen consumption of Astyanax fasciatus (Characidae, Pisces): A comparison of epigean and hypogean populations. Environmental Biology of Fishes. 17, 299-308 (1986).
  5. Moran, D., Softley, R., Warrant, E. J. Eyeless Mexican Cavefish Save Energy by Eliminating the Circadian Rhythm in Metabolism. PLoS ONE. 9, (9), e107877 (2014).
  6. Protas, M. E., et al. Genetic analysis of cavefish reveals molecular convergence in the evolution of albinism. Nature genetics. 38, 107-111 (2006).
  7. Wall, A., Volkoff, H. Effects of fasting and feeding on the brain mRNA expressions of orexin tyrosine hydroxylase (TH), PYY and CCK in the Mexican blind cavefish (Astyanax fasciatus mexicanus). General and Comparative Endocrinology. 183, 44-52 (2013).
  8. Aspiras, A., Rohner, N., Marineau, B., Borowsky, R., Tabin, J. Melanocortin 4 receptor mutations contribute to the adaptation of cavefish to nutrient-poor conditions. Proceedings of the National Academy of Sciences. 112, (31), 9668-9673 (2015).
  9. Yoshizawa, M., Gorički, Š, Soares, D., Jeffery, W. R. Evolution of a behavioral shift mediated by superficial neuromasts helps cavefish find food in darkness. Current Biology. 20, (18), 1631-1636 (2010).
  10. Jeffery, W. R. Regressive Evolution in Astyanax Cavefish. Annual Review of Genetics. 43, 25-47 (2009).
  11. Gross, J. B. The complex origin of Astyanax cavefish. BMC Evolutionary Biology. 12, 105 (2012).
  12. Elipot, Y., Hinaux, H., Callebert, J., Rétaux, S. Evolutionary shift from fighting to foraging in blind cavefish through changes in the serotonin network. Current Biology. 23, (1), 1-10 (2013).
  13. Kowalko, J. E. J., et al. Loss of schooling behavior in cavefish through sight-dependent and sight-independent mechanisms. Current Biology. 23, (19), 1874-1883 (2013).
  14. Duboué, E. R. E. R., Keene, A. C. A. C., Borowsky, R. L. R. L. Evolutionary convergence on sleep loss in cavefish populations. Current Biology. 21, (8), 671-676 (2011).
  15. Chin, J. S., et al. Convergence on reduced stress behavior in the Mexican blind cavefish. Developmental Biology. (2018).
  16. Scheer, N., Campos-Ortega, J. A. Use of the Gal4-UAS technique for targeted gene expression in the zebrafish. Mechanisms of Development. 80, (2), 153-158 (1999).
  17. Kawakami, K., Shima, A., Kawakami, N. Identification of a functional transposase of the Tol2 element, an Ac-like element from the Japanese medaka fish, and its transposition in the zebrafish germ lineage. Proceedings of the National Academy of Sciences. 97, (21), 11403-11408 (2000).
  18. Balciunas, D., et al. Enhancer trapping in zebrafish using the Sleeping Beauty transposon. BMC Genomics. (2004).
  19. Auer, T. O., Duroure, K., De Cian, A., Concordet, J. P., Del Bene, F. Highly efficient CRISPR/Cas9-mediated knock-in in zebrafish by homology-independent DNA repair. Genome Research. 24, (1), 142-153 (2014).
  20. Kimura, Y., Hisano, Y., Kawahara, A., Higashijima, S. I. Efficient generation of knock-in transgenic zebrafish carrying reporter/driver genes by CRISPR/Cas9-mediated genome engineering. Scientific Reports. 4, (2014).
  21. Bill, B. R., Petzold, A. M., Clark, K. J., Schimmenti, L. A., Ekker, S. C. A Primer for Morpholino Use in Zebrafish. Zebrafish. 6, (1), 69-77 (2009).
  22. Nasevicius, A., Ekker, S. C. Effective targeted gene “knockdown” in zebrafish. Nature Genetics. (2000).
  23. Sander, J. D., et al. Targeted gene disruption in somatic zebrafish cells using engineered TALENs. Nature Biotechnology. (2011).
  24. Huang, P., et al. Heritable gene targeting in zebrafish using customized TALENs. Nature Biotechnology. (2011).
  25. Kawakami, K. Transposon tools and methods in zebrafish. Developmental Dynamics. 234, (2), 244-254 (2005).
  26. Urasaki, A., Morvan, G., Kawakami, K. Functional dissection of the Tol2 transposable element identified the minimal cis-sequence and a highly repetitive sequence in the subterminal region essential for transposition. Genetics. 174, (2), 639-649 (2006).
  27. Juntti, S. A., Hu, C. K., Fernald, R. D. Tol2-Mediated Generation of a Transgenic Haplochromine Cichlid, Astatotilapia burtoni. PLoS ONE. 8, (10), (2013).
  28. Harel, I., Valenzano, D. R., Brunet, A. Efficient genome engineering approaches for the short-lived African turquoise killifish. Nature Protocols. 11, (10), 2010-2028 (2016).
  29. Erickson, P. A., Ellis, N. A., Miller, C. T. Microinjection for Transgenesis and Genome Editing in Threespine Sticklebacks. Journal of Visualized Experiments. (111), e54055 (2016).
  30. Elipot, Y., Legendre, L., Père, S., Sohm, F., Rétaux, S. Astyanax transgenesis and husbandry: how cavefish enters the laboratory. Zebrafish. 11, (4), 291-299 (2014).
  31. Keene, A., Yoshizawa, M., McGaugh, S. Biology and Evolution of the Mexican Cavefish. Academic Press. New York, NY. (2015).
  32. Casane, D., Rétaux, S. Evolutionary Genetics of the Cavefish Astyanax mexicanus. Advances in Genetics. 95, 117-159 (2016).
  33. Mcgaugh, S., et al. The cavefish genome reveals candidate genes for eye loss. Nature Communications. 5, 5307 (2014).
  34. Yoshizawa, M., et al. Distinct genetic architecture underlies the emergence of sleep loss and prey-seeking behavior in the Mexican cavefish. BMC Biology. 13, (1), (2015).
  35. Ma, L., Jeffery, W. R., Essner, J. J., Kowalko, J. E. Genome editing using TALENs in blind Mexican cavefish, Astyanax mexicanus. PLoS ONE. 10, (3), (2015).
  36. Bilandzija, H., Ma, L., Parkhurst, A., Jeffery, W. A potential benefit of albinism in Astyanax cavefish: downregulation of the oca2 gene increases tyrosine and catecholamine levels as an alternative to melanin synthesis. PLoS ONE. 8, (11), e80823 (2013).
  37. Alie, A., et al. Developmental evolution of the forebrain in cavefish: from natural variations in neuropeptides to behavior. eLife. 7, e32808 (2018).
  38. Jaggard, J. B., et al. Hypocretin underlies the evolution of sleep loss in the Mexican cavefish. eLife. 7, e32637 (2018).
  39. Borowsky, R. Handling Astyanax mexicanus eggs and fry. Cold Spring Harbor Protocols. 3, (11), (2008).
  40. Varshney, G. K., Sood, R., Burgess, S. M. Understanding and Editing the Zebrafish Genome. Advances in Genetics. 92, 1-52 (2015).
  41. Wierson, W. A., et al. GeneWeld: a method for efficient targeted integration directed by short homology. BioRxiv. (2018).
  42. Klaassen, H., Wang, Y., Adamski, K., Rohner, N., Kowalko, J. E. CRISPR mutagenesis confirms the role of oca2 in melanin pigmentation in Astyanax mexicanus. Developmental Biology. (2018).
  43. Jao, L. E., Wente, S. R., Chen, W. Efficient multiplex biallelic zebrafish genome editing using a CRISPR nuclease system. Proceedings of the National Academy of Sciences of the United States of America. 110, (34), 13904-13909 (2013).
  44. Kwan, K. M., et al. The Tol2kit: A multisite gateway-based construction Kit for Tol2 transposon transgenesis constructs. Developmental Dynamics. 236, (11), 3088-3099 (2007).
  45. Kawakami, K., et al. A transposon-mediated gene trap approach identifies developmentally regulated genes in zebrafish. Developmental Cell. 7, (1), 133-144 (2004).
  46. Kowalko, J., Ma, L., Jeffery, W. Genome Editing in Astyanax mexicanus Using Transcription Activator-like Effector Nucleases (TALENs). Journal of Visualized Experiments. (112), e54113 (2016).
  47. Nishino, S., Ripley, B., Overeem, S., Lammers, G. J., Mignot, E. Hypocretin (orexin) deficiency in human narcolepsy. Lancet. (2000).
  48. Lin, L., et al. The sleep disorder canine narcolepsy is caused by a mutation in the hypocretin (orexin) receptor 2. Cell. (1999).
  49. Park, H. C., et al. Analysis of upstream elements in the HuC promoter leads to the establishment of transgenic Zebrafish with fluorescent neurons. Developmental Biology. 227, (2), 279-293 (2000).
  50. Higashijima, S., Masino, M. A., Mandel, G., Fetcho, J. R. Imaging Neuronal Activity During Zebrafish Behavior With a Genetically Encoded Calcium Indicator. Journal of Neurophysiology. (2003).
  51. Vladimirov, N., et al. Light-sheet functional imaging in fictively behaving zebrafish. Nature Methods. 11, (9), 883-884 (2014).
  52. Halpern, M. E., et al. Gal4/UAS transgenic tools and their application to zebrafish. Zebrafish. 5, (2), 97-110 (2008).
  53. Jaggard, J. B., Stahl, B. A., Lloyd, E., Prober, D. A., Duboue, E. R., Keene, A. C. Hypocretin underlies the evolution of sleep loss in the Mexican cavefish. bioRxiv. 7, e32637 (2018).
  54. Bedell, V. M., Westcot, S. E., Ekker, S. C. Lessons from morpholino-based screening in zebrafish. Briefings in Functional Genomics. (2011).
  55. Robu, M. E., et al. p53 activation by knockdown technologies. PLoS Genetics. (2007).
  56. Hisano, Y., et al. Precise in-frame integration of exogenous DNA mediated by CRISPR/Cas9 system in zebrafish. Scientific reports. 5, 8841 (2015).
  57. Prykhozhij, S., et al. Optimized knock-in of point mutations in zebrafish using CRISPR/Cas9. Nucleic Acids Res. 46, (17), (2018).
  58. Tessadori, F., et al. Effective CRISPR/Cas9-based nucleotide editing in zebrafish to model human genetic cardiovascular disorders. Disease Model Mechanisms. 11, (10), (2018).
  59. Armstrong, G., Liao, M., You, Z., Lissouba, A., Chen, B., Drapeau, P. Homology Directed Knockin of Point Mutations in the Zebrafish tardbp and fus Genes in ALS Using the CRISPR/Cas9 System. PLoS ONE. 11, (3), (2016).
  60. Friedrich, R. W., Jacobson, G. A., Zhu, P. Circuit Neuroscience in Zebrafish. Current Biology. 20, (8), (2010).
  61. Friedrich, R. W., Genoud, C., Wanner, A. A. Analyzing the structure and function of neuronal circuits in zebrafish. Frontiers in Neural Circuits. 7, (2013).
  62. Scott, E. K., et al. Targeting neural circuitry in zebrafish using GAL4 enhancer trapping. Nature Methods. 4, (4), 323-326 (2007).
  63. Asakawa, K., Kawakami, K. Targeted gene expression by the Gal4-UAS system in zebrafish. Development Growth and Differentiation. (2008).
  64. Lloyd, E., et al. Evolutionary shift towards lateral line dependent prey capture behavior in the blind Mexican cavefish. Developmental Biology. (2018).
Manipulação de função do Gene em Cavefish mexicano
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Stahl, B. A., Jaggard, J. B., Chin, J. S. R., Kowalko, J. E., Keene, A. C., Duboué, E. R. Manipulation of Gene Function in Mexican Cavefish. J. Vis. Exp. (146), e59093, doi:10.3791/59093 (2019).More

Stahl, B. A., Jaggard, J. B., Chin, J. S. R., Kowalko, J. E., Keene, A. C., Duboué, E. R. Manipulation of Gene Function in Mexican Cavefish. J. Vis. Exp. (146), e59093, doi:10.3791/59093 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter