Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Biology

Verbeterde crosslinking Immunoprecipitation (eCLIP) methode voor efficiënte identificatie van proteïne-verbindend RNA in muis testis

doi: 10.3791/59681 Published: May 10, 2019
* These authors contributed equally

Summary

Hier presenteren we een eCLIP protocol om de belangrijkste RNA doelen van RBP kandidaten in testis te bepalen.

Abstract

Spermatogenese definieert een zeer besteld proces van mannelijke kiemcellen differentiatie bij zoogdieren. In testis, worden de transcriptie en de vertaling ontkoppeld, onderstrepend het belang van post-transcriptie regelgeving van de uitdrukking van het gen die door RBPs wordt georkestreerd. Om mechanistische rollen van een RBP op te helderen, kan de methodologie van crosslinking Immunoprecipitation (klem) worden gebruikt om zijn endogene directe doelstellingen van RNA te vangen en de daadwerkelijke interactie plaatsen te bepalen. De Enhanced CLIP (eCLIP) is een nieuw ontwikkelde methode die verschillende voordelen biedt ten opzichte van de conventionele CLIPs. Nochtans, is het gebruik van eCLIP tot dusver beperkt tot cel lijnen, die voor uitgebreide toepassingen roepen. Hier werkten wij eCLIP om MOV10 en MOV10L1, twee bekende RNA-bindende helicases, in muis testis te bestuderen. Zoals verwacht, vinden wij dat MOV10 hoofdzakelijk aan 3 ' onvertaalde gebieden (UTRs) van mRNA bindt en MOV10L1 selectief aan piwi-interactie RNA (piRNA) voorloper transcripten bindt. Onze eCLIP methode maakt een snelle bepaling van de grote RNA-soorten gebonden door verschillende RBPs via kleinschalige sequencing van subklonen en dus de beschikbaarheid van gekwalificeerde Bibliotheken, als een waarborg voor de procedure met diepe sequencing. Deze studie stelt een toepasbare basis vast voor eCLIP in zoogdier testis.

Introduction

De testis van zoogdieren vertegenwoordigt een uitstekend ontwikkelingsmodel waarin een ingewikkeld programma van de cel differentiatie cyclisch loopt om talrijke spermatozoa op te leveren. Een unieke waarde van dit model ligt in de opkomst van transcriptie inactivatie in bepaalde stadia van spermatogenese, meestal wanneer Meiotische geslacht chromosoom inactivatie (MSCI) voorkomt1,2 en wanneer ronde spermatids ondergaan drastische kern verdichting tijdens spermiogenesis3. Deze inopeenvolgende transcriptie gebeurtenissen vereisen post-transcriptie de regelgeving van het gen, waarin RNA-bindende proteïnen (RBPs) een essentiële rol spelen, die transcriptoom en het handhaven van mannelijke vruchtbaarheid vormen.

Om de bona fide doelen van RNA van een individuele RBP in vivo te identificeren, werd de crosslinking Immunoprecipitation (clip) methode ontwikkeld4,5, gebaseerd op maar buiten de reguliere RNA Immunoprecipitation (RIP)6,7 , door integratie van belangrijke stappen met inbegrip van ultraviolette (UV) crosslinking, stringente was en gel overdracht om signaal specificiteit te verbeteren. De geavanceerde toepassing van de CLIP in combinatie met een hoge doorvoersnelheid sequencing heeft uitgelokt grote belangstelling voor profilering eiwit-RNA interactie op genoom-Wide levels8. Naast genetische studies over RBP functie, zijn dergelijke biochemische methodes die het directe samenspel van endogene proteïne en RNA identificeren onontbeerlijk geweest om de regelgevende rollen van RNA van RBPs nauwkeurig te verhelderen. Bijvoorbeeld, MOV10L1 is een testikel-specifiek RNA Helicase vereist voor mannelijke vruchtbaarheid en de piwi-interactie RNA (piRNA) biogenesis9. Zijn paralogue MOV10 is gekend als een ubiquitously uitgedrukt en multifunctioneel RNA Helicase met rollen in veelvoudige aspecten van de biologie van RNA10, 11,12,13,14 , 15 , 16 , 17 , 18. door het gebruik van de conventionele clip-volgende, vonden we dat MOV10L1 bindt en reguleert primaire piRNA precursoren te initiëren vroege piRNA verwerking19,20, en dat MOV10 bindt mRNA 3 ' UTRs en als niet-codering RNA soorten in testiculaire kiemcellen (gegevens niet getoond).

Niettemin, CLIP is oorspronkelijk een moeizame, radioactieve procedure gevolgd door sequencing bibliotheek voorbereiding met een opmerkelijk verlies van CLIP Tags. In de conventionele CLIP, is een cDNA Bibliotheek bereid met behulp van adapters afgebonden op beide RNA ledematen. Na de eiwitvertering, kruisverwijzende korte polypeptiden blijven gehecht aan RNA fragmenten. Dit crosslinking merk blokkeert gedeeltelijk omgekeerde transcriptase (RTase) progressie tijdens cDNA synthese, resulterend in afgekapte cDNAs die ongeveer 80% van de cDNA Bibliotheek21,22vertegenwoordigen. Dus alleen cDNA fragmenten als gevolg van RTase het omzeilen van de crosslinking site (Read-Through) worden gesequenced. Onlangs, zijn diverse klem benaderingen, zoals pari-klem, iCLIP, eCLIP en uvCLAP, gebruikt om crosslink plaatsen van RBPs in levende cellen te identificeren. PAR-CLIP omvat de toepassing van 365 nm UV-straling en photoactivatable nucleotide analogen en is daarom exclusief voor in-kweken levende cellen, en de integratie van nucleoside analogen in nieuw gesynthetiseerde Transcripten is vatbaar voor het produceren bias waar RNA fysisch met proteïne23,24samenwerkt. In iCLIP, slechts een enkele adapter is afgebonden aan de 3 ' extremiteit van kruisverwijzende RNA fragmenten. Na omgekeerde transcriptie (RT), zowel worden de afgekapte als gelezen-door cDNAs verkregen door intramolecularly circularization en re-linearization die door de Kettingreactie van de polymerase (PCR) wordt gevolgd25,26. Echter, de efficiëntie van intramoleculaire circularization is relatief laag. Hoewel oudere CLIP protocollen moeten etikettering van kruisverwijzende RNA met een isotoop, ultraviolette crosslinking en affiniteit zuivering (uvCLAP), met een proces van strenge tandem affiniteit zuivering, vertrouwt niet op radioactiviteit27. Niettemin is uvCLAP beperkt tot gekweekte cellen die moeten worden transfected met de expressievector die de 3x FLAG-HBH tag voor tandem affiniteit zuivering draagt.

In eCLIP, adapters werden afgebonden eerste op de 3 ' extremiteit van RNA gevolgd door RT, en de volgende op de 3 ' extremiteit van cDNAs in een intermoleculaire modus. Vandaar, eCLIP is in staat om vast te leggen alle afgekapt en lees-through cDNA28. Ook is het niet beperkt tot radioactieve etikettering, noch om het gebruik van cel lijnen op basis van zijn principe, met behoud van single-nucleotide resolutie.

Hier bieden we een stap-voor-stap beschrijving van een eCLIP protocol aangepast voor de muis testis. Kort, dit eCLIP protocol begint met UV-crosslinking van testiculaire tubuli, gevolgd door gedeeltelijke ASE spijsvertering en Immunoprecipitation met behulp van een eiwit-specifieke antilichaam. Vervolgens, naar de proteïne-gebonden RNA zit gedefosforyleerd, en bewerker zit afgebonden voor zijn 3 ' uiterste. Na eiwit Elektroforese van het gel en gel-aan-membraan overdracht, wordt RNA geïsoleerd door het membraan gebied van een verwachte groottewaaier te snijden. Na RT, is de adapter van DNA afgebonden aan 3 ' eind van cDNA die door PCR versterking wordt gevolgd. Screening van subklonen voorafgaand aan high-throughput sequencing wordt genomen als een bibliotheek kwaliteitscontrole. Dit protocol is efficiënt bij het identificeren van belangrijke soorten van proteïne-verbindend RNA van RBPs, dat door twee wordt geïllustreerd testis-uitdrukt RNA helicases MOV10L1 en MOV10.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Alle uitgevoerde dierproeven zijn goedgekeurd door de Nanjing Medical University Comite. De mannelijke C57BL/6 muizen werden gehouden onder gecontroleerde fotoperiode voorwaarden en werden voorzien van voedsel en water.

1. weefsel oogsten en UV crosslinking

  1. Euthanaseren 2 volwassen muizen met behulp van kooldioxide (CO2) voor 1-2 min of tot de ademhaling stopt. Vervolgens voert u cervicale dislocatie op elke muis.
  2. Oogst ongeveer 100 mg testes van muizen van geschikte leeftijd (één volwassen testis in deze studie) voor elk immunoprecipitation experiment, en plaats de weefsels in ijskoud fosfaat gebufferde zoutoplossing (PBS).
  3. Verwijder de tunica albuginea voorzichtig met een paar fijne-getipt pincet.
  4. Voeg 3 mL ijskoude PBS toe in een weefsel slijper en fijnstampen het weefsel door middel van een lichte mechanische kracht met behulp van een losse glazen stamper (type A Glass stamper).
    Opmerking: Het doel van deze stap is niet te lyse cellen, maar om uit elkaar te trekken het weefsel. Behoud van de levensvatbaarheid van cellen en integriteit is belangrijk.
  5. Breng de weefsel schorsing naar een cel kweekschaal (10 cm in diameter) en voeg ijskoude PBS tot 6 mL.
  6. Schud snel de plaat zodat de vloeistof de bodem van de schotel gelijk behandelt. Als het weefsel goed wordt gemalen, gelijkmatig verdeeld seminiferous tubuli zal zichtbaar zijn, terwijl de aanwezigheid van weefsel bosjes geeft aan dat weefsel dispersie is suboptimaal.
  7. Crosslink de opschorting drie keer met 400 mJ/cm2 bij 254 nm op ijs. Meng suspensie tussen elke straling.
    Opmerking: Voor elk nieuw experiment moet crosslinking worden geoptimaliseerd.
  8. Verzamel de suspensie in een 15 mL kegelvormige buis en pellet bij 1.200 x g voor 5 min bij 4 °c. Verwijder de bovendrijvende, hersuspendeer de pellet in 1 mL PBS en breng de suspensie over naar een 1,5 mL centrifugebuis. Draai bij 4 °C en 1.000 x g voor 2 min, en verwijder bovendrijvende.
  9. Op dit punt, onmiddellijk verder met de rest van het Protocol, of snap bevriezen van de pellets in vloeibare stikstof en op te slaan bij-80 °C tot het gebruik.

2. kralen voorbereiding

  1. Voeg 125 µ L van proteïne een magnetische parels per steekproef (korrel) aan een verse centrifugebuis toe.
    Opmerking: Gebruik eiwit G magnetische kralen voor muis antilichamen.
  2. Plaats de buis op de magneet om de kralen te scheiden van de oplossing. Verwijder na 10 s de bovendrijvende. Was tweemaal kralen met 1 mL ijskoude lysis buffer.
    Opmerking: De verdere scheiding van proteïne een magnetische parels volgt deze stap. Lysis buffer samenstelling is 50 mM tris-HCl, pH 7,5; 100 mM NaCl; 1% NP-40; 0,1% SDS; 0,5% natrium deoxycholate; 1/50 ethylenediaminetetraacetic acid (EDTA)-vrije proteaseremmer cocktail (Voeg vers).
  3. Hersuspendeer kralen in 100 µ L van koude lysis buffer met 10 µ g eCLIP antilichaam. Draai de tubes bij kamertemperatuur voor 45 min.
    Opmerking: De definitieve antistof concentratie voor Immunoprecipitation is 10 µ g/mL. Als de antilichamen concentratie onbekend is, zou de hoeveelheid antilichaam moeten worden geoptimaliseerd.
  4. Was tweemaal kralen met 1 mL ijskoude lysis buffer.

3. weefsel lysis en gedeeltelijke RNA spijsvertering

  1. Hersuspendeer weefsel pellets in 1 mL koude lysis buffer (Voeg 22 µ L van 50x (EDTA)-vrije eiwit remmer cocktail en 11 µ L van de ASE-remmer op 1 mL van lysis buffer).
    1. Hersuspendeer twee UV-kruisverwijzende pellets en twee niet-kruisverwijzende pellets per groep experimenten: UV-kruisverwijzende-1 pellets voor eCLIP Library (UV-1); UV-kruisverwijzende-2 pellets voor eCLIP Library (UV-2); niet-kruisverwijzende-1 pellets voor eCLIP Library als een controle (niet-UV); niet-kruisverwijzende-2 pellets voor IgG IP om de specificiteit van antilichamen aan te tonen.
      Let op: de ideale controle voor de eCLIP bibliotheek van de UV-kruisverwijzende Wide-type testikels is die van de UV-kruisverwijzende Knockout testes van muizen van hetzelfde nest.
  2. Houd Lysing de monsters op ijs voor 15 min (om degradatie van eiwitten en RNA te voorkomen).
  3. Bewerk in een digitale geen ultrasoonapparaat bij 10% amplitude voor 5 min, bij 30 s op/30 s uit. Plaats het monster altijd op het ijs en reinig de sonde met Nuclease water tussen elk monster.
  4. Voeg 4 µ L van DNase aan elke buis, en meng goed. Incubeer voor 10 min bij 37 °C, schudden bij 1.200 rpm.
  5. Voeg toe 10 µ L van verdunde ASE I (4 U/µ L ASE I in PBS), en mengeling goed. Incubeer voor 5 min bij 37 °C, schudden bij 1.200 rpm.
  6. Ontruim de lysate door Centrifugeer bij 15.000 x g 20 min (bij 4 °c).
  7. Zorgvuldig verzamelen van de bovendrijvende. Laat 50 µ L van lysate en gooi de pellet mee.
  8. Sparen input steekproeven als RWB (looppas voor westelijke vlek) en RRI (looppas voor de isolatie van RNA). Bespaar 20 µ L (2%) van UV-1, UV-2, niet-UV en IgG monsters als input voor RWB gel laden. Bespaar 20 µ L (2%) van UV-1 of UV-2 monsters als input voor RRI gel loading.

4. Immunoprecipitation

  1. Voeg 1 mL van de lysate (vanaf stap 3,7) toe aan de kralen (bereid in punt 2) en draai de monsters bij 4 °C voor 2 uur of 's nachts.
  2. Verzamel de kralen met een magnetische stand en gooi de bovendrijvende. Was de kralen tweemaal met 900 µ L van hoge zout buffer (50 mM tris-HCl, pH 7,5; 1 M NaCl; 1 mM EDTA; 1% NP-40; 0,1% SDS; 0,5% natrium deoxycholate), en dan tweemaal wassen met 900 µ L van was buffer (20 mM tris-HCl, pH 7,5; 10 mM MgCl2; 0,2% tween-20).
    Opmerking: Voor de IgG monster, pauzeren de procedure hier en opslaan op ijs in de buffer te wassen.
  3. Was een keer kralen met 500 µ L van 1x dephosphorylation buffer (10 mM tris-HCl, pH 7,5; 5 mM MgCl2; 100 mm KCl; 0,02% Triton X-100).

5. Dephosphorylation van RNA 3 ' uiteinden

  1. Verzamel de kralen met een magnetische stand en gooi de bovendrijvende. Verwijder restvloeistof met behulp van fijne pipet tips. Voeg 100 µ L van dephosphorylation Master Mix (10 µ L van 10x dephosphorylation buffer [100 mM tris-HCl, pH 8,0; 50 mM MgCl2; 1 M KCl; 0,2% Triton X-100; 1 mg/ml boviene serum ALBUMINE (BSA)]; 78 µ l van Nuclease water; 2 µ l van de remmer van ASE; 2 µ l van DNase; 8 µ l van al kortram fosfatase) aan elk monster, en incubeer gedurende 15 min bij 37 ° c, schudden op 1.200 rpm.
  2. Voeg 300 µ L van polynucleotide kinase (PNK) Master Mix (60 µ L van 5x PNK pH 6,5 buffer [350 mM tris-HCl, pH 6,5; 50 mM MgCl2]; 223 µ l van Nuclease water; 5 µ l ASE-remmer; 2 µ l DNase; 7 µ l van PNK enzym; 3 µ l van 0,1 M dithiothreitol) aan elk monster , Incubeer gedurende 20 min bij 37 °C, schudden op 1.200 rpm.
  3. Verzamel de kralen met een magnetische stand en gooi de bovendrijvende. Was een keer kralen met 500 µ L koude Wash buffer. Dan wassen kralen een keer met 500 µ L van koude hoge zout buffer. Herhaal deze wast nogmaals in deze volgorde.
  4. Was een keer kralen met 500 µ L koude was buffer en vervolgens tweemaal met 300 µ L koud 1x afbinding buffer (geen dithiothreitol, 50 mM tris-HCl, pH 7,5; 10 mM MgCl2).

6. de adapter Afbinding van RNA aan de einden van RNA 3

  1. Gooi de bovendrijvende, en verwijder de resterende vloeistof met fijne pipet tips. Voeg 25 µ L van 3 ' afbinding Master Mix toe aan elk monster. Meng zorgvuldig door het pipetteren. Deze stap is gevoelig voor het produceren van bubbels.
    Opmerking: Afbinding Master Mix bevat 3 µ L van 10x afbinding buffer [500 mM tris-HCl, pH 7,5; 100 mM MgCl2]; 9 µ L van Nuclease water; 0,4 µ L van de remmer van ASE; 0,3 µ L van 0,1 M ATP; 0,8 µ L van dimethyl sulfoxide (DMSO); 9 µ L van 50% de glycol van het polyethyleen (PEG) 8000; 2,5 µ L van RNA ligase [30 U/µ L].
  2. Voeg 2,5 µ L van de adapter X1A van RNA (lijst 1) en 2,5 µ l van de adapter X1B van RNA (lijst 1) aan elk steekproef toe. Meng zorgvuldig door te pipetten of flicking, en incubeer voor 75 min bij 25 ° c, flicking om elke 10 minuten te mengen.
  3. Was een keer kralen met 500 µ L koude Wash buffer (CV IgG monster hier).
  4. Was een keer kralen met 500 µ L van koude hoge zout buffer en vervolgens met 500 µ L Cold Wash buffer. Herhaal deze wast nogmaals.
  5. Magnetisch gescheiden kralen, en verwijder residuele vloeistof met fijne pipet tips.
  6. Hersuspendeer de kralen in 100 µ L van koude Wash buffer (pauze de IgG monster hier en op te slaan op ijs in de buffer te wassen). Verplaats 20 µ L naar nieuwe tubes als RWB samples. Scheid magnetisch de resterende 80 µ L als RRI steekproeven. Verwijder de RRI samples ' bovendrijvende en hersuspendeer de kralen in 20 µ L van Wash buffer.
  7. Voeg 37,5 µ L van 4x Lithium dodecyl sulfaat (LDS) sample buffer en 15 µ L van 10x monster reductiemiddel aan de IgG monster. Voeg 7,5 µ L van 4x LDS sample buffer en 3 µ L van 10x monster reductiemiddel om de (resterende) monsters. (Meng niet door pipetten). Incubeer voor 10 min bij 70 °C, schudden bij 1.200 rpm. Koel op ijs voor 1 min, en centrifugeer bij 1.000 x g voor 1 min bij 4 °c.

7. SDS-pagina en membraan overdracht

  1. Load gels.
    1. Voor RRI gel (4-12% bis-tris Protein gel, 10-well, 1,5 mm) plaats buizen op een magneet en afzonderlijke proteïne eluaat van de kralen. Belasting 30 µ L van steekproef per put. De steekproeven worden verdeeld door pre-bevlekt eiwit grootte teller.
    2. Voor RWB gel (4-12% bis-tris Protein gel, 10-well, 1,5 mm) plaats buizen op een magneet en afzonderlijke proteïne eluaat van de kralen. Belasting 15 µ L van steekproef per well. Sla de resterende monsters bij-20 °C op als back-ups.
  2. Voeg 500 µ L van anti-oxidant tot 500 mL van 1x SDS-Running buffer. Looppas bij 200 V in 1x SDS lopende buffer voor 50 min of tot de kleurstof voorzijde bij de bodem is.
    Opmerking: Antioxidant bevat N, N-dimethylformamide, natrium bisulfiet, die migreert met verminderde eiwitten om de reoxidatie van gevoelige aminozuren zoals methionine en tryptofaan te voorkomen.
  3. Overdracht eiwit-RNA complexen van de gel naar een nitrocellulose membraan bij 10 V voor 70 min in 1xtransfer buffer met 10% methanol (vol/vol). Spoel het RRI membraan in koude PBS, verpak het in plastic omslag, en opslag bij-80 °C.
  4. Blokkeer het RWB membraan in 5% melk in TBST bij kamertemperatuur voor 1 h. Spoel het membraan in TBST. Incubeer met primair antilichaam in TBST bij 4 °C 's nachts. Was tweemaal met TBST voor 5 min. Incubeer met secundair antilichaam (1:5000 HRP geit anti-konijn IgG) in TBST bij kamertemperatuur voor 1 h. was drie keer met TBST voor 5 min, 10 min en 15 min, respectievelijk.
  5. Mix gelijke volumes van electrochemiluminescence (ECL) buffer A en buffer B, toe te voegen aan membraan en incuberen voor 1 min. Bedek het membraan met plastic folie, en bloot te stellen aan een X-ray film bij kamertemperatuur voor 2-3 min. Dan ontwikkelen de film.
    Opmerking: De film met overbelichting zal duidelijk de vorm van de randen van het membraan tonen, waardoor de film terug naar het RWB membraan kan worden gericht. Dan, lijn de RWB en RRI membranen op basis van de posities van de markers daarin. Gelaagd in volgorde van beneden naar boven zijn de film, de RWB membraan en de RRI membraan in de juiste volgorde.

8. de isolatie van RNA

  1. Snijd het gebied van de eiwit band aan 75 kDa (ongeveer 220 NT van RNA) boven het, gebruikend het RWB membraan en de film als gidsen.
    Opmerking: Aangezien een proteïne-beschermde molecule van RNA een maximumlengte van 225 basissen kan hebben, met ongeveer 340 da per basis, is het redelijk om het gebied over 75 kDa boven de RBP band te snijden om alle proteïne-RNA complexen terug te winnen.
  2. Snijd de besneden stuk membraan in verschillende kleine plakjes, en plaats ze in een verse 1,5 mL centrifugebuis. Voeg 200 µ L van proteïnase K (PK) buffer (100 mM tris-HCl pH 7,5; 50 mM NaCl; 10 mM EDTA) met 40 µ L van PK aan de membraan stukken. Meng en incubatie voor 20 min bij 37 ° c, schudden op 1.200 rpm.
  3. Voeg 200 µ L van PK ureum buffer (100 mM tris-HCl pH 7,4; 50 mM NaCl; 10 mM EDTA; 7 M ureum) aan elk monster. Incubeer voor 20 min bij 37 °C, schudden bij 1.200 rpm.
  4. Voeg 400 µ L van zuur fenol/chloroform/isoamyl alcohol (25:24:1), meng goed en incubeer voor 5 min bij 37 °C, schudden op 1.200 rpm.
  5. Plaats 2 mL Phase Lock gel (PLG) zware buis in de centrifuge en draai bij 15.000 x g voor 25 s.
  6. Breng alle inhoud, behalve membraan plakjes naar PLG zware buis. Incubeer voor 5 min bij 37 °C, schudden bij 1.200 rpm.
  7. Draai bij kamertemperatuur en 15.000 x g voor 15 min. Breng de waterige laag over in een nieuwe conische buis van 15 ml.
  8. Gebruik RNA zuivering en concentratie kolommen om RNA te halen.
    1. Voeg 2 volumes (800 µ L) van de bindende buffer van RNA aan elk steekproef (van stap 8,7) toe en mengeling. Voeg een gelijk volume (1200 µ L) van 100% ethanol en mix.
    2. Breng 750 µ L van steekproef (van stap 8.8.1) aan de reiniging en de concentratie kolommen van RNA in een inzamelings buis over en centrifugeer bij 15.000 x g voor 30 s. de stroom van de teruggooi.
    3. Herhaal stap 8.8.2 tot alle steekproeven door de kolom worden doorgegeven. Voeg 400 µ L van RNA prep buffer aan de kolom toe en centrifugeer bij 15.000 x g voor 30 s. de stroom-door van de teruggooi, past 700 µ l van de buffer van de was van RNA toe en centrifugeer de kolom bij 15.000 x g voor 30 s. Gooi stroom-door.
    4. Voeg 400 µ L van RNA was buffer toe aan de kolom en centrifugeer bij 15.000 x g voor 2 min. Breng de kolom voorzichtig over in een nieuwe buis van 1,5 ml. Voeg 10 µ L van Nuclease water toe aan de kolom matrijs, laat zitten voor 2 min, en centrifugeer bij 15.000 x g voor 30 s. Bewaar eCLIP steekproeven bij-80 °C tot RT (stap 11,1).

9. Dephosphorylation van input RNA 3 ' ends

  1. Voeg 15 µ L van dephosphorylation Master Mix (2,5 µ L van 10x dephosphorylation buffer [100 mM tris-HCl, pH 8,0; 50 mM MgCl2; 1 M KCl; 0,2% Triton X-100; 1 mg/ml BSA]; 9,5 µ l van Nuclease-vrij water; 0,5 µ l van de Inhibitor van ase; 2,5 µ l van alkalische fosfatase) aan 10 µ l van input samples (van stap 8.8.4). Incubeer voor 15 min bij 37 °C, schudden bij 1.200 rpm.
  2. Voeg 75 µ L van PNK Master Mix (20 µ L van 5x PNK PH 6,5 buffer [350 mM tris-HCl, pH 6,5; 50 mM MgCl2]; 44 µ l van Nuclease water; 1 µ l van de remmer van ASE; 2 µ l van DNase; 7 µ l van PNK enzym; 1 µ l van 0,1 M dithiothreitol) aan steekproeven. Incubeer voor 20 min bij 37 °C, schudden bij 1.200 rpm.
  3. Opschoning van input RNA
    1. Opnieuw op te schorten thenucleic zuren extractie magnetische beadsin de flacon (Vortex voor meer dan 30 s). Voeg 20 µ L van nucleïnezuren extractie magnetische kralen voor elk monster om nieuwe buizen. Verzamel de kralen met een magnetische stand en gooi de bovendrijvende.
    2. De parels van de was eens met 1 mL van de zuiverings lysis buffer van RNA (RLT buffer). Plaats de buis op een magneet voor 30 s en gooi de bovendrijvende.
      Opmerking: Daaropvolgende scheiding van nucleïnezuren extractie magnetische kralen volgde deze stap.
    3. Hersuspendeer kralen met 300 µ L van RLT buffer en voeg toe aan het monster. Voeg 10 µ L van 5 M NaCl en 615 µ L van 100% ethylalcohol (EtOH) toe en meng door het pipetteren. Draai bij kamertemperatuur 15 min. magnetisch de kralen los en verwijder bovendrijvende.
    4. Opnieuw op te schorten kralen in 1 mL van 75% EtOH en de overdracht naar een nieuwe buis. Na 30 s, het verzamelen van de kralen met een magnetische stand en gooi de bovendrijvende. Was tweemaal met 75% EtOH, magnetische Scheid de kralen, en gooi residuele vloeistof met fijne pipet uiteinden. Lucht drogen voor 5 min (vermijd overmatig drogen).
    5. Hersuspendeer de kralen met 10 µ L van Nuclease water en Incubeer het voor 5 min. magnetisch gescheiden kralen, en verplaats 5 µ L van bovendrijvende naar een nieuwe buis (voor 3 ' adapter afbinding hieronder). Het resterende RNA kan bij-80 °C als files worden opgeslagen.

10. de adapter Afbinding van RNA aan input RNA 3 einden

  1. Voeg 1,5 µ L van DMSO en 0,5 µ L van RiL19 adapter (tabel 1) tot 5 µ l van input RNA (van stap 9.3.5) toe, incubeer voor 2 min bij 65 °c, en plaats op ijs voor meer dan 1 min. Voeg 13,5 µ l van 3 ' afbinding Master Mix toe aan elk monster , Meng door het pipetteren, en incubeer voor 75 min bij 25 °C, met flicking om elke 15 min te mengen.
    Opmerking: Afbinding Master Mix bevat 2 µ L van 10x afbinding buffer [500 mM tris-HCl, pH 7,5; 100 mM MgCl2; 10 mm dithiothreitol]; 1,5 µ L van Nuclease-vrij water; 0,2 µ L van de remmer van ASE; 0,2 µ L van 0,1 M ATP; 0,3 µ L van DMSO; 8 µ L van 50% PEG8000; 1,3 µ L van RNA ligase [30 U/µ L].
  2. Opschoning van afgebonden input RNA
    1. Magnetisch gescheiden 20 µ L van nucleïnezuren extractie magnetische kralen voor elk monster, en verwijder de bovendrijvende. Was een keer kralen met 1 mL RLT buffer.
    2. Opnieuw op te schorten kralen in 61,6 µ L van RLT buffer en overdracht schorsing aan elk monster. Voeg 61,6 µ L van 100% EtOH. Gebruik pipet te mengen voor 15 min om de 5 min. magnetisch gescheiden kralen, en verwijder bovendrijvende.
    3. Herhaal stap 9.3.4.
    4. Opnieuw op te schorten kralen met 10 µ L van Nuclease water, en laat het zitten voor 5 min. magnetische Scheid de kralen en de overdracht 10 µ L van de bovendrijvende naar een nieuwe buis.
      Opmerking: Dit is een mogelijk stoppunt (input monsters kunnen worden opgeslagen bij-80 ° c tot de volgende dag).

11. omgekeerde transcriptie, de adapter Afbinding van DNA aan cDNA 3 ' einden

  1. Voeg 0,5 µ L van RT inleiding (lijst 1) aan 10 µ l van input RNA (van stap 10.2.4) en 10 µ l van klem RNA (van stap 8.8.4) toe, respectievelijk Incubeer voor 2 min in pre-verwarmd PCR blok bij 65 °c, plaats op ijs voor meer dan 1 min.
  2. Voeg 10 µ L van RT Master Mix (2 µ L van RT buffer [500 mM tris-HCl, pH 8,3; 750 mM KCl; 30 mM MgCl2]; 4 µ l van Nuclease water; 0,3 µ l van de remmer van ASE; 2 µ l van 0,1 m dithiothreitol; 0,2 µ l van 0,1 m dATP; 0,2 µ l van 0,1 m dCTP; 0,2 µ l van 0,1 M dGTP; 0,2 µ L van 0,1 M dTTP; 0,9 µ L van omgekeerde transcriptase) aan elk monster, meng, Incubeer bij 55 °C voor 45 min op een pre-verwarmd PCR blok.
  3. Meng 20 µ L van RT reactieproduct met 3,5 µ L van PCR product Cleanup reagens. Incubeer gedurende 15 min bij 37 °C.
  4. Voeg 1 µ L van 0,5 M EDTA toe, Meng door het pipetteren. Voeg 3 µ L van 1 M NaOH toe, Meng door het pipetteren, en incubatie voor 12 min bij 70 °C op een PCR blok om het malplaatje RNA te hydroliseer.
  5. Voeg 3 µ L van 1 M HCl, pipet-mix toe om de buffer te neutraliseren.
  6. Opschoning van cDNA
    1. Magnetische afzonderlijke 10 µ L van nucleïnezuur extractie magnetische kralen voor elk monster, verwijder de bovendrijvende. Was een keer met 500 µ L van RLT buffer.
    2. Opnieuw op te schorten kralen in 93 µ L van RLT buffer en overdracht schorsing van het monster. Voeg 111,6 µ L van 100% EtOH, Incubeer het voor 5 min, en pipet Meng elke 2 min. Verzamel de kralen met een magnetische stand en gooi de bovendrijvende. Hersuspendeer kralen met 1 mL van 80% EtOH en ga naar een nieuwe buis.
    3. Na 30 s, het verzamelen van de kralen met een magnetische stand en gooi de bovendrijvende. Was tweemaal met 80% EtOH. Magnetisch gescheiden en gooi restvloeistof met fijne tip. Lucht drogen voor 5 min (vermijd overmatig drogen). Opnieuw op te schorten kralen in 5 µ L van 5 mM tris-HCl en Incubeer het voor 5 min.
  7. Voeg 0,8 µ L van de adapter van DNA (lijst 1) en 1 µ l van DMSO aan de parels toe, incubeer 2 min bij 75 °c. Plaats op ijs voor meer dan 1 minuut.
  8. Bereid 12,8 µ L van afbinding Master Mix (2 µ L van 10x afbinding buffer [500 mM tris-HCl; 100 mM MgCl2; 10 mm dithiothreitol]; 1,1 µ l van Nuclease-vrij water; 0,2 µ l van 0,1 M ATP; 9 µ l van 50% PEG8000; 0,5 µ l van de Ligase van RNA [30 U/µ l]) , Flick te mengen, kort draaien in een centrifuge, en voeg het toe aan elk monster, roer monster met pipet Tip langzaam.
  9. Voeg nog 1 µ L van RNA ligase [30 U/µ L] toe aan elk monster en flick om te mixen. Incubeer voor 30 s bij 25 °C, schudden bij 1.200 rpm. Incubeer bij 25 °C 's nachts. Flick om licht 5 tot 6 keer, eens per uur te mengen.
  10. Opschoning van afgebonden cDNA
    1. Magnetische afzonderlijke 5 µ L van nucleïnezuren extractie magnetische kralen voor elk monster, en verwijder bovendrijvende.
    2. Was een keer met 500 µ L RLT buffer.
    3. Opnieuw op te schorten kralen in 60 µ L van RLT buffer aan kralen en overdracht schorsing aan elk monster. Voeg 60 µ L van 100% EtOH, Incubeer het voor 5 min en pipet Meng elke 2 min. magnetisch gescheiden, gooi bovendrijvende.
    4. Herhaal stap 9.3.4.
    5. Hersuspendeer kralen met 27 µ L van 10 mM tris-HCl, Incubeer het voor 5 min. magnetisch gescheiden, en verplaats 25 µ L van het monster naar een nieuwe buis. Verdun de 1 µ L van afgebonden cDNA met 9 µ L van Nuclease-vrij water in een nieuwe buis. Bewaar de resterende monsters bij-20 °C tot stap 13,1.

12. kwantificering van cDNA door real-time kwantitatieve PCR (qPCR)

  1. Voeg 9 µ L van qPCR Master Mix (5 µ L van 2x Master Mix; 3,6 µ L van Nuclease-vrij water; 0,4 µ L van inleidings mengeling [10 µ M PCR-F-D50X en 10 µ M PCR-R-D70X]) aan een 96-goed qPCR plaat. Voeg 1 µ L van 1:10 verdund (in H2O) cDNA (van stap 11.10.5), afdichting en meng.
  2. Voer het qPCR programma uit in een Thermocycler: 2 min bij 50 °C; 2 min bij 95 °C; 3 s bij 95 °C, gevolgd door 30 s bij 68 °C voor 40 cycli; 15 s bij 95 °C gevolgd door 60 s bij 68 °C gevolgd door 15 s bij 95 °C voor 1 cyclus. Opmerking CT-waarde (cyclus drempel).

13. PCR versterking van cDNA

  1. Doseer 35 µ L van PCR hoofd mengeling (25 µ L van 2x PCR hoofd mengeling; 5 µ L van Nuclease water; 5 µ L van inleidings mengeling [20 µ M PCR-F-D50X en 20 µ M PCR-R-D70X]) in 8-goed stroken. Voeg voor CLIP groep 12,5 µ L van CLIP sample + 2,5 µ L van H2O toe; voor input Group, voeg 10 µ L van ingangen + 5 µ L van H2O. Meng goed en draai kort in centrifuge.
  2. Voer het PCR-programma uit: 30 s bij 98 °C; 15 s bij 98 °C gevolgd door 30 s bij 68 °C gevolgd door 40 s bij 72 °C gedurende 6 cycli; 15 s bij 98 °C gevolgd door 60 s bij 72 °C voor N cycli = (qPCR CT waarden-3)-6; 60 s bij 72 °C; 4 °C houd.
    Opmerking: Het is beter om 1 tot 2 extra PCR cycli voor de eerste paar klemmen uit te voeren.

14. gel reiniging

  1. De steekproeven van de lading op een 3% hoge resolutie agarose gel. Het verlaten van 1 leeggoed tussen de monsters, en gebruik een ladder aan beide zijden van de gel. Draaien op 100 V voor 75 min in 1x tris-Borat-EDTA (TBE) buffer.
  2. Onder blauw licht verlichting, cut gel slices 175-350 BP met behulp van verse scheermesjes voor elk monster. Leg ze in 15 mL conische buizen.
    1. Weeg de gel slice, en elueer de gel met behulp van een gel extractie Kit.
    2. Voeg 6x volumes van gel oplossende buffer toe om de gel (100 mg gel = 600 µ L van gel die buffer oplost) te smelten. Los de gel op kamertemperatuur. (Schud om elke 15 min te mengen tot de gel slice volledig is opgelost). Voeg 1 gel volume van 100% isopropanol en meng goed.
    3. Breng 750 µ L van steekproef (van stap 14.2.2) aan de kolom in een inzamelings buis over en centrifugeer bij 17.900 x g voor 1 min. Gooi doorstroming.
    4. Herhaal stap 14.2.3 totdat alle monsters zijn doorgegeven door de kolom, een keer wassen met 500 µ L van gel oplossen buffer.
    5. Voeg 750 µ L van Wash buffer (van gel extractie Kit) naar de kolom en centrifugeer bij 17.900 x g voor 1 min. Gooi de flow-through, draai bij 17.900 x g voor 2 min. plaats de kolom in een nieuwe 1,5 ml tube.
    6. Verwijder alle resterende Wash buffer van de plastic paarse rand van de kolom. Lucht drogen voor 2 min. Voeg 12,5 µ L van Nuclease-vrij water toe aan het midden van het membraan. Laat de kolom staan voor 2 min bij kamertemperatuur, en draai bij 17.900 x g voor 1 min (voor een betere opbrengst, herhaal de elutie stap).

15. TOPO kloon van PCR product

  1. Bereid de TOPO het klonen reactie mengeling voor (1 µ L van PCR product van stap 14.2.6; 1 µ L van het klonen mengeling; 3 µ L van steriel water). Meng zachtjes en incubeer gedurende 5 min bij 20-37 °C. Koel op ijs.
  2. Ontdooi chemisch bevoegde E. coli bacteriën op ijs. Voeg 5 µ L van de TOPO klonen product aan 100 µ L van de bevoegde bacteriën29. Zachtjes goed mengen. Incubeer op ijs voor 30 min.
  3. Heat-shock voor 60 s bij 42 °C. Vervolgens koel op ijs voor 2 min. Voeg 900 µ L van lysogeny Bouillon (LB) medium, Incubeer bij 37 ° c voor 1 uur, schudden op 225 rpm. Draai bij 1.000 x g voor 1 min, en verwijder dan 900 µ l van bovendrijvende. De rest van de oplossing opnieuw op te schorten.
  4. Plaat de getransformeerde bacteriën op 1,5% LB agar platen met AMPICILLIN (100 µ g/mL), en broeden 's nachts op 37 °C.
  5. Bereid ten minste 20 1,5 mL centrifuge buizen voor elke constructie. Vul een set met 500 µ L van LB medium met 100 µ g/mL AMPICILLIN. Gebruik een steriele pipet tip om af te krabben een bacteriële kolonie willekeurig en meng (door pipet) met 500 µ L van LB medium. Incubeer bij 37 °C voor 5 h, schudden bij 225 rpm.
  6. Volgorde het insert fragment met de M13 reverse primer: CAGGAAACAGCTATGAC door Sanger sequencing30.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

De eCLIP procedure en de resultaten worden geïllustreerd in figuur 1, Figuur 2, Figuur 3, Figuur 4. Muizen werden euthanized met koolstofdioxide en een kleine incisie werd gemaakt in de onderbuik met behulp van chirurgische schaar (Figuur 2a,B). Muis testes werden verwijderd, detunicated en vervolgens UV-kruisverwijzende na het slijpen (figuur 2c-I). Representatieve eCLIP resultaten van het gebruik van twee bekende RNA-bindende helicases in testis weefsels zijn afgebeeld in Figuur 3 en 4. We voerden MOV10 eCLIP in testes van volwassen wild-type muizen, met gemeenschappelijke concentratie van 40 U/mL van de ASE ik de behandeling van de kruisverwijzende lysate. Het hoogste paneel van Figuur 3a toont aan dat het doel eiwit formaat ongeveer 114 kDa met succes werd verrijkt. De westelijke vlek van immunoprecipitated MOV10L1 proteïnen werd uitgevoerd met twee concentraties (5 of 40 U/mL) van ASE I tijdens het eCLIP proces (Figuur 3a). Figuur 3b toont qPCR met behulp van 1:10 verdunde cDNA (reeds AFGEBONDEN met DNA-adapter) van MOV10 en MOV10L1 UV-kruisverwijzende, niet-kruisverwijzende, en de gepaarde grootte matched input (SMInput) sample. De niet-kruisverwijzende steekproeven tonen verminderde terugwinning van RNA. We hebben vastgesteld dat de CT-waarden van de niet-kruisverwijzende groep was over het algemeen 5 keer meer dan UV-kruisverwijzende groep. Figuur 4a toont PCR versterking en grootte selectie via Agarose de Elektroforese van het gel (besnoeiing 175-350 BP). Primer-dimeer product verschijnt op ongeveer 140 BP. Figure 4b toont de UCSC genoom Browser View van twee representatieve subclone sequenties. MOV10-gebonden eCLIP Tags blijken te zijn gevestigd in de 3 ' UTR van Gene FTO; De geschatte snelheid van 3 ' UTR doelstellingen is goed voor 75% (figuur 4c), in overeenstemming met de meerderheid van de MOV10 doelstellingen in HEK293 cellen10 en in testes (gegevens niet getoond). In tegenstelling, MOV10L1-gebonden eCLIP Tags zijn gevonden om te worden gevestigd in een piRNA cluster met vermelding van MOV10L1 doelen piRNA precursoren. Het geschatte tarief van piRNA voorloper doelstellingen is goed voor 42% (figuur 4e), wat een trend weerspiegelt van onze vorige conventionele clip experiment20. MOV10L1 eCLIP met 40 U/mL-ASE I de spijsvertering opbrengsten vrij meer opeenvolgingen met minder dan 20 BP (cijfer 4D).

Figure 1
Figuur 1 : Schematische weergave van eCLIP. UV-kruisverwijzende muis seminiferous tubuli (stap 1) zijn lysed in eCLIP lysis buffer en sonicated (stap 2). Lysate wordt behandeld met ASE I aan fragment RNA, waarna proteïne-RNA de complexen zijn immunoprecipitated gebruikend het anti-RBP antilichamen (stap 3-4). Dephosphorylation van de fragmenten van RNA en Afbinding van 3 ′ de adapter van RNA worden uitgevoerd (stap 5-6). Eiwit-RNA complexen worden uitgevoerd op een SDS-pagina gel en overgebracht naar nitrocellulose membranen (stap 7). RNA wordt teruggekregen van het membraan door de proteïne met proteïnase K en ureum te verteren die een kort polypeptide blijvend bij de crosslink plaats verlaat. Dephosphorylation van de fragmenten van RNA van input steekproeven en Afbinding van 3 ′ de adapter van RNA wordt uitgevoerd (stap 8). Uitvoeren RT van RNA en Afbinding van 3 ' DNA-adapter (stap 9-10). Voer PCR versterking van cDNA Library, gel extractie, en stomp-end PCR klonen voor voorlopige bibliotheek kwaliteitscontrole (stap 11) uit. Ten slotte voert u high-throughput sequencing (stap 12). Klik hier om een grotere versie van dit cijfer te bekijken.

Figure 2
Figuur 2 : Testisweefsel oogsten en UV-crosslinking. (A) de blootstelling van de muis buik. (B) een 0,5 cm incisie in de buikwand bloot het buikvlies. (C) een paar van de testikels worden genomen door het uittrekken van de vette pads. (D) testiculaire weefsel wordt verwijderd en geplaatst in een klein gerecht met ijskoude PBS. (E) Verwijder voorzichtig de tunica albuginea. (F) druk op de losse stamper om het weefsel te fijnstampen in een weefsel slijper dounce. (G) gedistribueerd seminiferous tubuli in een 10 cm plaat. (H) UV crosslinking met 400 MJ/cm2 energie. Ide kruisverwijzende monsters worden verzameld in 1,5 ml centrifuge buizen. Klik hier om een grotere versie van dit cijfer te bekijken.

Figure 3
Figuur 3 : Representatieve resultaten van MOV10 en MOV10L1 eCLIP. (A) westelijke vlek bevestiging van MOV10 en MOV10L1 immunoprecipitates. (B) qPCR op 1:10 verdunde eCLIP bibliotheken van MOV10 en MOV10L1, met replicatie voor UV, niet-UV en de gepaarde SMInput monsters. Klik hier om een grotere versie van dit cijfer te bekijken.

Figure 4
Figuur 4 : eCLIP bibliotheek voorbereiding en kwaliteitsbeoordeling. (A) de gel beelden van PCR versterking worden getoond. Asterisk geeft aan primer dimeer. De rode gestippelde lijn wijst op gebieden die voor PCR product van cDNA, ergens tussen 175 en 350 BP worden geaccijnst. (B) UCSC genoom browser mening van twee representatieve subclone opeenvolgingen31. (C) kleinschalige subkloon sequencing analyse van MOV10. (D) MOV10L1 Tags tonen verschillende patronen van lengte verdeling wanneer verwerkt door twee verschillende ASE concentraties. (E) kleinschalige subkloon sequencing analyse van MOV10L1. Klik hier om een grotere versie van dit cijfer te bekijken.

Naam van reeks Sequence informatie Beschrijving
De adapters van RNA
RNA X1A /5Phos/AUAUAGGNNNNNAGAUCGGAAGAGCGUCGUGUAG/3SpC3/ voorraad bij 200 µ M; werken bij 20 µ M
RNA X1B /5Phos/AAUAGCANNNNNAGAUCGGAAGAGCGUCGUGUAG/3SpC3/ voorraad bij 200 µ M; werken bij 20 µ M
RiL19 /5phos/AGAUCGGAAGAGCGUCGUG/3SpC3/ voorraad bij 200 µ M; werken bij 40 µ M
De adapter van DNA
Rand103tr3 /5Phos/NNNNNNNNNNAGATCGGAAGAGCACACGTCTG/3SpC3/ voorraad bij 200 µ M; werken bij 80 µ M
RT primer
AR17 ACACGACGCTCTTCCGA voorraad bij 200 µ M; werken bij 20 µ M
PCR inleidingen

PCR-F-D 501
AATGATACGGCGACCACCGAGATCTACACTATAGCCTACACTCTTTCCCTACACGACGCTCTTCCGATCT voorraad bij 100 µ M; werken bij 20 µ M
PCR-R-D 701 CAAGCAGAAGACGGCATACGAGATCGAGTAATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC voorraad bij 100 µ M; werken bij 20 µ M
(Zie lichtsterkte klantenservice brief voor D502-508, D702-712)

Tabel 1: adapter en primer sequenties. De adapter bevat een in-line Random-Mer (ofwel N5 of N10) om te bepalen of twee identieke sequentieel leest wijzen op twee unieke RNA fragmenten of PCR duplicaten van hetzelfde RNA fragment. "5 PHOS" staat voor 5 ' phosphorylation, die nodig is als een oligo wordt gebruikt als een substraat voor DNA/RNA ligase. "3SpC3" staat voor 3 ' C3 spacer, die kan voorkomen afbinding tussen adapters.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Met het toenemende begrip van de universele rol van RBPs onder zowel biologische als pathologische contexten, zijn de klem methodes wijd gebruikt om de moleculaire functie van RBPs20,32,33te openbaren, 34,35. Het hier beschreven protocol vertegenwoordigt een aangepaste toepassing van de eCLIP-methode op muis testis.

Een uitdaging in het uitvoeren van eCLIP in testis is het behoud van de levensvatbaarheid en de integriteit van verse testiculaire cellen, die ook belangrijk is voor een effectieve crosslinking. Het scheren van de testis met milde mechanische kracht met behulp van de losse stamper kan voorkomen dat cel lysis32,36. De juiste spijsvertering van RNA is ook kritiek voor succesvolle eCLIP analyses. De fragmenten van RNA zouden meer convergente na spijsvertering kunnen zijn, maar de lengte minder dan 20 BP kan via pre-processing van de bibliotheek worden verwijderd leest. Met het oog op een ideale ASE dosering voor een RBP kandidaat vast te stellen, raden we een voorlopige test op basis van de resultaten van de subkloon sequencing van eCLIP bibliotheken die kunnen worden voorbereid door de behandeling van de ASE, met concentraties variërend van 0 u tot 40 U (per milliliter van lysate). De kleinschalige subkloon sequencing analyse is een aanbevolen stap voor een betrouwbaar onderzoek van de kwaliteit van de bibliotheek in onze eCLIP methode. Ten eerste, het percentage van de inserts korter dan 20 BP mag niet te hoog zijn, of de daaropvolgende pre-processing van eCLIP Library zal leiden tot een kostbaar verlies van leest. Ten tweede moet de efficiëntie van de juiste Afbinding van beide adapters worden gecontroleerd. Substandaard monsters kunnen worden geëlimineerd zonder diepe sequencing te zorgen voor een succesvolle diepe sequencing, waarvan de resultaten in het algemeen veel langer duren om te analyseren.

Hoewel de haalbaarheid van eCLIP in muis testis nog door de specificiteit van het antilichaam voor de stap van Immunoprecipitation wordt beperkt, is eCLIP voordelig over conventionele klem methodes in verscheidene aspecten. Ten eerste is het een niet-radioactieve methode. Door eCLIP, zijn de doelstellingen van RNA van RBPs direct gevangen in vivo zonder het moeten aan arbeidsintensieve technieken gebruikend radioactieve materialen toevlucht nemen. Ten tweede, de methode is minder tijd intensief. De hele procedure duurt slechts 4 dagen door middel van eCLIP bibliotheek voorbereiding. Derde, opeenvolging diversiteit. Vergeleken met de conventionele Verenigde versterkings cyclus van 25-35 cycli, verwijst ECLIP naar CT waarden van qPCR om het aantal PCR cycli specifiek te plaatsen. Ten slotte biedt het een sterkere signaal-ruisverhouding. De grootte-matched input dient als een geschikte achtergrond voor authentieke doelen.

Samengevat, onze eCLIP resultaten consolideren de conclusies dat MOV10 en MOV10L1 hebben een bindende voorkeur aan mRNA 3 ' UTR en piRNA precursoren, respectievelijk. Het protocol dat we hierin beschreven, vertegenwoordigt de eerste tewerkstelling van de eCLIP methode in reproductie, een gebied waarin RNA-RBP interactie kennis nogal ontoereikend is, hoewel genetische studies voldoende informatie hebben verschaft over de biologische rol van RBPs. visualisatie van dit eCLIP protocol kan helpen zijn wijdverspreide toepassingen in bredere gebieden te begeleiden.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

De auteurs hebben niets te onthullen.

Acknowledgments

Wij danken Eric L van strand en Gene W Yeo voor nuttige begeleiding bij het oorspronkelijke protocol. K.Z. werd gesteund door nationale belangrijke R & D programma van China (2016YFA0500902, 2018YFC1003500), en de nationale stichting van de natuurwetenschappen van China (31771653). L.Y. werd gesteund door de nationale stichting van de natuurwetenschappen van China (81471502, 31871503) en innovatief en ondernemend programma van provincie Jiangsu.

Materials

Name Company Catalog Number Comments
Antibodies
Anti-mouse MOV10  antibody Proteintech, China 10370-1-AP
Anti-mouse MOV10L1 antibody Zheng et al.20109 polyclonal antisera UP2175 provided by P. Jeremy Wang lab, University of Pennsylvania
HRP Goat Anti-Rabbit IgG  ABclonal AS014
Rabbit IgG Beyotime, China A7016
Equipment
Centrifuge Eppendorf, Hamburg, Germany 5242R
Digital sonifier BRANSON,USA BBV12081048A 450 Watts; 50/60 Hz
DynaMag-2 Magnet Invitrogen,USA 12321D
Mini Blot Module Invitrogen,USA B1000
Mini Gel Tank Invitrogen,USA A25977
Shaking incubator Eppendorf, Hamburg, Germany Thermomixer comfort 
Tissue Grinder, Dounce PYREX, USA 1234F35 only  the "loose" pestle is used in this protocol
TProfessional standard 96 Gradient Biometra, Germany serial no.: 2604323
Tube Revolver  Crystal, USA serial no.: 3406051
UV-light cross-linker UVP, USA CL-1000
Materials
TC-treated Culture Dish Corning, USA 430167 100 mm 
Tubes Corning, USA 430791 15 mL
Microtubes tubes AXYGEN , USA MCT-150-C 1.5 mL 
Reagents 
Acid phenol/chloroform/isoamyl alcohol  Solarbio, China P1011 25:24:01
AffinityScript Enzyme Agilent, USA 600107
Antioxidant Invitrogen,USA NP0005
DH5α competent bacteria Thermo Scientific, USA 18265017 these economical cells yield >1 x 106 transformants/µg control DNA per 50 µL reaction.
DMSO Sigma-Aldrich, USA D8418
DNA Ladder Invitrogen, USA 10416014
dNTP Sigma-Aldrich, USA DNTP100-1KT
Dynabeads Protein A  Invitrogen, USA 10002D
ECL reagent Vazyme, China E411-04
EDTA Invitrogen, USA AM9260G
EDTA free protease inhibitor cocktail Roche, USA 04693132001 add fresh
Exo-SAP-IT Affymetrix, USA 78201 PCR Product Cleanup Reagent 
FastAP enzyme Thermo Scientific, USA EF0652
LDS Sample Buffer Thermo Scientific, USA NP0007
MetaPhor Agarose  lonza, Switzerland 50180
MgCl2 Invitrogen, USA AM9530G
MiniElute gel Extraction QIAGEN, Germany 28604 column store at 4 ?; buffer QG=gel dissolving buffer; buffer PE= wash buffer(for step 14)
MyONE Silane beads Thermo Scientific, USA 37002D nucleic acids extraction magnetic beads
NaCl Invitrogen,USA AM9759
 
NP-40 Amresco, USA M158-500ML
NuPAGE Bis-Tris Protein Gels Invitrogen, USA NP0336BOX 4%–12%,1.5 mm, 15-well
NuPAGE MOPS SDS Buffer Kit  Invitrogen, USA NP0050
PBS Gibco, USA 10010023
Phase-Locked Gel (PLG) heavy tube   TIANGEN, China WM5-2302831
PowerUp SYBR Green Master Mix Applied Biosystems, USA A25742
Proteinase K NEB, New England  P8107S
Q5 PCR master mix  NEB, New England  M0492L
RLT buffer QIAGEN, Germany 79216 RNA purification lysis buffer 
RNA Clean & Concentrator-5 columns  ZYMO RESEARCH, USA R1016 RNA purification and concentration columns
RNase I  Invitrogen, USA AM2295
RNase Inhibitor Promega, USA N251B
RQ1 DNase Promega,USA M610A
Sample Reducing Agent Invitrogen,USA NP0009
SDS Solution Invitrogen, USA 15553027 10%
Sodium deoxycholate Sigma-Aldrich, USA 30970 protect from light
T4 PNK enzyme NEB, New England  M0201L
T4 RNA ligase 1 high conc NEB, New England  M0437M
TA/Blunt-Zero Cloning Mix Vazyme, China C601-01
TBE Invitrogen,USA AM9863
Tris-HCI Buffer Invitrogen, USA 15567027
Triton X-100 Sangon Biotech, China A600198 
Tween-20 Sangon Biotech, China A600560
Urea Sigma-Aldrich, USA U5378
X-ray Films Caresteam, Canada 6535876

DOWNLOAD MATERIALS LIST

References

  1. Turner, J. M., Mahadevaiah, S. K., Ellis, P. J., Mitchell, M. J., Burgoyne, P. S. Pachytene asynapsis drives meiotic sex chromosome inactivation and leads to substantial postmeiotic repression in spermatids. Developmental Cell. 10, (4), 521-529 (2006).
  2. Turner, J. M. A. Meiotic sex chromosome inactivation. Development. 134, (10), 1823-1831 (2007).
  3. Kimmins, S., Sassone-Corsi, P. Chromatin remodelling and epigenetic features of germ cells. Nature. 434, (7033), 583-589 (2005).
  4. Ule, J., et al. CLIP identifies Nova-regulated RNA networks in the brain. Science. 302, (5648), 1212-1215 (2003).
  5. Ule, J., Jensen, K., Mele, A., Darnell, R. B. CLIP: a method for identifying protein-RNA interaction sites in living cells. Methods. 37, (4), 376-386 (2005).
  6. Trifillis, P., Day, N., Kiledjian, M. Finding the right RNA: identification of cellular mRNA substrates for RNA-binding proteins. RNA. 5, (8), 1071-1082 (1999).
  7. Tenenbaum, S. A., Carson, C. C., Lager, P. J., Keene, J. D. Identifying mRNA subsets in messenger ribonucleoprotein complexes by using cDNA arrays. Proceedings of National Acadamy of Sciences U S A. 97, (26), 14085-14090 (2000).
  8. Chi, S. W., Zang, J. B., Mele, A., Darnell, R. B. Argonaute HITS-CLIP decodes microRNA-mRNA interaction maps. Nature. 460, (7254), 479-486 (2009).
  9. Zheng, K., et al. Mouse MOV10L1 associates with Piwi proteins and is an essential component of the Piwi-interacting RNA (piRNA) pathway. Proceedings of National Acadamy of Sciences U S A. 107, (26), 11841-11846 (2010).
  10. Gregersen, L. H., et al. MOV10 Is a 5' to 3' RNA helicase contributing to UPF1 mRNA target degradation by translocation along 3' UTRs. Molecular Cell. 54, (4), 573-585 (2014).
  11. Banerjee, S., Neveu, P., Kosik, K. S. A coordinated local translational control point at the synapse involving relief from silencing and MOV10 degradation. Neuron. 64, (6), 871-884 (2009).
  12. Choi, J., Hwang, S. Y., Ahn, K. Interplay between RNASEH2 and MOV10 controls LINE-1 retrotransposition. Nucleic Acids Research. 46, (4), 1912-1926 (2018).
  13. Goodier, J. L., Cheung, L. E., Kazazian, H. H. Jr MOV10 RNA helicase is a potent inhibitor of retrotransposition in cells. PLoS Genetics. 8, (10), e1002941 (2012).
  14. Haussecker, D., et al. Capped small RNAs and MOV10 in human hepatitis delta virus replication. Nature Structural & Molecular Biology. 15, (7), 714-721 (2008).
  15. Kenny, P. J., et al. MOV10 and FMRP regulate AGO2 association with microRNA recognition elements. Cell Reports. 9, (5), 1729-1741 (2014).
  16. Messaoudi-Aubert, S. E., et al. Role for the MOV10 RNA helicase in Polycomb-mediated repression of the INK4a tumor suppressor. Nature Structural & Molecular Biology. 17, (7), 862-868 (2010).
  17. Sievers, C., Schlumpf, T., Sawarkar, R., Comoglio, F., Paro, R. Mixture models and wavelet transforms reveal high confidence RNA-protein interaction sites in MOV10 PAR-CLIP data. Nucleic Acids Research. 40, (20), e160 (2012).
  18. Skariah, G., et al. Mov10 suppresses retroelements and regulates neuronal development and function in the developing brain. BMC Biology. 15, (1), 54 (2017).
  19. Zheng, K., Wang, P. J. Blockade of pachytene piRNA biogenesis reveals a novel requirement for maintaining post-meiotic germline genome integrity. PLoS Genetics. 8, (11), e1003038 (2012).
  20. Vourekas, A., et al. The RNA helicase MOV10L1 binds piRNA precursors to initiate piRNA processing. Genes & Development. 29, (6), 617-629 (2015).
  21. Hocq, R., Paternina, J., Alasseur, Q., Genovesio, A., Le Hir, H. Monitored eCLIP: high accuracy mapping of RNA-protein interactions. Nucleic Acids Research. 46, (21), 11553-11565 (2018).
  22. Huppertz, I., et al. iCLIP: protein-RNA interactions at nucleotide resolution. Methods. 65, (3), 274-287 (2014).
  23. Hafner, M., et al. Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 141, (1), 129-141 (2010).
  24. Hafner, M., et al. PAR-CliP--a method to identify transcriptome-wide the binding sites of RNA binding proteins. Journal of Visualized Experiments. (41), (2010).
  25. Konig, J., et al. iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nature Structural & Molecular Biology. 17, (7), 909-915 (2010).
  26. Konig, J., et al. iCLIP--transcriptome-wide mapping of protein-RNA interactions with individual nucleotide resolution. Journal of Visualized Experiments. (50), (2011).
  27. Maticzka, D., Ilik, I. A., Aktas, T., Backofen, R., Akhtar, A. uvCLAP is a fast and non-radioactive method to identify in vivo targets of RNA-binding proteins. Nature Communications. 9, (1), 1142 (2018).
  28. Van Nostrand, E. L., et al. Robust transcriptome-wide discovery of RNA-binding protein binding sites with enhanced CLIP (eCLIP). Nature Methods. 13, (6), 508-514 (2016).
  29. Radulovich, N., Leung, L., Tsao, M. S. Modified gateway system for double shRNA expression and Cre/lox based gene expression. BMC Biotechnology. 11, 24 (2011).
  30. Breunig, C. T., et al. A Customizable Protocol for String Assembly gRNA Cloning (STAgR). Journal of Visualized Experiments. (142), (2018).
  31. Kuhn, R. M., Haussler, D., Kent, W. J. The UCSC genome browser and associated tools. Briefings in Bioinformatics. 14, (2), 144-161 (2013).
  32. Vourekas, A., et al. Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis. Nature Structural & Molecular Biology. 19, (8), 773-781 (2012).
  33. Preitner, N., et al. APC is an RNA-binding protein, and its interactome provides a link to neural development and microtubule assembly. Cell. 158, (2), 368-382 (2014).
  34. Meyer, C., et al. The TIA1 RNA-Binding Protein Family Regulates EIF2AK2-Mediated Stress Response and Cell Cycle Progression. Molecular Cell. 69, (4), 622-635 (2018).
  35. Gerstberger, S., Hafner, M., Tuschl, T. A census of human RNA-binding proteins. Nature Reviews Genetics. 15, (12), 829-845 (2014).
  36. Vourekas, A., Mourelatos, Z. HITS-CLIP (CLIP-Seq) for mouse Piwi proteins. Methods in Molecular Biology. 1093, 73-95 (2014).
Verbeterde crosslinking Immunoprecipitation (eCLIP) methode voor efficiënte identificatie van proteïne-verbindend RNA in muis testis
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Xu, Q., Wang, C., Ling, L., Yue, Q., Liu, M., Zhang, S., Fu, K., Ye, L., Zheng, K. Enhanced Crosslinking Immunoprecipitation (eCLIP) Method for Efficient Identification of Protein-bound RNA in Mouse Testis. J. Vis. Exp. (147), e59681, doi:10.3791/59681 (2019).More

Xu, Q., Wang, C., Ling, L., Yue, Q., Liu, M., Zhang, S., Fu, K., Ye, L., Zheng, K. Enhanced Crosslinking Immunoprecipitation (eCLIP) Method for Efficient Identification of Protein-bound RNA in Mouse Testis. J. Vis. Exp. (147), e59681, doi:10.3791/59681 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter