Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Biology

Méthode améliorée d’Immunopréprécipitation de réticulation (eCLIP) pour l’identification efficace de l’ARN lié aux protéines dans les testicules de souris

doi: 10.3791/59681 Published: May 10, 2019
* These authors contributed equally

Summary

Ici, nous présentons un protocole eCLIP pour déterminer les principales cibles d’ARN des candidats du RBP dans les testicules.

Abstract

La spermèse définit un processus hautement ordonné de différenciation des cellules germinales mâles chez les mammifères. Dans le testis, la transcription et la traduction sont découplées, soulignant l’importance de la régulation post-transcriptionnelle de l’expression génique orchestrée par les RPB. Pour élucider les rôles mécanistes d’un RBP, la méthodologie d’immunopréprécipitation croisée (CLIP) peut être utilisée pour capturer ses cibles d’ARN directes endogènes et définir les sites d’interaction réels. Le CLIP amélioré (eCLIP) est une méthode nouvellement développée qui offre plusieurs avantages par rapport aux CLIPs conventionnels. Cependant, l’utilisation de eCLIP a jusqu’à présent été limitée aux lignées cellulaires, appelant à des applications élargies. Ici, nous avons employé eCLIP pour étudier MOV10 et MOV10L1, deux hélicases connues de liaison d’ARN, dans des testicules de souris. Comme prévu, nous constatons que MOV10 se lie principalement à 3 'régions non traduites (UTRs) de mRNA et MOV10L1 se lie sélectivement aux transcriptions des précurseurs de l’ARN en interaction piwi (piRNA). Notre méthode eCLIP permet la détermination rapide des principales espèces d’ARN liées par divers RPB par le séquençage à petite échelle des sous-clones et donc la disponibilité des bibliothèques qualifiées, comme un mandat pour procéder à un séquençage profond. Cette étude établit une base applicable pour eCLIP dans les testicules des mammifères.

Introduction

Le testicules de mammifères représente un excellent modèle de développement dans lequel un programme complexe de différenciation cellulaire s’exécute cycliquement pour produire de nombreux spermatozoïdes. Une valeur unique de ce modèle réside dans l’émergence de l’inactivation transcriptionnelle à certains stades de la spermèse, typiquement lorsque l’inactivation des chromosomes sexuels méiotiques (MSCI) se produit1,2 et lorsque les spermatides ronds subissent compactage nucléaire drastique pendant la spermiogenèse3. Ces événements transcriptionnels inconsécutifs nécessitent une régulation génique post-transcriptionnelle, dans laquelle les protéines liant l’ARN (RPB) jouent un rôle crucial, formant le transcriptome et conservant la fertilité masculine.

Pour identifier les cibles d’ARN de bonne foi d’un RBP individuel in vivo, la méthode de réticulation par immunoprécipitation (clip) a été développée4,5, basée sur mais au-delà de l’immunopreprécipitation à l’ARN ordinaire (RIP)6,7 , par incorporation d’étapes clés, y compris la réticulation ultraviolette (UV), un transfert de gel et de lavage rigoureux pour améliorer la spécificité du signal. L’application avancée du CLIP combinée à un séquençage à haut débit a suscité un grand intérêt pour le profilage de l’interaction protéine-ARN aux niveaux8de l’ensemble du génome. En plus des études génétiques sur la fonction RBP, ces méthodes biochimiques qui identifient l’interaction directe de la protéine endogène et de l’ARN ont été indispensables pour élucider avec précision les rôles de régulation de l’ARN des RPB. Par exemple, MOV10L1 est une hélicase d’ARN spécifique aux testicules requise pour la fertilité masculine et la biogenèse9de l’ARN en interaction piwi (Pirna). Son paralogue MOV10 est connu comme une hélicase d’ARN façon ubiquitaire exprimée et multifonctionnelle avec des rôles dans de multiples aspects de la biologie de l’ARN10,11,12,13,14 , le 15 , le 16 , le 17 , 18. en employant le clip-SEQ conventionnel, nous avons constaté que MOV10L1 lie et régule les précurseurs de Pirna primaires pour initier le traitement de Pirna précoce19,20, et que MOV10 lie mRNA 3 'utrs et aussi bien que l’ARN de non codantes cellules germinales testiculaires (données non illustrées).

Néanmoins, CLIP est à l’origine une procédure laborieuse et radioactive suivie par la préparation de la bibliothèque de séquençage avec une perte remarquable de balises CLIP. Dans le CLIP conventionnel, une bibliothèque d’ADNc est préparée à l’aide d’adaptateurs ligés aux deux extrémités de l’ARN. Après la digestion des protéines, les polypeptides courts réticulé demeurent attachés à des fragments d’ARN. Cette marque de réticulation bloque partiellement la progression de la transcriptase inverse (RTase) pendant la synthèse de l’ADNc, ce qui entraîne des cDNAs tronqués qui représentent environ 80% de la bibliothèque de l’ADNc21,22. Ainsi, seuls les fragments d’ADNc résultant de RTase contournant le site de réticulation (lecture-à travers) sont séquencés. Récemment, diverses approches de CLIP, telles que PAR-CLIP, iCLIP, eCLIP et uvCLAP, ont été employées pour identifier les sites de Crosslink des RBPs dans les cellules vivantes. PAR-CLIP implique l’application de 365 nm de rayonnement UV et d’analogues de nucléotides photoactivables et est donc exclusif à la culture des cellules vivantes, et l’incorporation d’analogues nucléosidiques dans les transcriptions nouvellement synthétisées est sujette à la production de biais où l’ARN interagit physiquement avec la protéine23,24. Dans iCLIP, un seul adaptateur est ligné à l’extrémité 3 'des fragments d’ARN réticulés. Après la transcription inversée (RT), les cDNAs tronqués et lus-through sont obtenus par circularisation intramoléculaire et relinéarisation, puis par amplification de la polymérase en chaîne (PCR)25,26. Cependant, l’efficacité de la circularisation intramoléculaire est relativement faible. Bien que les protocoles CLIP plus anciens ont besoin d’étiquetage de l’ARN réticulé avec un radio-isotopes, la réticulation ultraviolette et la purification d’affinité (uvCLAP), avec un processus de purification d’affinité tandem stricte, ne repose pas sur la radioactivité27. Néanmoins, uvCLAP est limitée aux cellules cultivées qui doivent être transftées avec le vecteur d’expression portant la balise 3x FLAG-HBH pour la purification d’affinité en tandem.

Dans eCLIP, les adaptateurs ont été lignés d’abord à l’extrémité 3 'de l’ARN suivie de RT, et ensuite à l’extrémité 3 'des cDNAs en mode intermoléculaire. Par conséquent, eCLIP peut capturer tous les cDNA28tronqués et lus. En outre, il n’est ni limité à l’étiquetage radioactif, ni à l’utilisation de lignées cellulaires en fonction de son principe, tout en conservant une résolution mono-nucléotide.

Ici, nous fournissons une description étape par étape d’un protocole eCLIP adapté pour les testicules de souris. Brièvement, ce protocole eCLIP commence par une réticulation UV des tubules testiculaires, suivie d’une digestion partielle de la RNase et d’une immunopréprécipitation à l’aide d’un anticorps spécifique aux protéines. Ensuite, l’ARN lié aux protéines est déphosphorylé, et l’adaptateur est ligné à son extrémité 3 '. Après l’électrophorèse sur gel protéique et le transfert gel-membrane, l’ARN est isolé en coupant la zone membranaire d’une fourchette de taille attendue. Après RT, l’adaptateur d’ADN est ligné à l’extrémité 3 'de l’ADNc suivi de l’amplification par PCR. Le filtrage des sous-clones avant le séquençage à haut débit est considéré comme un contrôle de qualité de bibliothèque. Ce protocole est efficace pour identifier les principales espèces d’ARN lié aux protéines des RPB, illustré par les deux hélicases d’ARN exprimant le testif MOV10L1 et MOV10.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Toutes les expérimentations animales réalisées ont été approuvées par le Comité de l’Université médicale de Nanjing. Les souris mâles C57BL/6 ont été maintenues dans des conditions de photopériode contrôlées et ont été livrées avec de la nourriture et de l’eau.

1. récolte de tissus et réticulation UV

  1. Euthanasier 2 souris adultes à l’aide de dioxyde de carbone (CO2) pendant 1-2 min ou jusqu’à ce que la respiration s’arrête. Ensuite, effectuez la dislocation cervicale sur chaque souris.
  2. Récolter environ 100 mg de testicules provenant de souris d’âge approprié (un testif adulte dans cette étude) pour chaque expérience d’immunopréprécipitation, et placer les tissus dans la solution saline tamponnée au phosphate de glace froide (PBS).
  3. Retirer le Tunica albuginée doucement avec une paire de pincettes fines pointes.
  4. Ajouter 3 mL de PBS glacé dans un broyeur de tissus et triturer le tissu par une force mécanique légère à l’aide d’un pilon en verre lâche (Pilon en verre de type A).
    Remarque: Le but de cette étape n’est pas de lyser les cellules, mais de se séparer du tissu. La préservation de la viabilité et de l’intégrité des cellules est importante.
  5. Transférer la suspension tissulaire à un plat de culture cellulaire (10 cm de diamètre) et ajouter du PBS glacé jusqu’à 6 mL.
  6. Secouez la plaque rapidement afin que le liquide recouvre le fond du plat uniformément. Si le tissu est broyé correctement, les tubules séminaux distribués uniformément seront visibles, tandis que la présence de touffis tissulaires indique que la dispersion tissulaire est sous-optimale.
  7. Crosslink la suspension trois fois avec 400 mJ/cm2 à 254 nm sur la glace. Mélanger la suspension entre chaque irradiation.
    Remarque: Pour chaque nouvelle expérience, la réticulation doit être optimisée.
  8. Prélever la suspension dans un tube conique de 15 mL et le pellet à 1 200 x g pendant 5 min à 4 ° c. Retirez le surnageant, Resuspendez le culot dans 1 mL de PBS, puis transférez la suspension dans un tube de centrifugation de 1,5 mL. Tourner à 4 ° c et 1 000 x g pendant 2 min, et enlever le surnageant.
  9. À ce stade, procéder immédiatement au reste du protocole, ou enclencher le gel des granulés dans l’azote liquide et stocker à-80 ° c jusqu’à l’utilisation.

2. préparation des billes

  1. Ajouter 125 μL de billes magnétiques de protéine A par échantillon (Pellet) à un tube de centrifugation fraîche.
    Remarque: Utilisez des billes magnétiques de protéine G pour les anticorps de souris.
  2. Placez le tube sur l’aimant pour séparer les billes de la solution. Après 10 s, enlevez le surnageant. Lavez les billes deux fois avec 1 mL de tampon de lyse glacé.
    Remarque: La séparation subséquente des billes magnétiques de protéine A suit cette étape. La composition du tampon de lyse est 50 mM Tris-HCl, pH 7,5; 100 mM NaCl; 1% NP-40; 0,1% SDS; 0,5% de désoxycholate de sodium; 1/50 cocktail inhibiteur de protéase sans acide éthylenediaminetétraacétique (EDTA) (Ajouter frais).
  3. Resuspendre les billes dans 100 μL de tampon de lyse à froid avec 10 μg d’anticorps eCLIP. Faire pivoter les tubes à température ambiante pendant 45 min.
    Remarque: La concentration finale d’anticorps pour l’immunopréprécipitation est de 10 μg/mL. Si la concentration d’anticorps est inconnue, la quantité d’anticorps doit être optimisée.
  4. Lavez les billes deux fois avec 1 mL de tampon de lyse glacé.

3. Lyse tissulaire et digestion à l’ARN partiel

  1. Resuspendre les pastilles de tissu dans 1 mL de tampon de lyse à froid (Ajouter 22 μL de cocktail d’inhibiteur de protéine libre de 50x (EDTA) et 11 μL d’inhibiteur de RNase à 1 mL de tampon de lyse).
    1. Resuspendre deux pastilles réticulé par UV et deux granulés non réticulé par groupe d’expériences: UV-réticulé-1 pellets pour la bibliothèque eCLIP (UV-1); UV-crosslinked-2 pastilles pour bibliothèque eCLIP (UV-2); non réticulé-1 pellets pour la bibliothèque eCLIP comme un contrôle (non-UV); non réticulé-2 pastilles pour IgG IP pour démontrer la spécificité des anticorps.
      Remarque: le contrôle idéal pour la bibliothèque eCLIP des testicules à rayons UV-crosslinked est celui des testicules à élimination croisée UV-réticulé des souris de la même litière.
  2. Continuez à lyser les échantillons sur la glace pendant 15 min (pour prévenir la dégradation des protéines et de l’ARN).
  3. Sonicate dans un sonicateur numérique à 10% d’amplitude pendant 5 min, à 30 s on/30 s off. Toujours placer l’échantillon sur la glace et nettoyer la sonde avec de l’eau exempte de nucléases entre chaque échantillon.
  4. Ajouter 4 μL de DNase dans chaque tube et bien mélanger. Incuber pendant 10 min à 37 ° c, en secouant à 1 200 tr/min.
  5. Ajouter 10 μL de RNase I diluée (4 U/μL de RNase I dans le PBS) et bien mélanger. Incuber pendant 5 min à 37 ° c, en secouant à 1 200 tr/min.
  6. Dégager le lysat par centrifugation à 15 000 x g pendant 20 min (à 4 ° c).
  7. Recueillir soigneusement le surnageant. Laisser 50 μL de lysat et jeter le culot avec.
  8. Enregistrer les échantillons d’entrées comme RWB (Run pour Western Blot) et RRI (exécuter pour l’isolement d’ARN). Economisez 20 μL (2%) d’échantillons UV-1, UV-2, non-UV et IgG comme intrants pour le chargement de gel RWB. Economisez 20 μL (2%) d’échantillons UV-1 ou UV-2 comme entrées pour le chargement de gel RRI.

4. immunopréprécipitation

  1. Ajouter 1 mL du lysat (de l’étape 3,7) aux billes (préparées dans la section 2) et faire pivoter les échantillons à 4 ° c pendant 2 h ou pendant la nuit.
  2. Recueillir les perles avec un support magnétique et jeter le surnageant. Lavez les billes deux fois avec 900 μL de tampon de sel élevé (50 mM Tris-HCl, pH 7,5; 1 M NaCl; 1 mM EDTA; 1% NP-40; 0,1% SDS; 0,5% désoxycholate de sodium), puis laver les billes deux fois avec 900 μL de tampon de lavage (20 mM Tris-HCl, pH 7,5; 10 mM MgCl2; 0,2% Tween-20).
    Remarque: Pour l’échantillon IgG, mettre en pause la procédure ici et stocker sur la glace dans le tampon de lavage.
  3. Laver les billes une fois avec 500 μL de tampon de déphosphorylation 1x (Tris-HCl 10 mM, pH 7,5; 5 mM MgCl2; 100 mm kcl; 0,02% Triton X-100).

5. déphosphorylation de l’ARN 3 'extrémités

  1. Recueillir les perles avec un support magnétique et jeter le surnageant. Retirer le liquide résiduel à l’aide de pointes de pipette fines. Ajouter 100 μL de mélange maître de déphosphorylation (10 μL de tampon de déphosphorylation 10x [100 mM Tris-HCl, pH 8,0; 50 mM MgCl2; 1 M kcl; 0,2% Triton X-100; 1 mg/ml d’albumine sérique bovine (BSA)]; 78 μL d’eau exempte de nucléases; 2 μl d’inhibiteur de RNase; 2 μl de DNase; 8 μl d’Al de la phosphatase de kaline) à chaque échantillon, et incuber pendant 15 min à 37 ° c, en secouant à 1 200 tr/min.
  2. Ajouter 300 μL de mélange principal de polynucléotide kinase (PNK) (60 μL de tampon 5x PNK pH 6,5 [350 mM Tris-HCl, pH 6,5; 50 mM MgCl2]; 223 μL d’eau exempte de nucléases; 5 μl d’inhibiteur de RNase; 2 μl de DNase; 7 μL d’enzyme PNK; 3 μl de 0,1 M de dithiothreitol) à chaque échantillon , incuber pendant 20 min à 37 ° c, en secouant à 1 200 tr/min.
  3. Recueillir les perles avec un support magnétique et jeter le surnageant. Laver les perles une fois avec 500 μL de tampon de lavage à froid. Laver ensuite les perles une fois avec 500 μL de tampon de sel froid élevé. Répétez ces lavages une fois de plus dans cet ordre.
  4. Laver les perles une fois avec 500 μL de tampon de lavage à froid, puis deux fois avec 300 μL de tampon de ligature 1x froid (pas de dithiothreitol, 50 mM Tris-HCl, pH 7,5; 10 mM MgCl2).

6. ligature de l’adaptateur d’ARN à l’ARN 3 'extrémités

  1. Jetez le surnageant et enlevez le liquide résiduel avec des pointes de pipette fines. Ajouter 25 μL de mélange principal de ligature de 3 'à chaque échantillon. Mélanger soigneusement par pipetage. Cette étape est sujette à produire des bulles.
    Remarque: Le mélange principal de ligature contient 3 μL de tampon de LIGATURE 10x [500 mM Tris-HCl, pH 7,5; 100 mM MgCl2]; 9 μL d’eau exempte de nucléases; 0,4 μL d’inhibiteur de RNase; 0,3 μL de 0,1 M ATP; 0,8 μL de diméthyl sulfoxyde (DMSO); 9 μL de 50% de polyéthylène glycol (PEG) 8000; 2,5 μL de la ligase de l’ARN [30 U/μL].
  2. Ajouter 2,5 μL d’adaptateur d’ARN (tableau 1) et 2,5 μl d’adaptateur d’ARN X1B (tableau 1) à chaque échantillon. Mélanger soigneusement en pipetant ou en feuillant, et incuber pendant 75 min à 25 ° c, en feuillant pour mélanger toutes les 10 min.
  3. Laver les perles une fois avec 500 μL de tampon de lavage à froid (reprendre l’échantillon d’IgG ici).
  4. Laver les perles une fois avec 500 μL de tampon de sel froid élevé, puis avec 500 μL de tampon de lavage à froid. Répétez ces lavages une fois de plus.
  5. Séparer magnétiquement les billes et retirer le liquide résiduel avec des pointes de pipette fines.
  6. Resuspendre les billes dans 100 μL de tampon de lavage à froid (mettre en pause l’échantillon d’IgG et le conserver sur la glace dans le tampon de lavage). Déplacez 20 μL dans de nouveaux tubes en tant qu’échantillons RWB. Séparer magnétiquement les 80 μL restants en tant qu’échantillons RRI. Retirez le surnageant des échantillons RRI et resuspendez les billes dans 20 μL de tampon de lavage.
  7. Ajouter 37,5 μL de tampon d’échantillon de 4x de lithium dodécyl sulfate (LDS) et 15 μL d’agent réducteur d’échantillon 10x à l’échantillon d’IgG. Ajouter 7,5 μL de tampon d’échantillon de 4x LDS et 3 μL d’agent réducteur d’échantillon 10x aux échantillons (restants). (Ne pas mélanger par pipetage). Incuber pendant 10 min à 70 ° c, en secouant à 1 200 tr/min. Refroidir sur glace pendant 1 min et centrifuger à 1 000 x g pendant 1 min à 4 ° c.

7. SDS-PAGE et transfert de membrane

  1. Chargez les gels.
    1. Pour le gel RRI (4-12% de gel de protéine bis-tris, 10 puits, 1,5 mm), placer les tubes sur un aimant et séparer les protéines de l’éluat des billes. Chargez 30 μL d’échantillon par puits. Les échantillons sont espacés par marqueur de taille de protéine pré-teinté.
    2. Pour le gel RWB (4-12% de gel de protéine bis-tris, 10 puits, 1,5 mm), placer les tubes sur un aimant et séparer les protéines de l’éluat des billes. Chargez 15 μL d’échantillon par puits. Sauvegardez les échantillons restants à-20 ° c en tant que sauvegardes.
  2. Ajouter 500 μL d’antioxydant à 500 mL de 1 tampon de fonctionnement SDS. Exécuter à 200 V dans 1x SDS tampon de fonctionnement pour 50 min ou jusqu’à ce que le colorant avant est au fond.
    Remarque: Antioxydant contient N, N-diméthylformamide, bisulfite de sodium, qui migre avec des protéines réduites pour prévenir la réoxydation des acides aminés sensibles tels que la méthionine et le tryptophane.
  3. Transférer des complexes d’ARN-protéine du gel à une membrane de nitrocellulose à 10 V pour 70 min dans un tampon 1xtransfer avec 10% de méthanol (vol/vol). Rincez la membrane RRI dans du PBS froid, enveloppez-la dans une pellicule plastique et rangez-la à-80 ° c.
  4. Bloquer la membrane RWB dans 5% de lait en TBST à température ambiante pendant 1 h. Rincer la membrane en TBST. Incuber avec l’anticorps primaire dans la TBST à 4 ° c pendant la nuit. Laver deux fois avec la TBST pendant 5 min. Incuber avec l’anticorps secondaire (1:5000 HRP chèvre anti-lapin IgG) dans la TBST à la température ambiante pendant 1 h. laver trois fois avec TBST pendant 5 min, 10 min et 15 min, respectivement.
  5. Mélanger les volumes égaux de l’électrochimiluminescence (ECL) tampon A et tampon B, ajouter à la membrane et incuber pendant 1 min. recouvrir la membrane d’une pellicule de plastique et l’exposer à un film à rayons X à température ambiante pendant 2-3 min. Ensuite, développez le film.
    Remarque: Le film avec surexposition montrera clairement la forme des bords de la membrane, par lequel le film peut être aligné de nouveau à la membrane RWB. Alignez ensuite les membranes RWB et RRI en fonction des positions des marqueurs qui s’y trouvent. Les couches dans l’ordre de bas en haut sont le film, la membrane RWB et la membrane RRI dans l’ordre.

8. isolement de l’ARN

  1. Coupez la région de la bande protéique à 75 kDa (environ 220 NT d’ARN) au-dessus, en utilisant la membrane RWB et le film comme guides.
    Remarque: Comme une molécule d’ARN protégée par des protéines peut avoir une longueur maximale de 225 bases, avec environ 340 da par base, il est raisonnable de couper la région environ 75 kDa au-dessus de la bande RBP pour récupérer tous les complexes d’ARN-protéine.
  2. Coupez le morceau de membrane excisée en plusieurs petites tranches, et placez-les dans un tube de centrifugation de 1,5 mL frais. Ajouter 200 μL de tampon protéinase K (PK) (100 mM Tris-HCl pH 7,5; 50 mM NaCl; 10 mM EDTA) avec 40 μL de PK sur les morceaux de membrane. Mélanger et incuber 20 min à 37 ° c, en secouant à 1 200 tr/min.
  3. Ajouter 200 μL de tampon d’urée PK (100 mM Tris-HCl pH 7,4; 50 mM NaCl; 10 mM EDTA; 7 M d’urée) à chaque échantillon. Incuber pendant 20 min à 37 ° c, en secouant à 1 200 tr/min.
  4. Ajouter 400 μL d’acide phénol/chloroforme/Isoamyl alcool (25:24:1), bien mélanger et incuber pendant 5 min à 37 ° c, en secouant à 1 200 RPM.
  5. Placer le tube lourd de gel de phase de 2 mL (PLG) dans la centrifugeuse et tourner à 15 000 x g pendant 25 s.
  6. Transférer tout le contenu à l’exception des tranches de membrane en tube lourd PLG. Incuber pendant 5 min à 37 ° c, en secouant à 1 200 tr/min.
  7. Tourner à température ambiante et 15 000 x g pendant 15 min. transférer la couche aqueuse dans un nouveau tube conique de 15 ml.
  8. Utilisez des colonnes de purification et de concentration d’ARN pour extraire l’ARN.
    1. Ajouter 2 volumes (800 μL) de tampon de liaison ARN à chaque échantillon (à partir de l’étape 8,7) et mélanger. Ajouter un volume égal (1200 μL) de 100% d’éthanol et mélanger.
    2. Transférer 750 μL d’échantillon (de l’étape 8.8.1) aux colonnes de purification et de concentration d’ARN dans un tube collecteur et centrifuger à 15 000 x g pendant 30 s. jeter l’écoulement.
    3. Répétez l’étape 8.8.2 jusqu’à ce que tous les échantillons soient passés dans la colonne. Ajouter 400 μL de tampon de préparation de l’ARN à la colonne et centrifuger à 15 000 x g pendant 30 s. jeter l’écoulement, appliquer 700 μl de tampon de lavage d’ARN et centrifuger la colonne à 15 000 x g pendant 30 s. jeter l’écoulement.
    4. Ajouter 400 μL de tampon de lavage d’ARN à la colonne et centrifuger à 15 000 x g pendant 2 min. transférer la colonne avec précaution dans un nouveau tube de 1,5 ml. Ajouter 10 μL d’eau exempte de nucléases dans la matrice de colonne, laisser reposer pendant 2 min et centrifuger à 15 000 x g pendant 30 s. conserver les échantillons eclip à-80 ° c jusqu’à RT (étape 11,1).

9. déphosphorylation de l’ARN d’entrée 3 'extrémités

  1. Ajouter 15 μL de mélange maître de déphosphorylation (2,5 μL de tampon de déphosphorylation 10x [100 mM Tris-HCl, pH 8,0; 50 mM MgCl2; 1 M kcl; 0,2% Triton X-100; 1 mg/ml BSA]; 9,5 μl d’eau exempte de nucléases; 0,5 μl d’inhibiteur de rnase; 2,5 μl de phosphatase alcaline) à 10 μl de échantillons d’entrée (à partir de l’étape 8.8.4). Incuber pendant 15 min à 37 ° c, en secouant à 1 200 tr/min.
  2. Ajouter 75 μL de mélange massique PNK (20 μL de tampon 5x PNK PH 6,5 [350 mM Tris-HCl, pH 6,5; 50 mM MgCl2]; 44 μL d’eau exempte de nucléases; 1 μl d’inhibiteur de RNase; 2 μl de DNase; 7 μL d’enzyme PNK; 1 μl de 0,1 M de dithiothreitol). Incuber pendant 20 min à 37 ° c, en secouant à 1 200 tr/min.
  3. Nettoyage de l’ARN d’entrée
    1. Resuspendre les acides thenucléiques extraction de la perle magnétique du flacon (Vortex pendant plus de 30 s). Ajouter 20 μL d’acides nucléiques extraction de billes magnétiques pour chaque échantillon de nouveaux tubes. Recueillir les perles avec un support magnétique et jeter le surnageant.
    2. Laver les billes une fois avec 1 mL de tampon de lyse de purification de l’ARN (tampon RLT). Placez le tube sur un aimant pendant 30 s et jetez le surnageant.
      Remarque: La séparation subséquente des acides nucléiques extraction des billes magnétiques a suivi cette étape.
    3. Resuspendre les billes avec 300 μL de tampon RLT et les ajouter à l’échantillon. Ajouter 10 μL de NaCl 5 M et 615 μL de 100% d’alcool éthylique (EtOH) et mélanger par pipetage. Faire pivoter à température ambiante pendant 15 min. séparer magnétiquement les billes et enlever le surnageant.
    4. Resuspendre les billes dans 1 mL de 75% EtOH et les transférer dans un nouveau tube. Après 30 s, recueillir les perles avec un support magnétique et jeter le surnageant. Laver deux fois avec 75% EtOH, séparer magnétiquement les billes et jeter le liquide résiduel avec des pointes de pipette fines. Sécher à l’air pendant 5 min (éviter un séchage excessif).
    5. Résuspendez les billes avec 10 μL d’eau exempte de nucléases et incubez-les pendant 5 min. des billes magnétiquement séparées et déplacez 5 μL de surnageant dans un nouveau tube (pour la ligature de l’adaptateur 3 'ci-dessous). Le reste de l’ARN peut être stocké à-80 ° c en tant que sauvegardes.

10. ligature de l’adaptateur d’ARN à l’ARN d’entrée 3 'extrémités

  1. Ajouter 1,5 μL de DMSO et 0,5 μL d’adaptateur RiL19 (tableau 1) à 5 ΜL d’ARN d’entrée (à partir de l’étape 9.3.5), incuber pendant 2 min à 65 ° c et placer sur la glace pendant plus de 1 min. Ajouter 13,5 μl de mélange maître de ligature 3 'à chaque échantillon , mélanger par pipetage, et incuber pour 75 min à 25 ° c, avec un battement à mélanger toutes les 15 min.
    Remarque: Le mélange principal de ligature contient 2 μL de tampon de LIGATURE 10x [500 mM Tris-HCl, pH 7,5; 100 mM MgCl2; 10 mm dithiothreitol]; 1,5 μL d’eau exempte de nucléases; 0,2 μL d’inhibiteur de RNase; 0,2 μL de 0,1 M ATP; 0,3 μL de DMSO; 8 μL de 50% PEG8000; 1,3 μL de la ligase de l’ARN [30 U/μL].
  2. Nettoyage de l’ARN d’entrée ligné
    1. Séparer magnétiquement 20 μL d’acides nucléiques extraction de billes magnétiques pour chaque échantillon, et enlever le surnageant. Laver les billes une fois avec 1 mL de tampon RLT.
    2. Resuspendre les billes dans 61,6 μL de tampon RLT et la suspension de transfert à chaque échantillon. Ajouter 61,6 μL de 100% EtOH. Utiliser une pipette pour mélanger pendant 15 min toutes les 5 min. des perles magnétiquement séparées, et enlever le surnageant.
    3. Répétez l’étape 9.3.4.
    4. Resuspendre les billes avec 10 μL d’eau exempte de nucléases et laisser reposer pendant 5 min. séparer magnétiquement les billes et transférer 10 μL du surnageant dans un nouveau tube.
      Remarque: Il s’agit d’un point d’arrêt possible (les échantillons d’entrée peuvent être stockés à-80 ° c jusqu’au lendemain).

11. transcription inversée, ligature d’adaptateur d’ADN à l’ADNc 3 'extrémités

  1. Ajouter 0,5 μL d’apprêt RT (tableau 1) à 10 ΜL d’ARN d’entrée (de l’étape 10.2.4) et 10 ΜL d’ARN clip (à partir de l’étape 8.8.4) respectivement, incuber pendant 2 min dans un bloc PCR préchauffé à 65 ° c, placer sur la glace pendant plus de 1 min.
  2. Ajouter 10 μL de mélange maître RT (2 μL de tampon RT [500 mM Tris-HCl, pH 8,3; 750 mM KCl; 30 mM MgCl2]; 4 μl d’eau exempte de nucléases; 0,3 μL d’inhibiteur de RNase; 2 μl de 0,1 m de dithiothreitol; 0,2 μl de 0,1 m dATP; 0,2 μl de 0,1 m dCTP; 0,2 μl de 0,1 M dGTP; 0,2 μL de 0,1 M dTTP; 0,9 μL de transcriptase inverse) à chaque échantillon, mélanger, incuber à 55 ° c pendant 45 min sur un bloc PCR préchauffé.
  3. Mélanger 20 μL de produit de réaction RT avec 3,5 μL de réactif de nettoyage du produit PCR. Incuber pendant 15 min à 37 ° c.
  4. Ajouter 1 μL de 0,5 M d’EDTA, mélanger par pipetage. Ajouter 3 μL de NaOH 1 M, mélanger par pipetage et incuber pendant 12 min à 70 ° c sur un bloc PCR pour hydrolyser l’ARN du gabarit.
  5. Ajouter 3 μL de HCl 1 M, mélanger la pipette pour neutraliser le tampon.
  6. Nettoyage de l’ADNc
    1. Séparer magnétiquement 10 μL de billes magnétiques d’extraction d’acide nucléique pour chaque échantillon, enlever le surnageant. Laver une fois avec 500 μL de tampon RLT.
    2. Resuspendre les billes dans 93 μL de tampon RLT et la suspension de transfert à l’échantillon. Ajouter 111,6 μL de 100% EtOH, incuber pendant 5 min et mélanger les pipettes toutes les 2 min. recueillir les perles avec un support magnétique et jeter le surnageant. Resuspendre les billes avec 1 mL de 80% EtOH et passer à un nouveau tube.
    3. Après 30 s, recueillir les perles avec un support magnétique et jeter le surnageant. Laver deux fois avec 80% EtOH. Séparer magnétiquement et jeter le liquide résiduel avec pointe fine. Sécher à l’air pendant 5 min (éviter un séchage excessif). Resuspendre les billes dans 5 μL de Tris-HCl 5 mM et incuber pendant 5 min.
  7. Ajouter 0,8 μL d’adaptateur d’ADN (tableau 1) et 1 ΜL de DMSO aux billes, incuber pendant 2 min à 75 ° c. Placer sur la glace pendant plus de 1 min.
  8. Préparer 12,8 μL de mélange principal de ligature (2 μL de tampon de LIGATURE 10x [500 mM Tris-HCl; 100 mM MgCl2; 10 mm dithiothreitol]; 1,1 μl d’eau exempte de nucléases; 0,2 μl de 0,1 M d’ATP; 9 μL de 50% PEG8000; 0,5 ΜL d’ARN ligase [30 U/μl]) , feuilleter pour mélanger, tourner brièvement dans une centrifugeuse, et l’ajouter à chaque échantillon, remuer l’échantillon avec la pointe de la pipette lentement.
  9. Ajouter un autre 1 μL de ligase d’ARN [30 U/μL] à chaque échantillon et feuilleter pour mélanger. Incuber pendant 30 s à 25 ° c, en secouant à 1 200 tr/min. Incuber à 25 ° c pendant la nuit. Feuilleter pour mélanger légèrement 5 à 6 fois, une fois par heure.
  10. Nettoyage de l’ADNc ligné
    1. Séparer magnétiquement 5 μL d’acides nucléiques extraction de billes magnétiques pour chaque échantillon, et enlever le surnageant.
    2. Laver une fois avec 500 μL de tampon RLT.
    3. Resuspendre les billes dans 60 μL de tampon RLT pour les billes et transférer la suspension à chaque échantillon. Ajouter 60 μL de 100% EtOH, incuber pendant 5 min et mélanger les pipettes toutes les 2 min. séparer magnétiquement, jeter le surnageant.
    4. Répétez l’étape 9.3.4.
    5. Resuspendre les billes avec 27 μL de Tris-HCl 10 mM, incuber pendant 5 min. séparer magnétiquement, et déplacer 25 μL d’échantillon dans un nouveau tube. Diluer les 1 μL d’ADNc ligné avec 9 μL d’eau exempte de nucléases dans un nouveau tube. Conserver les échantillons restants à-20 ° c jusqu’à l’étape 13,1.

12. quantification de l’ADNc par PCR quantitative en temps réel (qPCR)

  1. Ajouter 9 μL de mélange principal de qPCR (5 μL de mélange maître 2x; 3,6 μL d’eau exempte de nucléases; 0,4 μL de mélange d’apprêt [10 μM PCR-F-D50X et 10 μM PCR-R-D70X]) à une plaque qPCR de 96 puits. Ajouter 1 μL de 1:10 dilué (en H2O) cDNA (à partir de l’étape 11.10.5), sceller et mélanger.
  2. Exécuter le programme qPCR dans un thermocycleur: 2 min à 50 ° c; 2 min à 95 ° c; 3 s à 95 ° c suivis de 30 s à 68 ° c pour 40 cycles; 15 s à 95 ° c, suivis de 60 s à 68 ° c suivis de 15 s à 95 ° c pendant 1 cycle. Note CT (seuil de cycle) valeur.

13. amplification PCR de l’ADNc

  1. Distribuer 35 μL de mélange massique de PCR (25 μL de mélange maître 2x PCR; 5 μL d’eau exempte de nucléases; 5 μL de mélange d’apprêt [20 μM PCR-F-D50X et 20 μM PCR-R-D70X]) en bandelettes de 8 puits. Pour le groupe CLIP, ajouter 12,5 μL d’échantillon de CLIP + 2,5 μL de H2O; pour le groupe d’entrées, ajouter 10 μL d’entrées + 5 μL de H2O. bien mélanger et tourner brièvement dans la centrifugeuse.
  2. Exécuter le programme de PCR: 30 s à 98 ° c; 15 s à 98 ° c suivis de 30 s à 68 ° c suivis de 40 s à 72 ° c pendant 6 cycles; 15 s à 98 ° c suivis de 60 s à 72 ° c pour N cycles = (valeurs CT qPCR-3)-6; 60 s à 72 ° c; 4 ° c en attente.
    Remarque: Il est préférable d’effectuer 1 à 2 cycles de PCR supplémentaires pour le premier couple de CLIPs.

14. purification de gel

  1. Chargez des échantillons sur un gel d’d’agarose à haute résolution de 3%. Laisser 1 puits vide entre les échantillons et utiliser une échelle des deux côtés du gel. Exécuter à 100 V pour 75 min dans 1x tampon Tris-borate-EDTA (TBE).
  2. Sous l’éclairage bleu, coupez les tranches de gel 175-350 BP à l’aide de lames de rasoir fraîches pour chaque échantillon. Placez-les dans 15 mL de tubes coniques.
    1. Peser la tranche de gel, et éluer le gel à l’aide d’un kit d’extraction de gel.
    2. Ajoutez 6x volumes de tampon de dissolution de gel pour faire fondre le gel (100 mg de gel = 600 μL de tampon de dissolution de gel). Dissoudre le gel à température ambiante. (Agiter pour mélanger toutes les 15 min jusqu’à ce que la tranche de gel soit complètement dissoute). Ajouter 1 volume de gel de 100% d’isopropanol et bien mélanger.
    3. Transférer 750 μL d’échantillon (de l’étape 14.2.2) à la colonne dans un tube collecteur et centrifuger à 17 900 x g pendant 1 min. jeter l’écoulement.
    4. Répétez l’étape 14.2.3 jusqu’à ce que tous les échantillons aient traversé la colonne, lavez une fois avec 500 μL de tampon de dissolution de gel.
    5. Ajouter 750 μL de tampon de lavage (du kit d’extraction de gel) à la colonne et centrifuger à 17 900 x g pendant 1 min. jeter le flux à travers, tourner à 17 900 x g pendant 2 min. Placer la colonne dans un nouveau tube de 1,5 ml.
    6. Retirez tous les tampons de lavage restants du rebord en plastique violet de la colonne. Sécher à l’air pendant 2 min. Ajouter 12,5 μL d’eau exempte de nucléases au centre de la membrane. Laisser la colonne reposer pendant 2 min à température ambiante, et tourner à 17 900 x g pendant 1 min (pour un rendement amélioré, répéter l’étape d’élution).

15. TOPO clone du produit PCR

  1. Préparer le mélange de réaction de clonage TOPO (1 μL de produit PCR à partir de l’étape 14.2.6; 1 μL de mélange de clonage; 3 μL d’eau stérile). Mélanger doucement et incuber pendant 5 min à 20-37 ° c. Cool sur la glace.
  2. Décongeler les bactéries E. coli chimiquement compétentes sur la glace. Ajouter 5 μL du produit de clonage TOPO à 100 μL de bactéries compétentes29. Mélangez doucement bien. Incuber sur la glace pendant 30 min.
  3. Choc thermique pour 60 s à 42 ° c. Ensuite, refroidir sur la glace pendant 2 min. Ajouter 900 μL de bouillon de lysogenèse (LB), incuber à 37 ° c pendant 1 h, en secouant à 225 RPM. Tourner à 1 000 x g pendant 1 min, puis retirer 900 μl de surnageant. Resuspendre le reste de la solution.
  4. Planez les bactéries transformées sur des plaques d’agar 1,5% LB contenant de l’ampicilline (100 μg/mL) et incubez pendant la nuit à 37 ° c.
  5. Préparer au moins 20 1,5 mL de tubes à centrifuger pour chaque construction. Remplir un ensemble avec 500 μL de milieu LB contenant 100 μg/mL d’ampicilline. Utiliser un embout de pipette stérile pour gratter une colonie bactérienne aléatoirement et mélanger (par pipetage) avec 500 μL de milieu LB. Incuber à 37 ° c pendant 5 h, en secouant à 225 tr/min.
  6. Séquencer le fragment d’insert à l’aide de l’amorce inversée de la base: CAGGAAACAGCTATGAC par Sanger séquençage30.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

La procédure et les résultats de l’eclip sont illustrés à la figure 1, figure 2, figure 3, figure 4. Les souris ont été euthanasiées avec du dioxyde de carbone et une petite incision a été faite dans le bas-ventre à l’aide de ciseaux chirurgicaux (figure 2a,B). Les testicules de souris ont été enlevés, déconnectés puis réticulés par les rayons UV après broyage (Figure 2c-I). Les résultats eCLIP représentatifs de l’utilisation de deux hélicases de liaison à l’ARN connues dans les tissus des testicules sont représentés dans les figures 3 et 4. Nous avons effectué MOV10 eCLIP dans des testicules de souris adultes de type sauvage, avec une concentration commune de 40 U/mL de RNase I traitant le lysat réticulé. Le panneau supérieur de la figure 3A montre que la protéine cible de taille environ 114 kDa a été enrichie avec succès. La tache occidentale des protéines MOV10L1 immunopprécipités a été réalisée avec deux concentrations (5 ou 40 U/mL) de RNase I pendant le processus eCLIP (figure 3A). La figure 3b montre qPCR à l’aide de 1:10 cDNA dilué (déjà ligné avec un adaptateur d’ADN) à partir de MOV10 et MOV10L1 UV-réticulé, non réticulé, et l’échantillon apparié de la taille appariée d’entrée (SMInput). Les échantillons non réticulé montrent une diminution de la récupération de l’ARN. Nous avons observé que les valeurs CT du groupe non réticulé étaient généralement 5 fois plus que celles du groupe réticulé par les rayons UV. La figure 4a affiche l’amplification PCR et la sélection de la taille via l’électrophorèse sur gel d’d’agarose (Cut 175-350 BP). Primer-dimer produit apparaît à environ 140 BP. figure 4b montre le navigateur du génome UCSC vue de deux séquences de sous-clones représentatifs. Les balises eCLIP MOV10-Bound se trouvent dans le 3 'UTR du gène FTO; Le taux approximatif de 3 'UTR cibles représente 75% (figure 4C), ce qui correspond à la majorité des cibles MOV10 dans les cellules HEK29310 et dans les testicules (données non affichées). En revanche, les balises eCLIP MOV10L1-Bound se trouvent dans un cluster piRNA indiquant que MOV10L1 cible des précurseurs de piRNA. Le taux approximatif de cibles de précurseurs de piRNA représente 42% (figure 4e), ce qui reflète une tendance de notre précédente expérience classique de clip20. MOV10L1 eCLIP avec 40 U/mL de digestion RNase I donne relativement plus de séquences avec moins de 20 BP (figure 4D).

Figure 1
Figure 1 : Représentation schématique de eCLIP. Les tubules séminifères de souris réticulé par UV (étape 1) sont lysés dans le tampon de lyse eclip et soniqué (étape 2). Le lysat est traité avec la RNase I pour fragmenter l’ARN, après quoi les complexes d’ARN-protéine sont immunopprécipités à l’aide de l’anticorps anti-RBP (étape 3-4). La déphosphorylation des fragments d’ARN et la ligature de l’adaptateur d’ARN 3 ′ sont effectuées (étape 5-6). Les complexes de protéine-ARN sont exécutés sur un gel SDS-PAGE et transférés aux membranes de nitrocellulose (étape 7). L’ARN est récupéré de la membrane par digestion de la protéine avec la protéinase K et l’urée qui laisse un court polypeptide restant au site de Crosslink. La déphosphorylation des fragments d’ARN des échantillons d’entrée et la ligature de l’adaptateur d’ARN 3 ′ est effectuée (étape 8). Effectuer RT d’ARN et ligature de 3 ′ adaptateur d’ADN (étape 9-10). Effectuez l’amplification PCR de la bibliothèque cDNA, l’extraction de gel et le clonage de PCR à extrémité arrondie pour le contrôle de qualité préliminaire de la bibliothèque (étape 11). Enfin, effectuez un séquençage à haut débit (étape 12). S’il vous plaît cliquez ici pour voir une version plus grande de ce chiffre.

Figure 2
La figure 2 : Récolte des tissus testis et réticulation UV. (A) l’exposition de l’abdomen de la souris. Bune incision de 0,5 cm dans la paroi abdominale exposant le péritoine. (C) une paire de testicules est enlevée en tirant les tampons adipeux. (D) le tissu testiculaire est enlevé et placé dans un petit plat contenant du PBS glacé à froid. (E) Retirer délicatement le Tunica albuginea. (F) Appuyez sur le pilon lâche pour triturer le tissu dans un broyeur de tissu dounce. G) des tubules séminifères distribués dans une assiette de 10 cm. (H) réticulation UV avec 400 MJ/cm2 d’énergie. (I) les échantillons réticulé sont prélevés dans des tubes à centrifugation de 1,5 ml. S’il vous plaît cliquez ici pour voir une version plus grande de ce chiffre.

Figure 3
Figure 3 : Résultats représentatifs de MOV10 et MOV10L1 eCLIP. A) lavalidation de l’ouest des MOV10 et MOV10L1 immunoprécipités. (B) qpcr sur 1:10 les bibliothèques eclip diluées de MOV10 et MOV10L1, avec des répliques pour les échantillons UV, non-UV et SMInput appariés. S’il vous plaît cliquez ici pour voir une version plus grande de ce chiffre.

Figure 4
Figure 4 : préparation de la bibliothèque eclip et évaluation de la qualité. (A) les images en gel de l’amplification PCR sont affichées. L’astérisque indique le dimère d’amorce. La ligne pointillée rouge indique les régions excisées pour le produit PCR de l’ADNc, quelque part entre 175 et 350 BP. (B) vue du navigateur du génome UCSC de deux séquences de sous-clones représentatifs31. (C) analyse de séquençage des sous-clones à petite échelle de MOV10. (D) les balises MOV10L1-Bound affichent des schémas distincts de distribution de la longueur lorsqu’ils sont traités par deux concentrations différentes de RNase. E) analyse du séquençage des sous-clones à petite échelle de MOV10L1. S’il vous plaît cliquez ici pour voir une version plus grande de ce chiffre.

Nom de la séquence Informations sur la séquence description
Adaptateurs d’ARN
ARN /5Phos/auauaggnnnnnagaucggaagagcgucguguag/3spc3/ stock à 200 μM; fonctionnant à 20 μM
ARN X1B /5Phos/aauagcannnnnagaucggaagagcgucguguag/3spc3/ stock à 200 μM; fonctionnant à 20 μM
RiL19 /5Phos/agaucggaagagcgucgug/3spc3/ stock à 200 μM; fonctionnant à 40 μM
Adaptateur ADN
Rand103tr3 /5Phos/NNNNNNNNNNAGATCGGAAGAGCACACGTCTG/3SpC3/ stock à 200 μM; fonctionnant à 80 μM
Apprêt RT
AR17 Les ACACGACGCTCTTCCGA stock à 200 μM; fonctionnant à 20 μM
Amorces PCR

PCR-F-D 501
AATGATACGGCGACCACCGAGATCTACACTATAGCCTACACTCTTTCCCTACACGACGCTCTTCCGATCT stock à 100 μM; fonctionnant à 20 μM
PCR-R-D 701 CAAGCAGAAGACGGDGAGATCGAGTAATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC stock à 100 μM; fonctionnant à 20 μM
(Voir la lettre du service à la clientèle d’Illumina pour D502-508, D702-712)

Tableau 1: séquences d’adaptateurs et d’amorces. L’adaptateur contient un Random-mer en ligne (soit n5 ou n10) pour déterminer si deux lectures séquencées identiques indiquent deux fragments d’ARN uniques ou des doublons de PCR du même fragment d’ARN. "5 Phos" signifie phosphorylation 5 ', ce qui est nécessaire si un oligo est utilisé comme substrat pour l’ADN/ARN ligase. "3SpC3" est synonyme d’entretoise 3 'C3, ce qui peut empêcher la ligature entre les adaptateurs.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Avec une meilleure compréhension du rôle universel des RPB dans les contextes biologiques et pathologiques, les méthodes d’agrafe ont été largement utilisées pour révéler la fonction moléculaire du rbps20,32,33, 34,35. Le protocole décrit ici représente une application adaptée de la méthode eCLIP à la souris testis.

Un défi dans l’exécution de eCLIP dans les testicules est de maintenir la viabilité et l’intégrité des cellules testiculaires fraîches, ce qui est également important pour la réticulation efficace. Le cisaillement du testicule avec une force mécanique légère à l’aide du pilon lâche peut empêcher la lyse cellulaire32,36. Une bonne digestion de l’ARN est également essentielle pour les tests eCLIP réussis. Les fragments d’ARN pourraient être plus convergents après la digestion, mais la longueur inférieure à 20 BP peut être enlevée par le pré-traitement des lectures de la bibliothèque. Afin d’adopter un dosage de RNase idéal pour un candidat de RBP, nous suggérons un test préliminaire basé sur les résultats du séquençage de sous-clone des bibliothèques eCLIP qui peuvent être préparés par le traitement de RNase avec des concentrations allant de 0 vous à 40 U (par millilitre de lysat). L’analyse de séquençage des sous-clones à petite échelle est une étape recommandée pour un examen fiable de la qualité de la bibliothèque dans notre méthode eCLIP. Premièrement, le pourcentage d’inserts inférieurs à 20 PB ne devrait pas être trop élevé, ou, le prétraitement ultérieur de la bibliothèque eCLIP provoquera une perte coûteuse de lectures. Deuxièmement, l’efficacité de la ligature correcte des deux adaptateurs doit être vérifiée. Les échantillons de sous-norme peuvent être éliminés sans séquençage profond pour assurer un séquençage profond réussi, dont les résultats prennent généralement beaucoup plus de temps à analyser.

Bien que la faisabilité de eCLIP dans les testicules de souris est encore limitée par la spécificité de l’anticorps pour l’étape de l’immunopreprécipitation, eCLIP est avantageux par rapport aux méthodes conventionnelles de CLIP dans plusieurs aspects. Premièrement, il s’agit d’une méthode non radioactive. Par eCLIP, les cibles d’ARN des RPB sont directement capturées in vivo sans avoir à recourir à des techniques à forte intensité de main-d’œuvre utilisant des matières radioactives. Deuxièmement, la méthode est moins intensive en temps. L’ensemble de la procédure ne prend que 4 jours à travers la préparation de la bibliothèque eCLIP. Troisièmement, la diversité des séquences. Comparé au cycle d’amplification unifié conventionnel de 25-35 cycles, eclip fait référence aux valeurs CT de qPCR pour définir le nombre de cycles de PCR spécifiquement. Enfin, il fournit un rapport signal/bruit plus fort. L’entrée de taille assortie sert d’arrière-plan approprié pour les cibles authentiques.

En résumé, nos résultats eCLIP consolident les conclusions que MOV10 et MOV10L1 ont une préférence contraignante pour les précurseurs de mRNA 3 'UTR et piRNA, respectivement. Le protocole que nous avons décrit ici représente le premier emploi de la méthode eCLIP dans la reproduction, un domaine dans lequel la connaissance de l’interaction ARN-RBP est assez insuffisante, bien que les études génétiques aient fourni des informations suffisantes sur les rôles biologiques des Les RPB. la visualisation de ce protocole eCLIP peut aider à guider ses applications répandues dans des domaines plus larges.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Les auteurs n’ont rien à divulguer.

Acknowledgments

Nous remercions Eric L Van Nostrand et Gene W Yeo pour les conseils utiles avec le protocole original. K.Z. a été appuyé par le programme national clé R & D de la Chine (2016YFA0500902, 2018YFC1003500), et la Fondation nationale des sciences naturelles de la Chine (31771653). L.Y. a été soutenu par la National Natural Science Foundation de la Chine (81471502, 31871503) et le programme novateur et entrepreneurial de la province de Jiangsu.

Materials

Name Company Catalog Number Comments
Antibodies
Anti-mouse MOV10  antibody Proteintech, China 10370-1-AP
Anti-mouse MOV10L1 antibody Zheng et al.20109 polyclonal antisera UP2175 provided by P. Jeremy Wang lab, University of Pennsylvania
HRP Goat Anti-Rabbit IgG  ABclonal AS014
Rabbit IgG Beyotime, China A7016
Equipment
Centrifuge Eppendorf, Hamburg, Germany 5242R
Digital sonifier BRANSON,USA BBV12081048A 450 Watts; 50/60 Hz
DynaMag-2 Magnet Invitrogen,USA 12321D
Mini Blot Module Invitrogen,USA B1000
Mini Gel Tank Invitrogen,USA A25977
Shaking incubator Eppendorf, Hamburg, Germany Thermomixer comfort 
Tissue Grinder, Dounce PYREX, USA 1234F35 only  the "loose" pestle is used in this protocol
TProfessional standard 96 Gradient Biometra, Germany serial no.: 2604323
Tube Revolver  Crystal, USA serial no.: 3406051
UV-light cross-linker UVP, USA CL-1000
Materials
TC-treated Culture Dish Corning, USA 430167 100 mm 
Tubes Corning, USA 430791 15 mL
Microtubes tubes AXYGEN , USA MCT-150-C 1.5 mL 
Reagents 
Acid phenol/chloroform/isoamyl alcohol  Solarbio, China P1011 25:24:01
AffinityScript Enzyme Agilent, USA 600107
Antioxidant Invitrogen,USA NP0005
DH5α competent bacteria Thermo Scientific, USA 18265017 these economical cells yield >1 x 106 transformants/µg control DNA per 50 µL reaction.
DMSO Sigma-Aldrich, USA D8418
DNA Ladder Invitrogen, USA 10416014
dNTP Sigma-Aldrich, USA DNTP100-1KT
Dynabeads Protein A  Invitrogen, USA 10002D
ECL reagent Vazyme, China E411-04
EDTA Invitrogen, USA AM9260G
EDTA free protease inhibitor cocktail Roche, USA 04693132001 add fresh
Exo-SAP-IT Affymetrix, USA 78201 PCR Product Cleanup Reagent 
FastAP enzyme Thermo Scientific, USA EF0652
LDS Sample Buffer Thermo Scientific, USA NP0007
MetaPhor Agarose  lonza, Switzerland 50180
MgCl2 Invitrogen, USA AM9530G
MiniElute gel Extraction QIAGEN, Germany 28604 column store at 4 ?; buffer QG=gel dissolving buffer; buffer PE= wash buffer(for step 14)
MyONE Silane beads Thermo Scientific, USA 37002D nucleic acids extraction magnetic beads
NaCl Invitrogen,USA AM9759
 
NP-40 Amresco, USA M158-500ML
NuPAGE Bis-Tris Protein Gels Invitrogen, USA NP0336BOX 4%–12%,1.5 mm, 15-well
NuPAGE MOPS SDS Buffer Kit  Invitrogen, USA NP0050
PBS Gibco, USA 10010023
Phase-Locked Gel (PLG) heavy tube   TIANGEN, China WM5-2302831
PowerUp SYBR Green Master Mix Applied Biosystems, USA A25742
Proteinase K NEB, New England  P8107S
Q5 PCR master mix  NEB, New England  M0492L
RLT buffer QIAGEN, Germany 79216 RNA purification lysis buffer 
RNA Clean & Concentrator-5 columns  ZYMO RESEARCH, USA R1016 RNA purification and concentration columns
RNase I  Invitrogen, USA AM2295
RNase Inhibitor Promega, USA N251B
RQ1 DNase Promega,USA M610A
Sample Reducing Agent Invitrogen,USA NP0009
SDS Solution Invitrogen, USA 15553027 10%
Sodium deoxycholate Sigma-Aldrich, USA 30970 protect from light
T4 PNK enzyme NEB, New England  M0201L
T4 RNA ligase 1 high conc NEB, New England  M0437M
TA/Blunt-Zero Cloning Mix Vazyme, China C601-01
TBE Invitrogen,USA AM9863
Tris-HCI Buffer Invitrogen, USA 15567027
Triton X-100 Sangon Biotech, China A600198 
Tween-20 Sangon Biotech, China A600560
Urea Sigma-Aldrich, USA U5378
X-ray Films Caresteam, Canada 6535876

DOWNLOAD MATERIALS LIST

References

  1. Turner, J. M., Mahadevaiah, S. K., Ellis, P. J., Mitchell, M. J., Burgoyne, P. S. Pachytene asynapsis drives meiotic sex chromosome inactivation and leads to substantial postmeiotic repression in spermatids. Developmental Cell. 10, (4), 521-529 (2006).
  2. Turner, J. M. A. Meiotic sex chromosome inactivation. Development. 134, (10), 1823-1831 (2007).
  3. Kimmins, S., Sassone-Corsi, P. Chromatin remodelling and epigenetic features of germ cells. Nature. 434, (7033), 583-589 (2005).
  4. Ule, J., et al. CLIP identifies Nova-regulated RNA networks in the brain. Science. 302, (5648), 1212-1215 (2003).
  5. Ule, J., Jensen, K., Mele, A., Darnell, R. B. CLIP: a method for identifying protein-RNA interaction sites in living cells. Methods. 37, (4), 376-386 (2005).
  6. Trifillis, P., Day, N., Kiledjian, M. Finding the right RNA: identification of cellular mRNA substrates for RNA-binding proteins. RNA. 5, (8), 1071-1082 (1999).
  7. Tenenbaum, S. A., Carson, C. C., Lager, P. J., Keene, J. D. Identifying mRNA subsets in messenger ribonucleoprotein complexes by using cDNA arrays. Proceedings of National Acadamy of Sciences U S A. 97, (26), 14085-14090 (2000).
  8. Chi, S. W., Zang, J. B., Mele, A., Darnell, R. B. Argonaute HITS-CLIP decodes microRNA-mRNA interaction maps. Nature. 460, (7254), 479-486 (2009).
  9. Zheng, K., et al. Mouse MOV10L1 associates with Piwi proteins and is an essential component of the Piwi-interacting RNA (piRNA) pathway. Proceedings of National Acadamy of Sciences U S A. 107, (26), 11841-11846 (2010).
  10. Gregersen, L. H., et al. MOV10 Is a 5' to 3' RNA helicase contributing to UPF1 mRNA target degradation by translocation along 3' UTRs. Molecular Cell. 54, (4), 573-585 (2014).
  11. Banerjee, S., Neveu, P., Kosik, K. S. A coordinated local translational control point at the synapse involving relief from silencing and MOV10 degradation. Neuron. 64, (6), 871-884 (2009).
  12. Choi, J., Hwang, S. Y., Ahn, K. Interplay between RNASEH2 and MOV10 controls LINE-1 retrotransposition. Nucleic Acids Research. 46, (4), 1912-1926 (2018).
  13. Goodier, J. L., Cheung, L. E., Kazazian, H. H. Jr MOV10 RNA helicase is a potent inhibitor of retrotransposition in cells. PLoS Genetics. 8, (10), e1002941 (2012).
  14. Haussecker, D., et al. Capped small RNAs and MOV10 in human hepatitis delta virus replication. Nature Structural & Molecular Biology. 15, (7), 714-721 (2008).
  15. Kenny, P. J., et al. MOV10 and FMRP regulate AGO2 association with microRNA recognition elements. Cell Reports. 9, (5), 1729-1741 (2014).
  16. Messaoudi-Aubert, S. E., et al. Role for the MOV10 RNA helicase in Polycomb-mediated repression of the INK4a tumor suppressor. Nature Structural & Molecular Biology. 17, (7), 862-868 (2010).
  17. Sievers, C., Schlumpf, T., Sawarkar, R., Comoglio, F., Paro, R. Mixture models and wavelet transforms reveal high confidence RNA-protein interaction sites in MOV10 PAR-CLIP data. Nucleic Acids Research. 40, (20), e160 (2012).
  18. Skariah, G., et al. Mov10 suppresses retroelements and regulates neuronal development and function in the developing brain. BMC Biology. 15, (1), 54 (2017).
  19. Zheng, K., Wang, P. J. Blockade of pachytene piRNA biogenesis reveals a novel requirement for maintaining post-meiotic germline genome integrity. PLoS Genetics. 8, (11), e1003038 (2012).
  20. Vourekas, A., et al. The RNA helicase MOV10L1 binds piRNA precursors to initiate piRNA processing. Genes & Development. 29, (6), 617-629 (2015).
  21. Hocq, R., Paternina, J., Alasseur, Q., Genovesio, A., Le Hir, H. Monitored eCLIP: high accuracy mapping of RNA-protein interactions. Nucleic Acids Research. 46, (21), 11553-11565 (2018).
  22. Huppertz, I., et al. iCLIP: protein-RNA interactions at nucleotide resolution. Methods. 65, (3), 274-287 (2014).
  23. Hafner, M., et al. Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 141, (1), 129-141 (2010).
  24. Hafner, M., et al. PAR-CliP--a method to identify transcriptome-wide the binding sites of RNA binding proteins. Journal of Visualized Experiments. (41), (2010).
  25. Konig, J., et al. iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nature Structural & Molecular Biology. 17, (7), 909-915 (2010).
  26. Konig, J., et al. iCLIP--transcriptome-wide mapping of protein-RNA interactions with individual nucleotide resolution. Journal of Visualized Experiments. (50), (2011).
  27. Maticzka, D., Ilik, I. A., Aktas, T., Backofen, R., Akhtar, A. uvCLAP is a fast and non-radioactive method to identify in vivo targets of RNA-binding proteins. Nature Communications. 9, (1), 1142 (2018).
  28. Van Nostrand, E. L., et al. Robust transcriptome-wide discovery of RNA-binding protein binding sites with enhanced CLIP (eCLIP). Nature Methods. 13, (6), 508-514 (2016).
  29. Radulovich, N., Leung, L., Tsao, M. S. Modified gateway system for double shRNA expression and Cre/lox based gene expression. BMC Biotechnology. 11, 24 (2011).
  30. Breunig, C. T., et al. A Customizable Protocol for String Assembly gRNA Cloning (STAgR). Journal of Visualized Experiments. (142), (2018).
  31. Kuhn, R. M., Haussler, D., Kent, W. J. The UCSC genome browser and associated tools. Briefings in Bioinformatics. 14, (2), 144-161 (2013).
  32. Vourekas, A., et al. Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis. Nature Structural & Molecular Biology. 19, (8), 773-781 (2012).
  33. Preitner, N., et al. APC is an RNA-binding protein, and its interactome provides a link to neural development and microtubule assembly. Cell. 158, (2), 368-382 (2014).
  34. Meyer, C., et al. The TIA1 RNA-Binding Protein Family Regulates EIF2AK2-Mediated Stress Response and Cell Cycle Progression. Molecular Cell. 69, (4), 622-635 (2018).
  35. Gerstberger, S., Hafner, M., Tuschl, T. A census of human RNA-binding proteins. Nature Reviews Genetics. 15, (12), 829-845 (2014).
  36. Vourekas, A., Mourelatos, Z. HITS-CLIP (CLIP-Seq) for mouse Piwi proteins. Methods in Molecular Biology. 1093, 73-95 (2014).
Méthode améliorée d’Immunopréprécipitation de réticulation (eCLIP) pour l’identification efficace de l’ARN lié aux protéines dans les testicules de souris
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Xu, Q., Wang, C., Ling, L., Yue, Q., Liu, M., Zhang, S., Fu, K., Ye, L., Zheng, K. Enhanced Crosslinking Immunoprecipitation (eCLIP) Method for Efficient Identification of Protein-bound RNA in Mouse Testis. J. Vis. Exp. (147), e59681, doi:10.3791/59681 (2019).More

Xu, Q., Wang, C., Ling, L., Yue, Q., Liu, M., Zhang, S., Fu, K., Ye, L., Zheng, K. Enhanced Crosslinking Immunoprecipitation (eCLIP) Method for Efficient Identification of Protein-bound RNA in Mouse Testis. J. Vis. Exp. (147), e59681, doi:10.3791/59681 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter