Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Biology

Verbesserte Vernetzung der Immunoptierungsmethode (eCLIP) zur effizienten Identifizierung der proteingebundenen RNA in Mäusetestis

doi: 10.3791/59681 Published: May 10, 2019
* These authors contributed equally

Summary

Hier stellen wir ein eCLIP-Protokoll vor, um die wichtigsten RNA-Ziele von RBP-Kandidaten in Hoden zu ermitteln.

Abstract

Die Spermatogenese definiert einen sehr geordneten Prozess der männlichen Keimzelldifferenzierung bei Säugetieren. In den meisten Hoden werden Transkriptionen und Übersetzungen entkoppelt, was die Bedeutung der nachträglichen Regulierung der von RBPs orchestrierten Genexpression unterstreicht. Um die mechanistische Rolle eines RBP zu erklären, kann die Vernetzung der Immunop-(CLIP)-Methodik verwendet werden, um die endogenen direkten RNA-Ziele zu erfassen und die tatsächlichen Interaktionsorte zu definieren. Das erweiterte CLIP (eCLIP) ist ein neu entwickeltes Verfahren, das gegenüber den herkömmlichen CLIPs mehrere Vorteile bietet. Allerdings ist die Nutzung von eCLIP bisher auf Zelllinien beschränkt, was erweiterte Anwendungen fordert. Hier haben wir eCLIP eingesetzt, um MOV10 und MOV10L1, zwei bekannte RNA-bindende Helicases, in Mäusehden zu studieren. Wie zu erwarten, stellen wir fest, dass MOV10 überwiegend an 3 ' nicht übersetzte Regionen (UTRs) von mRNA und MOV10L1 selektiv an Piwi-interagierende RNA (piRNA) Vorläuferprotokolle bindet. Unsere eCLIP-Methode ermöglicht die schnelle Bestimmung von großen RNA-Arten, die durch verschiedene RBPs durch kleine Sequenzierung von Subklonen und damit die Verfügbarkeit von qualifizierten Bibliotheken gebunden sind, als Garantie für die Durchführung einer tiefen Sequenzierung. Diese Studie schafft eine anwendbare Grundlage für eCLIP in Säugetierhauszeugen.

Introduction

Mammalian testis stellt ein hervorragendes Entwicklungsmodell dar, bei dem ein kompliziertes Zelldifferenzierungsprogramm zyklisch läuft, um zahlreiche Spermien zu erzeugen. Ein einzigartiger Wert dieses Modells liegt in der Entstehung der transkriptionalen Inaktivierung in bestimmten Stadien der Spermatogenese, typischerweise wenn die meiotische Geschlechtchromosome-Inaktivierung (MSCI) 1, 2 auftritt und wenn runde Spermien sich unterziehen. Drastische nukleare Verdichtungwährendder Spermiogenese 3. Diese inkonsekutiven transkriptionalen Ereignisse erfordern eine posttranskriptionale Genregulation, bei der RNA-bindende Proteine (RBPs) eine entscheidende Rolle spielen, die Transkriptome prägen und die männliche Fruchtbarkeit erhalten.

Um die echten RNA-Ziele eines einzelnen RBP in vivo zu identifizieren, wurde die vernetzte Immunop-(CLIP) Methode mit 4,5 entwickelt, basierendauf dem regulären RNA-Immunsystem (RIP)6,7 , durch die Einfügung von Schlüsselschritten, einschließlich der ultravioletten (UV) Vernetzung, strenger Wasch-und Gelübertragung, um die Signalspezifik zu verbessern. Die fortschrittliche Anwendung des CLIP in Kombination mit einer Hochdurchsatzsequenzierung hat großes Interesse an der Profi-Protein-RNA-Interaktion auf genomweiten Ebenen8geweckt. Zusätzlich zu genetischen Studien zur RBP-Funktion waren solche biochemischen Methoden, die das direkte Zusammenspiel von endogenem Protein und RNA identifizieren, unverzichtbar, um die RNA-regulatorische Rolle von RBPs genau zu erklären. MOV10L1 ist zum Beispiel eine weitenspezifische RNA-Helicase, die für die männliche Fruchtbarkeit und die Piwi-interagierende RNA (piRNA) Biogenese 9 benötigt wird. Sein paralogue MOV10 ist bekannt als allgegenwärtig ausgedrückte und multifunktionale RNA-HelicasemitRollen in verschiedenen Aspekten der RNA-Biologie 10,11, 12,13 ,14 , 15 , 16 , 17 , 18. Durch den Einsatz der herkömmlichen CLIP-seq, fanden wir, dass MOV10L1 bindet und reguliert primäre PiRNA-Vorläufer, um frühe piRNA-Verarbeitung19,20zu initiieren, und dass MOV10 mRNA 3 ' UTRs und sowie nicht-coding RNA Arten in Hodenkeimzellen (Daten nicht abgebildet).

Dennoch ist CLIP ursprünglich ein mühsames, radioaktives Verfahren, gefolgt von der Sequenzierung der Bibliotheksvorbereitung mit einem bemerkenswerten Verlust von CLIP-Tags. In der herkömmlichen CLIP wird eine cDNA-Bibliothek mit Adaptern vorbereitet, die an beiden RNA-Extremitäten ligiert sind. Nach der Proteinverdauung bleiben vernetzte kurze Polypeptide an RNA-Fragmenten befestigt. Diese Vernetzungsmarke blockiert die Reverse Transkriptase (RTase) während der cDNA-Synthese teilweise, was zu verkürzten cDNAs führt, die etwa 80%der cDNA-Bibliothek21,22ausmachen. So werden nur cDNA-Fragmente sequenziert, die aus RTase resultieren, die die Vernetzungsstelle umgehen (Durchlesen). In jüngster Zeit wurden verschiedene CLIP-Ansätze wie PAR-CLIP, iCLIP, eCLIP und uvCLAP eingesetzt, um Querlink-Standorte von RBPs in lebenden Zellen zu identifizieren. PAR-CLIP beinhaltet die Anwendung von 365 nm UV-Strahlung und photoaktivierbaren Nukleotid-Analogen und ist daher ausschließlich für die In-kulturierende lebende Zellen, und die Einbindung von Nukleosid-Analogen in neu synthetisierte Transkripte ist anfällig für die Produktion von Bias Dort, wo die RNA physischmit dem Protein 23,24interagiert. In iCLIP wird nur ein einziger Adapter an die 3 ' Extremität der vernetzten RNA-Fragmente gekoppelt. Nach der umgekehrten Transkription (RT) werden sowohl verkürzte als auch durchlässige cDNAs durch intramolekulare Zirkularisierung und Re-Linearisierung erreicht, gefolgt von einer Polymerase-Kettenreaktion (PCR), die 25,26verstärkt. Die Effizienz der intramolekularen Kreislaufisierung ist jedoch relativ gering. Obwohl ältere CLIP-Protokolle eine Kennzeichnung der vernetzten RNA mit einem Radioisotop benötigen, setzt die ultraviolette Vernetzung und Affinitätsreinigung (uvCLAP) bei einem Prozess der strengen Tandemaffinitätsreinigung nicht auf Radioaktivität 27. Dennoch beschränkt sich uvCLAP auf kultivierte Zellen, die mit dem Expressionsvektor, der das 3x FLAG-HBH-Tag zur Tandemaffinitätsreinigung trägt, transferiert werden müssen.

In eCLIP wurden Adapter zuerst an der 3 ' Extremität der RNA, gefolgt von RT, und als nächstes an der 3 ' Extremität von cDNAs in einem intermolekularen Modus. Damit ist eCLIP in der Lage, alle abgeschnittenen und durchlasen cDNA28zu erfassen. Außerdem beschränkt sie sich weder auf die radioaktive Kennzeichnung, noch auf die Verwendung von Zelllinien nach ihrem Prinzip, während die Auflösung von Nukleotiden beibehalten wird.

Hier finden Sie eine schrittweise Beschreibung eines eCLIP-Protokolls, das für den Mäusehausamser angepasst ist. Kurz gesagt, dieses eCLIP-Protokoll beginnt mit der UV-Vernetzung von Hodenröhrungen, gefolgt von einer teilweisen RNase-Verdauung und Immuntherapie mit einem proteinspezifischen Antikörper. Als nächstes wird die proteingebundene RNA dephosphoryliert, und der Adapter wird bis zu seinem 3 ' Ende ligiert. Nach der Protein-Gel-Elektrophorese und der Gel-zu-Membran-Übertragung wird die RNA durch das Schneiden der Membranfläche eines erwarteten Größenbereiches isoliert. Nach RT wird der DNA-Adapter an das 3 ' Ende der cDNA ligiert, gefolgt von PCR-Verstärkung. Das Screening von Subklonen vor der Hochdurchsatz-Sequenzierung wird als Qualitätskontrolle der Bibliothek genommen. Dieses Protokoll ist effizient bei der Identifizierung der wichtigsten Arten von proteingebundenen RNA von RBPs, beispielhaft für die beiden Protden-Ausdruck RNA-Helikasen MOV10L1 und MOV10.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Alle durchgeführten Tierversuche wurden vom Ausschuss der Nanjing Medical University genehmigt. Männliche C57BL/6 Mäuse wurden unter kontrollierten Photoperiodenbedingungen gehalten und mit Nahrung und Wasser versorgt.

1. Gewebeernte und UV-Kreuzung

  1. 2 erwachsene Mäuse mit Kohlendioxid (CO2) für 1-2 Minuten oder bis die Atmung anhält, mit Sterbezeit beweiden. Als Nächstes führen Sie die Gebärmutterhalskrebs auf jeder Maus durch.
  2. Ernten Sie für jedes Immun-und Immunitätsexperiment etwa 100 mg Testes von Mäusen im entsprechenden Alter (ein erwachsener Hodensack in dieser Studie) und legen Sie das Gewebe in eiskalter Phosphat-gepufferte Saline (PBS).
  3. Entfernen Sie die Tunica albuginea vorsichtig mit einem Paar fein gekippter Pinzette.
  4. 3 mL eiskalter PBS in einen Gewebeschleifer geben und das Gewebe mit einem lockeren Glasstestle (Typ A-Glaspestle) durch leichte mechanische Kraft triturieren.
    NOTE: Der Zweck dieses Schrittes ist nicht, Zellen zu lysivieren, sondern das Gewebe auseinander zu ziehen. Die Erhaltung der Lebensfähigkeit und Integrität der Zelle ist wichtig.
  5. Die Gewebefederung auf eine Zellkulturschale (10 cm Durchmesser) übertragen und eiskalte PBS bis zu 6 ml hinzufügen.
  6. Schütteln Sie die Platte schnell, so dass Flüssigkeit bedeckt den Boden der Schale gleichmäßig. Wenn das Gewebe richtig gemahlen wird, werden gleichmäßig verteilte seminiferöse Rohre sichtbar, während das Vorhandensein von Gewebeklumpen darauf hindeutet, dass die Gewebeverteilung suboptimal ist.
  7. Die Aufhängung dreimal mit 400 mJ/cm 2 bei 254 nm auf Eis kreuzen. Die Aufhängung zwischen den einzelnen Bestrahlungen vermischen.
    NOTE: Für jedes neue Experiment sollte die Vernetzung optimiert werden.
  8. Sammeln Sie die Aufhängung in einem 15 mL konischen Rohr und Pellet bei 1.200 x g für 5 min bei 4 ° C. Das Supernatant entfernen, das Pellet in 1 ml PBS wiederverwenden und dann die Aufhängung auf ein 1,5 ml Zentrifugenrohr übertragen. Drehen Sie bei 4 ° C und 1.000 x g für 2 min, und entfernen Sie supernatant.
  9. An dieser Stelle sofort mit dem restlichen Protokoll fortfahren, oder die Pellets in flüssigem Stickstoff einfrieren und bei-80 ° C bis zum Gebrauch aufbewahren.

2. Perlenvorbereitung

  1. Eine Magnetperle pro Probe (Pellet) wird in ein frisches Zentrifugenrohr gegeben.
    NOTE: Verwenden Sie Eiweiß-G-Magnetperlen für Maus-Antikörper.
  2. Legen Sie das Rohr auf den Magneten, um die Perlen von der Lösung zu trennen. Nach 10 s den Supernatant entfernen. Zweimal Perlen mit 1 mL eiskalter Lysepuffer waschen.
    NOTE: Nachfolgende Trennung des Proteins Eine magnetische Perlen folgt diesem Schritt. Lysis Pufferzusammensetzung ist 50 mM Tris-HCl, pH 7,5; 100 mM NaCl; 1% NP-40; 0,1% SDS; 0,5% Natriumoxycholat; Der Inhalierte 50 Ethylenediaminetetraacetik-Säure (EDTA) ist ein kostenloser Protease-Cocktail (frisch hinzufügen).
  3. Resuspend Perlen in 100 μL kalten Lysepuffers mit 10 μg eCLIP Antikörper. Drehen Sie Rohre bei Raumtemperatur für 45 min.
    NOTE: Die endgültige Antikörperkonzentration für die Immunophrenation beträgt 10 μg/mL. Ist die Antikörperkonzentration unbekannt, sollte die Antikörpermenge optimiert werden.
  4. Zweimal Perlen mit 1 mL eiskalter Lysepuffer waschen.

3. Tissue Lysis und partial RNA Verdauung

  1. Wiederbelebtes Gewebe Pellets in 1 ml kaltem Lysepuffer (22 μL von 50x (EDTA) freien Proteinhemmer und 11 μL RNase-Inhibitor zu 1 mL Lysepuffer hinzufügen).
    1. Rückfahrt von zwei UV-vernetzten Pellets und zwei nicht-vernetzten Pellets pro Experimentgruppe: UV-vernetzte 1-Pellets für die eCLIP-Bibliothek (UV-1); UV-Crosslinked-2-Pellets für die eCLIP-Bibliothek (UV-2); Nicht-vernetzte-1-Pellets für die eCLIP-Bibliothek als Steuerung (Nicht-UV); Nicht-vernetzte-2-Pellets für IgG IP, um die Spezifität von Antikörpern zu demonstrieren.
      Hinweis: Die ideale Steuerung für die eCLIP-Bibliothek der UV-vernetzten Breittysten ist die der UV-vernetzten Knockout-Hoden von Mäusen desselben Wurfes.
  2. Die Proben 15 Minuten lang auf Eis lysischen (um eine Verschlechterung von Eiweiß und RNA zu verhindern).
  3. Sonicate in einem digitalen Soundator bei 10% Amplitude für 5 min, bei 30 s on/30 s aus. Legen Sie die Probe immer auf Eis und reinigen Sie die Sonde mit nukleasfreiem Wasser zwischen den Proben.
  4. Fügen Sie 4 μL DNase zu jedem Rohr hinzu und mischen Sie gut. 10 min bei 37 ° C umgewirrt, bei 1.200 U/min schüttelt.
  5. Fügen Sie 10 μL verdünnte RNase I (4 U/μL RNase I in PBS) hinzu und mischen Sie gut. 5 min bei 37 ° C umatenspülen, bei 1.200 U/min schütteln.
  6. Reinigen Sie das Lysat durch Zentrifugation bei 15.000 x g für 20 min (bei 4 ° C).
  7. Sorgfältig sammeln die Supernatanten. 50 μL Lysat lassen und das Pellet damit ablegen.
  8. Speichern Sie Eingabe-und RWBungsproben wie RWB (laufen für Western Blot) und RRI (laufen für RNA-Isolation). 20 μL (2%) sparen Von UV-1, UV-2, Nicht-UV und IgG-Proben als Eingänge für die RWB-Gel-Belastung. 20 μL (2%) sparen Von UV-1 oder UV-2-Proben als Eingänge für die RRI-Gel-Ladung.

4. Immunoptierung

  1. 1 ml des Lysats (ab Schritt 3.7) zu den Perlen (in Abschnitt 2 vorbereitet) hinzufügen und die Proben bei 4 ° C für 2 Stunden oder über Nacht drehen.
  2. Sammeln Sie die Perlen mit einem Magnetständer und werfen Sie den Supernatant. Die Perlen zweimal mit 900 μL hohen Salzpuffer waschen (50 mM Tris-HCl, pH 7,5; 1 M NaCl; 1 mM EDTA; 1% NP-40; 0,1% SDS; 0,5% Natriumoxycholat), und dann Peren zweimal mit 900 μL Waschpuffer waschen (20 mM Tris-HCl, pH 7,5; 10 mM MgCl2; 0,2% Tween-20).
    NOTE: Für die IgG-Probe, unterbrechen Sie die Prozedur hier und speichern Sie auf Eis in Waschpuffer.
  3. Einmal Perlen mit 500 μL 1x Dephosphorylierungspuffer waschen (10 mM Tris-HCl, pH 7,5; 5 mM MgCl2; 100 mM KCl; 0,02% Triton X-100).

5. Dephosphorylierung der RNA 3 ' Ends

  1. Sammeln Sie die Perlen mit einem Magnetständer und werfen Sie den Supernatant. Entfernen Sie Restflüssigkeit mit feinen Pipette-Spitzen. Fügen Sie 100 μL Dephosphoryliation-Master-Mix (10 μL von 10x Dephosphoryliation-Puffer [100 mM Tris-HCl, pH 8.0; 50 mM MgCl 2; 1 M KCl; 0,2% Triton X-100; 1 mg/mL Rinder-Serum Albumin (BSA)]; 78 μL natomfreies Wasser; 2 μL RNase Inhibitor; 2 μL DNase; 8 μL al Die Phosphatase der Kaline) zu jeder Probe, und inkubieren für 15 min bei 37 ° C, schütteln bei 1.200 U/min.
  2. 300 μL Polynukleotid-Kinase (PNK) Master-Mix (60 μL von 5x PNK pH 6,5 Puffer [350 mM Tris-HCl, PH 6,5; 50 mM MgCl2]; 223 μL natomfreies Wasser; 5 μL RNase-Inhibitor; 2 μL DNase; 7 μL PNK-Enzym; 3 μL von 0,1 M dithiothreitol) zu jeder Probe , Inkubat für 20 min bei 37 ° C, Schütteln bei 1.200 U/min.
  3. Sammeln Sie die Perlen mit einem Magnetständer und werfen Sie den Supernatant. Einmal Perlen mit 500 μL Kaltwaschpuffer waschen. Dann die Perlen einmal mit 500 μL kaltem Salzpuffer waschen. Wiederholen Sie diese Waschungen noch einmal in dieser Reihenfolge.
  4. Einmal Perlen mit 500 μL Kaltwaschpuffer und dann zweimal mit 300 μL kaltem 1x-Ligationspuffer (kein Dithiothreitol, 50 mM Tris-HCl, pH 7,5; 10 mM MgCl2).

6. RNA-Adapter-Legierung zu RNA 3 ' Ends

  1. Den Supernatant abwerfen und Restflüssigkeit mit feinen Pipette-Spitzen entfernen. Fügen Sie jedem Beispiel 25 μL von 3 ' Ligation-Meister-Mix hinzu. Die sorgfältig durch Pipettieren mischen. Dieser Schritt neigt dazu, Blasen zu produzieren.
    NOTE: Ligation-Master-Mix enthält 3 μL 10x-Ligations-Puffer [500 mM Tris-HCl, pH 7,5; 100 mM MgCl2]; 9 μL natomfreies Wasser; 0,4 μL von RNase Inhibitor; 0,3 μL von 0,1 M ATP; 0,8 μL Dimethylsulfoxid (DMSO); 9 μL von 50% Polyethylen-Glykol (PEG) 8000; 2,5 μL RNA-Ligase [30 U/μL].
  2. Fügen Sie jeder Probe 2,5 μL RNA-Adapter X1A (Tabelle 1) und 2,5 μL RNA-Adapter X1B (Tabelle 1) hinzu. Nach dem Pipettieren oder Flicken vorsichtig vermischen und bei 25 ° C 75 Minuten inkubieren, alle 10 Minuten vermischen.
  3. Einmal Perlen mit 500 μL Kaltwaschpuffer waschen (IgG-Sampleffest hier wieder aufnehmen).
  4. Einmal Perlen mit 500 μL kaltem Salzpuffer und dann mit 500 μL Kaltwaschpuffer waschen. Wiederholen Sie diese Waschungen noch einmal.
  5. Magnetisch getrennte Perlen, und entfernen Sie Restflüssigkeit mit feinen Pipette-Spitzen.
  6. Die Perlen in 100 μL kaltem Waschpuffer wiederverwenden (die IgG-Sampffprobe hier unterbrechen und auf Eis im Waschpuffer aufbewahren). 20 μL auf neue Rohre als RWB-Proben verschieben. Die restlichen 80 μL werden magnetisch als RRI-Samples getrennt. Entfernen Sie den Supernatant der RID-Samples und lassen Sie die Perlen in 20 μL Waschpuffer wieder aufleben.
  7. Fügen Sie 37,5 μL von 4x Lithium-Dodeyl-Sulfat (LDS) Probenpuffer und 15 μL von 10x Probenreduzierung in die IgG-Sample-Probe. Fügen Sie 7,5 μL 4x LDS-Sampffuffer und 3 μL 10x Probenminderungsmittel zu den (verbleibenden) Proben hinzu. (Nicht durch Pipettieren mischen). 10 min bei 70 ° C umgewirrt, bei 1.200 U/min schüttelt. Auf Eis 1 min abkühlen und Zentrifuge bei 1.000 x g für 1 min bei 4 ° C.

7. SDS-PAGE und Membranübergabe

  1. Tragengel.
    1. Für RRI-Gel (4-12% Bis-Tris-Eiweißgel, 10-gut, 1,5 mm) auf einen Magneten Rohre legen und Eiweiß-Eluate von den Perlen trennen. 30 μL Probe pro Brunnen laden. Die Proben werden durch die vorgefärbte Proteingrößenmarkierung abgetrennt.
    2. Für RWB-Gel (4-12% Bis-Tris-Eiweißgel, 10-gut, 1,5 mm) auf einen Magneten Rohre legen und Eiweiß-Eluate von den Perlen trennen. Laden Sie 15 μL Probe pro Brunnen. Speichern Sie die restlichen Proben bei-20 ° C als Backups.
  2. Fügen Sie 500 μL Antioxidationsmittel zu 500 ml 1x SDS laufendem Puffer hinzu. Laufen Sie bei 200 V in 1x SDS Laufpuffer für 50 min oder bis die Farbstofffront unten ist.
    NOTE: Antioxidantien enthält N, N-Dimethylformamid, Natriumbisulfit, das mit reduzierten Proteinen wandert, um eine Reoxidation empfindlicher Aminosäuren wie Methionin und Tryptophan zu verhindern.
  3. Übertragung protein-RNA-Komplexe vom Gel auf eine Nitrocellulose-Membran bei 10 V für 70 min im 1xtransfer-Puffer mit 10% Methanol (vol/vol). Spülen Sie die RRI-Membran in kaltem PBS, wickeln Sie sie in Plastikfolie und lagern Sie bei-80 ° C.
  4. Die RWB-Membran in 5% Milch in TBST bei Raumtemperatur für 1 h einschlagen und die Membran in TBST abspülen. Inkubieren Sie mit dem primären Antikörper in TBST bei 4 ° C über Nacht. Mit TBST zweimal für 5 min waschen. Inkubat mit sekundärem Antikörper (1:5000 HRP Ziege Anti-Kaninchen IgG) in TBST bei Raumtemperatur für 1 h. Mit TBST dreimal 5 min, 10 min und 15 min waschen.
  5. Die gleichen Mengen der Elektrochemilumineszenz (ECL) Buffer A und Buffer B vermischen, die Membran und das Inkubat für 1 min hinzufügen. Die Membran mit Plastikfolie bedecken und 2-3 min einer Röntgenfolie bei Raumtemperatur aussetzen. Dann entwickeln Sie den Film.
    NOTE: Die überbelichtete Folie zeigt deutlich die Form der Membrankanten, durch die die Folie wieder auf die RWB-Membran ausgerichtet werden kann. Dann richten Sie die RWB und RRI-Membranen auf der Grundlage der Positionen der Marker darin. In der Reihenfolge von unten nach oben sind der Film, die RWB-Membran und die RRI-Membran in der Reihenfolge geschichtet.

8. RNA-Isolation

  1. Schneiden Sie die Region vom Proteinband auf 75 kDa (ca. 220 Nie der RNA) darüber, wobei die RWB-Membran und der Film als Führer verwendet werden.
    NOTE: Da ein proteingeschütztes RNA-Molekül eine maximale Länge von 225 Basen haben kann, mit etwa 340 Da pro Basis, ist es sinnvoll, die Region etwa 75 kDa über dem RBP-Band zu schneiden, um alle Protein-RNA-Komplexe abzurufen.
  2. Das ausgesuchte Membranstück in mehrere kleine Scheiben schneiden und in ein frisches 1,5 ml Zentrifugenrohr geben. 200 μL Proteinase K (PK) Puffer (100 mM Tris-HCl pH 7,5; 50 mM NaCl; 10 mM EDTA) mit 40 μL PK PK zu den Membranstücken hinzufügen. Mischen und Inkubieren 20 min bei 37 ° C, Schütteln bei 1.200 U/min.
  3. Fügen Sie jedem Beispiel 200 μL PK-Harnstoff-Puffer (100 mM Tris-HCl pH 7.4; 50 mM NaCl; 10 mM EDTA; 7 M Urea) hinzu. 20 Minuten bei 37 ° C umgewirrt, bei 1.200 U/min schüttelt.
  4. 400 μL sauren Phenol/chloroform/isoamyl-Alkohol (25:24:1) dazugeben, gut mischen und 5 min bei 37 ° C inkubieren, bei 1.200 U/min schütteln.
  5. Platz 2 mL Phasenverschluss Gel (PLG) schweres Rohr in der Zentrifuge und Drehen bei 15.000 x g für 25 s.
  6. Alle Inhalte außer Membranscheiben auf PLG-Schwerrohre übertragen. 5 min bei 37 ° C umatenspülen, bei 1.200 U/min schütteln.
  7. Drehen Sie bei Raumtemperatur und 15.000 x g für 15 min. Übertragen Sie die wässrige Schicht in ein neues 15 ml konisches Rohr.
  8. Verwenden Sie RNA-Reinigungs-und Konzentrationsspalten, um RNA zu extrahieren.
    1. Fügen Sie jeder Probe (ab Schritt 8.7) 2 Bände (800 μL) des RNA-Binderbandes hinzu (ab Schritt 8.7) und mischen Sie. Fügen Sie ein gleichmäßiges Volumen (1200 μL) von 100% Ethanol und Mischung.
    2. Übertragen Sie 750 μL Probe (von Schritt 8.8.1) auf die RNA-Reinigungs-und Konzentrationssäulen in einem Sammelrohr und Zentrifuge bei 15.000 x g für 30 s.
    3. Wiederholen Sie den Schritt 8.8.2, bis alle Proben durch die Säule geführt werden. Fügen Sie 400 μL RNA-Prep-Puffer in die Spalte und Zentrifuge bei 15.000 x g für 30 s. Discar-Durchfluss, 700 μL RNA-Waschpuffer auftragen und die Spalte mit 15.000 x g für 30 s zentrifuge.
    4. 400 μL RNA-Waschpuffer in die Säule und die Zentrifuge bei 15.000 x g für 2 min hinzufügen. 10 μL natomfreies Wasser in die Säulenmatrix geben, 2 min sitzen lassen und Zentrifuge bei 15.000 x g für 30 s. eCLIP-Proben bei-80 ° C bis RT (Schritt 11.1) aufbewahren.

9. Dephosphorylierung der Eingangs-RNA 3 ' Ends

  1. 15 μL Dephosphoryliation-Master-Mix (2,5 μL 10x Dephosphoryliationspuffer [100 mM Tris-HCl, pH 8.0; 50 mM MgCl 2; 1 M KCl; 0,2% Triton X-100; 1 mg/mL BSA]; 9,5 μL natikfreies Wasser; 0,5 μL RNase-Inhibitor; 2,5 μL alkalischer Phosphatase) bis 10 μL von Eingabeproben (von Schritt 8.8.4). 15 Minuten bei 37 ° C umgewirrt, bei 1.200 U/min schüttelt.
  2. Fügen Sie 75 μL PNK-Master-Mix hinzu (20 μL von 5x PNK PH 6.5 Puffer [350 mM Tris-HCl, PH 6,5; 50 mM MgCl2]; 44 μL natiesfreies Wasser; 1 μL RNase Inhibitor; 2 μL DNase; 7 μL PNK-Enzym; 1 μL von 0,1 M dithiothreitol) zu Proben. 20 Minuten bei 37 ° C umgewirrt, bei 1.200 U/min schüttelt.
  3. Sanierung der Eingangs-RNA
    1. Wiederaufnahme der Thenucleiinsäuren, die magnetische Beadsin der Ampulle (Wirbel für mehr als 30 s) abbauen. Fügen Sie 20 μL Nukleinsäuren hinzu, die für jede Probe magnetische Perlen extrahieren, neue Rohre. Sammeln Sie die Perlen mit einem Magnetständer und werfen Sie den Supernatant.
    2. Einmal Perlen mit 1 mL RNA-Reinigungslysepuffer (RLT-Puffer) waschen. Legen Sie die Röhre auf einen Magneten für 30 s und werfen Sie den Supernatant.
      NOTE: Die anschließende Trennung von Nukleinsääerextraktion von Magnetperlen folgte diesem Schritt.
    3. Perlen mit 300 μL RLT-Puffer wiederverwenden und in die Probe hinzufügen. 10 μL von 5 M NaCl und 615 μL von 100% Ethylalkohol (EtOH) dazugeben und durch Pipettieren mischen. Bei Raumtemperatur 15 min drehen. Die Perlen Magnetisch trennen und supernatant entfernen.
    4. Wiederholen Sie Perlen in 1 mL von 75% EtOH und übertragen Sie auf eine neue Röhre. Nach 30 Jahren die Perlen mit einem Magnetständer sammeln und den Supernatanten abwerfen. Zweimal mit 75% EtOH waschen, die Perlen magnetisch trennen und Restflüssigkeit mit feinen Pipette-Spitzen abwerfen. Die Luft 5 Minuten trocknen (übermäßiges Trocknen vermeiden).
    5. Die Perlen mit 10 μL natomlosem Wasser wiederauferstehen und 5 min inkubieren. Magnetisch getrennte Perlen, und bewegen Sie 5 μL supernatant in ein neues Rohr (für 3 ' Adapterligation unten). Die restliche RNA kann bei-80 ° C als Backups gespeichert werden.

10. RNA-Adapter-Ligation an Eingangs-RNA 3 ' Ends

  1. 1,5 μL DMSO und 0,5 μL RiL19-Adapter (Tabelle1) bis 5 μL Eingang-RNA (ab Schritt 9.3.5), Inkubat für 2 min bei 65 ° C, und mehr als 1 min auf Eis legen. , mischen Sie nach Pipettieren und inkubieren für 75 min bei 25 ° C, mit Flicken, um alle 15 Minuten zu mischen.
    NOTE: Ligation-Master-Mix enthält 2 μL 10x-Ligations-Puffer [500 mM Tris-HCl, pH 7,5; 100 mM MgCl 2; 10 mM dithiothreitol]; 1,5 μL natomfreies Wasser; 0,2 μL RNase-Inhibitor; 0,2 μL von 0,1 M ATP; 0,3 μL DMSO; 8 μL von 50% PEG8000; 1.3 μL der RNA-Ligase [30 U/μL].
  2. Sanierung der ligierten Eingangs-RNA
    1. Magnetisch trennen 20 μL Nukleinsäuren extrahieren magnetische Perlen für jede Probe, und entfernen Sie den Supernatant. Einmal Perlen mit 1 ml RLT-Puffer waschen.
    2. Wiederholen Sie Perlen in 61,6 μL RLT-Puffer und Transferaufhängung zu jeder Probe. Fügen Sie 61,6 μL von 100% EtOH hinzu. Verwenden Sie Pipette, um für 15 min alle 5 min mischen. Magnetisch getrennte Perlen, und entfernen Sie supernatant.
    3. Wiederholungsschritt 9.3.4.
    4. Die Perlen mit 10 μL natomlosem Wasser wiederbeleben und 5 Minuten ruhen lassen. Magnetisch die Perlen trennen und 10 μL des Supernatanten auf ein neues Rohr übertragen.
      NOTE: Dies ist ein möglicher Haltepunkt (Eingangsproben können bis zum nächsten Tag bei-80 ° C gespeichert werden).

11. Reverse Transcription, DNA Adapter Ligation to cDNA 3 ' Ends

  1. 0,5 μL RT-Grundierung (Tabelle1) bis 10 μL Eingang-RNA (ab Schritt 10.2.4) bzw. 10 μL CLIP-RNA (ab Schritt 8.8.4) bzw. im vorgeheizten PCR-Block bei 65 ° C, mehr als 1 min auf Eis legen.
  2. 10 μL RT-Master-Mix (2 μL RT-Puffer [500 mM Tris-HCl, pH 8.3; 750 mM KCl; 30 mM MgCl2]; 4 μL natiesfreies Wasser; 0,3 μL RNase Inhibitor; 2 μL von 0,1 M dithiothreitol; 0,2 μL von 0,1 M dATP; 0,2 μL von 0,1 M dCTP; 0,2 μL von 0,2 μL von 0,2 μL von 0,2 μL 0,1 M dGTP; 0,2 μL von 0,1 M dTTP; 0,9 μL umgekehrter Transkriptase) zu jeder Probe, mischen, inkubieren bei 55 ° C für 45 min auf einem vorgeheizten PCR-Block.
  3. Mischen Sie 20 μL RT-Reaktionsprodukt mit 3,5 μL PCR-Produktreinigungsreagenz. 15 min bei 37 ° C umatenfühlen.
  4. 1 μL von 0,5 M EDTA dazugeben, durch Pipettieren mischen. 3 μL von 1 M NaOH dazugeben, nach Pipettieren mischen und 12 min bei 70 ° C inkubieren, um die Schablone RNA zu hydrolysieren.
  5. Fügen Sie 3 μL von 1 M HCl, Pipette-Mix, um den Puffer zu neutralisieren.
  6. Sanierung von cDNA
    1. Magnetisch trennen 10 μL Nukleinsäureextraktion magnetische Perlen für jede Probe, entfernen Sie das Supernatant. Einmal mit 500 μL RLT-Puffer waschen.
    2. Wiederholen Sie Perlen in 93 μL des RLT-Puffers und Transferaufhängung auf die Probe. 111,6 μL von 100% EtOH dazugeben, 5 min inkubieren und alle 2 Minuten mit Pipette vermischen. Die Perlen mit einem Magnetständer sammeln und den Supernatant abwerfen. Perlen mit 1 ml von 80% EtOH wiederverwenden und in eine neue Röhre umziehen.
    3. Nach 30 Jahren die Perlen mit einem Magnetständer sammeln und den Supernatanten abwerfen. Mit 80% EtOH zweimal waschen. Magnetisch trennen und Restflüssigkeit mit feiner Spitze abwerfen. Die Luft 5 Minuten trocknen (übermäßiges Trocknen vermeiden). Perlen in 5 μL von 5 mM Tris-HCl wiederempfehlen und 5 min inkubieren.
  7. 0,8 μL DNA-Adapter (Tabelle 1) und 1 μL DMSO zu den Perlen geben, bei 75 ° C 2 min inkubieren. Auf Eis für mehr als 1 min.
  8. Bereiten Sie 12,8 μL Ligations-Master-Mix (2 μL von 10x Ligationspuffer [500 mM Tris-HCl; 100 mM MgCl2; 10 mM dithiothreitol]; 1,1 μL natikfreies Wasser; 0,2 μL von 0,1 M ATP; 9 μL von 50% PEG8000; 0,5 μL RNA-Ligase [30 UμL]) , flicken, mischen, kurz in einer Zentrifuge drehen und zu jeder Probe hinzufügen, Probe mit Pipette-Spitze langsam umrühren.
  9. Fügen Sie zu jeder Probe noch 1 μL RNA-Ligase [30 U/μL] hinzu und klicken Sie auf, um sie zu mischen. Inkubat für 30 s bei 25 ° C, Schütteln bei 1.200 U/min. Über Nacht bei 25 ° C einwirken. Flick, um leicht zu mischen, einmal pro Stunde.
  10. Säuberung der ligierten cDNA
    1. Magnetisch getrennte 5 μL Nukleinsäuren extrahieren magnetische Perlen für jede Probe, und entfernen Sie supernatant.
    2. Einmal mit 500 μL RL-LT-Puffer waschen.
    3. Wiederholen Sie Perlen in 60 μL RLT-Puffer auf Perlen und übertragen Sie die Suspendierung auf jede Probe. 60 μL von 100% EtOH dazugeben, 5 min inkubieren und alle 2 Minuten mit Pipette vermischen. Magnetisch getrennt, supernatant abwerfen.
    4. Wiederholungsschritt 9.3.4.
    5. Wiederholen Sie Perlen mit 27 μL von 10 mM Tris-HCl, inkubieren Sie sie für 5 min. Magnetisch trennen, und bewegen Sie 25 μL Probe auf ein neues Rohr. Die 1 μL ligierte cDNA mit 9 μL kernfreiem Wasser in einem neuen Rohr verdünnen. Die restlichen Proben bei-20 ° C bis zum Schritt 13.1 aufbewahren.

12. Quantifizierung der cDNA durch Echtzeit-Quantitative PCR (qPCR)

  1. 9 μL qPCR-Master-Mix (5 μL 2x Master-Mix; 3,6 μL natikfreies Wasser; 0,4 μL Primer-Mix [10 μM PCR-F-D50X und 10 μM PCR-R-D70X]) zu einer 96-well-qPCR-Platte hinzufügen. 1 μL von 1:10 verdünnt (in H2O) cDNA (ab Schritt 11.10.5), Dichtung und Mischung hinzufügen.
  2. Führen Sie das qPCR-Programm in einem Thermocycler aus: 2 min bei 50 ° C; 2 min bei 95 ° C; 3 s bei 95 ° C, gefolgt von 30 s bei 68 ° C für 40 Zyklen; 15 s bei 95 ° C, gefolgt von 60 s bei 68 ° C, gefolgt von 15 s bei 95 ° C für 1 Zyklus. Hinweis Ct (Zyklusschwelle).

13. PCR Amplifizierung von cDNA

  1. 35 μL PCR-Master-Mix (25 μL 2x PCR-Master-Mix; 5 μL natiertes Wasser; 5 μL Primer-Mix [20 μM PCR-F-D50X und 20 μM PCR-R-D70X]) in 8-well-Streifen. Für CLIP-Gruppe, fügen Sie 12,5 μL CLIP-Probe + 2,5 μL von H2 O; Für die Eingänge können Sie 10 μL von Eingängen + 5 μL von H2 O.gut vermischen und kurz in Zentrifuge drehen.
  2. Das PCR-Programm: 30 s bei 98 ° C; 15 s bei 98 ° C, gefolgt von 30 s bei 68 ° C, gefolgt von 40 s bei 72 ° C für 6 Zyklen; 15 s bei 98 ° C, gefolgt von 60 s bei 72 ° C für N-Zyklen = (qPCR Ct value es-3)-6; 60 s bei 72 ° C; 4 ° C halten.
    NOTE: Besser ist es, 1 bis 2 zusätzliche PCR-Zyklen für die ersten CLIPs durchzuführen.

14. Gel Reinigung

  1. Lastproben auf einem 3% hohen Agura-Gel. 1 Leergut zwischen den Proben lassen und auf beiden Seiten des Gels eine Leiter benutzen. Laufen Sie bei 100 V für 75 min im 1x Tris-Borate-EDTA (TBE) Puffer.
  2. Unter blauer Lichtbeleuchtung schneiden Gel-Scheiben 175-350 bp mit frischen Rasierklingen für jede Probe. In 15 ml konische Rohre geben.
    1. Wiegen Sie die Gel-Scheibe und elüßen Sie das Gel mit einem Gel-Extraktionssatz.
    2. Fügen Sie 6x Volumina des Gel-Auflösungspuffuffers hinzu, um das Gel zu schmelzen (100 mg Gel = 600 μL Gel-Auflösungspuffer). Das Gel bei Raumtemperatur auflösen. (Schütteln Sie alle 15 Minuten, bis sich die Gelscheibe vollständig aufgelöst hat). Ein Gel Volumen von 100% Isopropanol hinzufügen und gut mischen.
    3. 750 μL Probe (von Schritt 14.2.2) auf die Säule in einem Sammelrohr und Zentrifuge mit 17,900 x g für 1 min übertragen.
    4. Wiederholen Sie den Schritt 14.2.3, bis alle Proben durch die Säule gegangen sind, waschen Sie einmal mit 500 μL Gel-Auflösungspuffer.
    5. 750 μL Waschpuffer (aus Gel-Absaug-Kit) in die Säule geben und bei 17,900 x g für 1 min zentrifuge. Durchlauf von Ablegen, Drehen bei 17,900 x g für 2 min.
    6. Entfernen Sie alle verbleibenden Waschpuffer vom Plastiklila Rand der Säule. Die Luft 2 min trocknen. 12,5 μL kernfreies Wasser in die Mitte der Membran geben. Lassen Sie die Säule 2 min bei Raumtemperatur stehen und drehen Sie bei 17,900 x g für 1 min (Für eine bessere Ausbeute, wiederholen Sie den Elas-Schritt).

15. TOPO Clone von PCR Produkt

  1. Bereiten Sie den TOPO-Klonreaktionsmix vor (1 μL PCR-Produkt aus Schritt 14.2.6; 1 μL Klonen-Mix; 3 μL steriles Wasser). Mischen Sie sanft und inkubieren für 5 min bei 20-37 ° C. Kühl auf Eis.
  2. Thailen Sie chemisch kompetente E. coli-Bakterien auf Eis. Fügen Sie 5 μL des TOPO-Klonerprodukts auf 100 μL von kompetenten Bakterien29 hinzu. Sanft gut mischen. 30 min auf Eis geben.
  3. Hitze-Schock für 60 s bei 42 ° C. Dann 2 min auf Eis abkühlen lassen. 900 μL Lysogeni-Brüder (LB) mittel dazugeben, bei 37 ° C für 1 h inkubieren, bei 225 U/min schütteln. Drehen Sie bei 1.000 x g für 1 min, und dann 900 μL von Supernatant entfernen. Die restliche Lösung wiederbeleben.
  4. Platzieren Sie die umgebauten Bakterien auf 1,5% LB-Bagarplatten, die Ampicillin (100 μg/mL) enthalten, und inkubieren Sie über Nacht bei 37 ° C.
  5. Bereiten Sie für jedes Konstrukt mindestens 20 1,5 mL Zentrifugenrohre vor. Füllen Sie einen Satz mit 500 μL LB-Medium aus, der 100 μg/mL Ampicillin enthält. Verwenden Sie eine sterile Pipettspitze, um eine bakterielle Kolonie nach dem Zufallsprinzip abzukratzen und mit 500 μL LB-Medium zu vermischen (durch Pipettieren). Bei 37 ° C für 5 Stunden in die Höhe treiben und bei 225 U/min schütteln.
  6. Sequenz des Einfügefragments mit dem M13 Reverse-Primer: CAGGAAACAGCTATGAC vonSanger Sequencing 30.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Das eCLIP-Verfahren und die Ergebnisse sind in Abbildung 1, Abbildung 2, Abbildung3, Abbildung4 dargestellt. Die Mäuse wurden mit Kohlendioxid euthaniert und im Unterbauch wurde mit einer chirurgischen Schere (Abbildung 2A,B) ein kleiner Schnitt gemacht. Nach dem Schleifen wurden die Mäusestes entfernt, entkoppelt und dann mitUV-Verbindung verbunden (Abbildung 2C-I). In Abbildung 3 und 4sind repräsentative eCLIP-Ergebnisse der Verwendung von zwei bekannten RNA-bindenden Helicases in Hodengewebe dargestellt. Wir haben MOV10 eCLIP in Testes von erwachsenen Wild-Typ-Mäusen durchgeführt, mit einer gemeinsamen Konzentration von 40 U/mL RNase I, die den vernetzten Lysat behandelt. Die obere Tafel der Abbildung 3A zeigt, dass das Ziel, das etwa 114 kDa groß ist, erfolgreich angereichert wurde. Die Western-Blott der immunentwickelten MOV10L1-Proteine wurde während des eCLIP-Prozesses mit zwei Konzentrationen (5oder 40 U/mL) von RNase I durchgeführt. Abbildung 3B zeigt qPCR mit 1:10 verdünnter cDNA (bereits mit DNA-Adapter liiert) von MOV10 und MOV10L1 UV-vernetzten, nicht-vernetzten, nicht vernetzten und der gepaarten Größe abgestimmten Eingangsunterführung (SMInput). Nicht vernetzte Stichproben zeigen eine verminderte RNA-Erholung. Wir haben beobachtet, dass die Ct-Werte der nicht-vernetzten Gruppe in der Regel 5-mal höher waren als die UV-Kreuzgruppe. Abbildung 4A zeigt die PCR-Verstärkung und die Größenauswahl über die Agura-Gel-Elektrophorese (Schnitt 175-350 bp). Das Primer-Dammer-Produkt erscheint bei ca. 140 bp . Abbildung 4B zeigt die UCSC-Genom-Browseransicht von zwei repräsentativen Subklone-Sequenzen. MOV10-gebundene eCLIP-Tags befinden sich im 3 ' UTR des Gens Fto; Die ungefähre Rate von 3 ' UTR-Zielen beträgt 75% (Abbildung 4C), was mit der Mehrheit der MOV10-Ziele in HEK293 -Zellen 10 und in Testes (Daten nicht abgebildet) übereinstimmt. Im Gegensatz dazu finden sich MOV10L1-gebundene eCLIP-Tags in einem PiRNA-Cluster, der MOV10L1-Ziele für piRNA-Vorläufer anzeigt. Die ungefähre Rate der piRNA-Vorläuferziele beträgt 42% (Abbildung 4E), was einen Trend aus unserem bisherigen konventionellen CLIP-Experiment20widerspiegelt. MOV10L1 eCLIP mit 40 U/mL RNase I Verdauung ergibt relativ mehr Sequenzen mit weniger als 20 bp (Abbildung 4D).

Figure 1
Bild 1 : Schematische Darstellung von eCLIP. UV-vernetzte Maus-Seminifere-Röhrchen (Schritt 1) sind in eCLIP-Lysepuffer und klangvoll (Schritt 2) lysisch. Lysate wird mit RNase I behandelt, um RNA zu fragmentieren, danach werden Protein-RNA-Komplexe mit dem Anti-RBP-Antikörper immunoptiert (Schritt 3-4). Die Entfracht von RNA-Fragmenten und die Ligation von 3 ' RNA-Adapter werden durchgeführt (Schritt 5-6). Protein-RNA-Komplexe werden auf einem SDS-PAGE-Gel betrieben und auf Nitrocellulose-Membranen übertragen (Schritt 7). Die RNA wird aus der Membran gewonnen, indem das Protein mit Proteinase K und Urea verdaut wird, wodurch ein kurzes Polypeptid an der Kreuzung verbleibt. Die Entfracht von RNA-Fragmenten von Eingangsproben und der Ligation von 3 ' RNA-Adapter wird durchgeführt (Schritt 8). Führen Sie RT der RNA und Ligation von 3 "DNA-Adapter (Schritt 9-10). Führen Sie die PCR-Verstärkung der cDNA-Bibliothek, der Gel-Extraktion und des absteuerten PCR-Klonens zur vorläufigen Qualitätskontrolle der Bibliothek durch (Schritt 11). Schließlich eine Hochdurchsatzsequenzierung durchführen (Schritt 12). Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.

Figure 2
Bild 2 : Testis Gewebeernte und UV-Vernetzung. (A) Die Belichtung des Mausbaus. (B) Ein 0,5 cm langer Schnitt in der Bauchwand, der das Peritoneum freisetzt. (C) Ein paar Hoden werden herausgenommen, indem man die Fettpolster herauszieht. D) Testisches Gewebe wird entfernt und in eine kleine Schüssel mit eiskaltem PBS gelegt. (E) Die Tunica albuginea sanft entfernen. F) Drücken Sie den losen Stempel, um das Gewebe in einem Gewebeschleifer zu triturieren. (G) In einer 10 cm großen Platte verteilte, seminferische Röhrchen verteilen. (H) UV-Vernetzung mit 400 mJ/cm 2 Energie. (I) Die vernetzten Proben werden in 1,5 mL Zentrifugenrohren gesammelt. Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.

Figure 3
Bild 3 : Repräsentative Ergebnisse von MOV10 und MOV10L1 eCLIP. (A) Western-Blot-Validierung von MOV10 und MOV10L1-Immunsystemen. (B) qPCR auf 1:10 verdünnte eCLIP-Bibliotheken von MOV10 und MOV10L1, mit Replikaten für UV, Nicht-UV und die gepaarten SMInput-Samples. Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.

Figure 4
Bild 4 : eCLIP-Bibliotheksvorbereitung und Qualitätsbewertung. (A) Die Gel-Bilder der PCR-Verstärkung werden gezeigt. Sternchen deutet auf Primer dimer. Die rote gestrichelte Linie zeigt Regionen an, die für PCR-Produkt von cDNA exzessiv sind, irgendwo zwischen 175 und 350 bp. (B) UCSC-Genom-Browseransicht von zwei repräsentativen Subklone-Sequenzen 31. (C) Small-scale subclone Sequenzierung Analyse von MOV10. (D) MOV10L1-gebundene Tags zeigen unterschiedliche Muster der Längenverteilung, wenn sie von zwei verschiedenen RNase-Konzentrationen verarbeitet werden. (E) Small-scale subclone Sequenzierung Analyse von MOV10L1. Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.

Sequenzname Sequenzinformationen die Beschreibung
RNA-Adapter
RNA X1A /5Phos/AUAGGNNNNNNNNNNNAGAUCGGAAGAGCGUGUAG/3SpC3/ Bestand bei 200 μM; Arbeiten bei 20 μM
RNA X1B /5Phos/AAUAGCANNNNNNNNNAGAUCGGAAGCGUGUAG/3SpC3/ Bestand bei 200 μM; Arbeiten bei 20 μM
RiL19 /5phos/AGAUCGGAAGCGUCGUG/3SpC3/ Bestand bei 200 μM; Arbeiten bei 40 μM
DNA-Adapter
Rand103tr3 /5Phos/NNNNNNNNNNNNNNAGATCGGAAGAGCACGTCTG/3SpC3/ Bestand bei 200 μM; Arbeiten bei 80 μM
RT-Primer
AR17 ACACGACGCTCTTCCGA Bestand bei 200 μM; Arbeiten bei 20 μM
PCR-Primer

PCR-F-D 501
AATGATACGGGGGG-GACCGAGATCTACTATAGCCTACACTCTTTCCCTACGACGCTCTTCCGATCT Bestand bei 100 μM; Arbeiten bei 20 μM
PCR-R-D 701 CAAGAAGAAGACGGCATACGAGATCGAGATCGAGTAATGTGACTGGAGACGTGTGCTCTTCCGATC Bestand bei 100 μM; Arbeiten bei 20 μM
(Siehe Illumina Kundendienstbrief für D502-508, D702-712)

Tabelle 1: Adapter und Primer-Sequenzen. Der Adapter enthält einen Inline-Zufallsgenerator (entweder N5 oder N10), um festzustellen, ob zwei identische sequenzierte Lesezeichen zwei einzigartige RNA-Fragmente oder PCR-Duplikate desselben RNA-Fragments anzeigen. "5 Phos" steht für 5 ' Phosphorylierung, die benötigt wird, wenn ein Oligo als Substrat für die DNA/RNA-Ligase verwendet wird. "3SpC3" steht für 3 ' C3 Spacer, der die Ligation zwischen Adaptern verhindern kann.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Mit zunehmendem Verständnis der universellen Rolle von RBPs unter biologischen und pathologischen Kontexten wurden die CLIP-Methoden weit verbreitet eingesetzt, um die molekulare Funktion der RBPs 20,32,33zu zeigen. 34,35. Das hier beschriebene Protokoll stellt eine angepasste Anwendung der eCLIP-Methode auf Mäusehausweise dar.

Eine Herausforderung bei der Durchführung von eCLIP in Hoden ist die Aufrechterhaltung der Lebensfähigkeit und Integrität von frischen Hodenzellen, die auch für eine effektive Vernetzung wichtig ist. Das Scheren des Hoden mit leichter mechanischer Kraft mit dem losen Stachel kanndieZelllyse 32,36verhindern. Die richtige Verdauung der RNA ist auch für erfolgreiche eCLIP-TAssays von entscheidender Bedeutung. RNA-Fragmente könnten nach der Verdauung konvergenenter sein, aber Länge von weniger als 20 bp kann über die Vorverarbeitung der Bibliothekslesungen entfernt werden. Um eine ideale RNase-Dosierung für einen RBP-Kandidaten zu übernehmen, schlagen wir einen vorläufigen Test vor, der auf den Ergebnissen der Subclone-Sequenzierung von eCLIP-Bibliotheken basiert, die durch eine RNase-Behandlung mit Konzentrationen von 0 bis 40 U (pro Milliliter Lysat) vorbereitet werden können. Die kleinformatige Subklon-Sequenzierungsanalyse ist ein empfehlenswerter Schritt für eine zuverlässige Prüfung der Bibliotheksqualität in unserer eCLIP-Methode. Erstens sollte der Anteil der Einfügungen, die kleiner als 20 bp sind, nicht zu hoch sein, oder die anschließende Vorverarbeitung der eCLIP-Bibliothek wird zu einem kostspieligen Verlust von Lesungen führen. Zweitens sollte die Effizienz der korrekten Ligation beider Adapter überprüft werden. Substandardproben können ohne Tiefensequenzierung eliminiert werden, um eine erfolgreiche Tiefsequenzierung zu gewährleisten, deren Ergebnisse in der Regel viel länger dauern, um sie zu analysieren.

Obwohl die Machbarkeit von eCLIP in Mäusebarden durch die Spezifität des Antikörpers für den Schritt der Immunoptivierung noch eingeschränkt ist, ist eCLIP in mehrfacher Hinsicht vorteilhaft gegenüber herkömmlichen CLIP-Methoden. Erstens handelt es sich um eine nicht radioaktive Methode. Durch eCLIP werden RNA-Ziele von RBPs direkt in vivo erfasst, ohne dass sie auf arbeitsintensive Techniken mit radioaktiven Materialien zurückgreifen müssen. Zweitens: Die Methode ist weniger zeitintensiv. Die gesamte Prozedur dauert nur 4 Tage durch die eCLIP-Bibliotheksvorbereitung. Drittens, Sequenz-Vielfalt. Im Vergleich zum herkömmlichen, einheitlichen Verstärkungszyklus von 25-35 Zyklen bezieht sich eCLIP auf Ct-Werte von qPCR, um die Anzahl der PCR-Zyklen speziell festzulegen. Schließlich bietet sie ein stärkeres Signal-Rauschen-Verhältnis. Der mit Größe abgestimmte Input dient als geeigneter Hintergrund für authentische Ziele.

Zusammenfassend lässt sich sagen, dass unsere eCLIP-Ergebnisse die Schlussfolgerungen daraus ziehen, dass MOV10 und MOV10L1 eine verbindliche Präferenz gegenüber mRNA 3 ' UTR und piRNA-Vorläufern haben. Das Protokoll, das wir hier beschrieben haben, stellt die erste Anwendung der eCLIP-Methode in der Fortpflanzung dar, einem Bereich, in dem RNA-RBP-Interaktionswissen eher unzureichend ist, obwohl genetische Studien reichlich Informationen über die biologische Rolle von Die Visualisierung dieses eCLIP-Protokolls kann dabei helfen, seine weit verbreiteten Anwendungen in breiteren Bereichen zu lenken.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Die Autoren haben nichts zu offenbaren.

Acknowledgments

Wir danken Eric L Van Nostrand und Gene W Yeo für die hilfreiche Anleitung mit dem Originalprotokoll. K.Z. wurde unterstützt von National Key R & D Program of China (2016YFA0500902, 2018YFC1003500) und der National Natural Science Foundation of China (31771653). L.Y. wurde von der National Natural Science Foundation of China (81471502, 31871503) und dem Innovativen und unternehmerischen Programm der Provinz Jiangsu unterstützt.

Materials

Name Company Catalog Number Comments
Antibodies
Anti-mouse MOV10  antibody Proteintech, China 10370-1-AP
Anti-mouse MOV10L1 antibody Zheng et al.20109 polyclonal antisera UP2175 provided by P. Jeremy Wang lab, University of Pennsylvania
HRP Goat Anti-Rabbit IgG  ABclonal AS014
Rabbit IgG Beyotime, China A7016
Equipment
Centrifuge Eppendorf, Hamburg, Germany 5242R
Digital sonifier BRANSON,USA BBV12081048A 450 Watts; 50/60 Hz
DynaMag-2 Magnet Invitrogen,USA 12321D
Mini Blot Module Invitrogen,USA B1000
Mini Gel Tank Invitrogen,USA A25977
Shaking incubator Eppendorf, Hamburg, Germany Thermomixer comfort 
Tissue Grinder, Dounce PYREX, USA 1234F35 only  the "loose" pestle is used in this protocol
TProfessional standard 96 Gradient Biometra, Germany serial no.: 2604323
Tube Revolver  Crystal, USA serial no.: 3406051
UV-light cross-linker UVP, USA CL-1000
Materials
TC-treated Culture Dish Corning, USA 430167 100 mm 
Tubes Corning, USA 430791 15 mL
Microtubes tubes AXYGEN , USA MCT-150-C 1.5 mL 
Reagents 
Acid phenol/chloroform/isoamyl alcohol  Solarbio, China P1011 25:24:01
AffinityScript Enzyme Agilent, USA 600107
Antioxidant Invitrogen,USA NP0005
DH5α competent bacteria Thermo Scientific, USA 18265017 these economical cells yield >1 x 106 transformants/µg control DNA per 50 µL reaction.
DMSO Sigma-Aldrich, USA D8418
DNA Ladder Invitrogen, USA 10416014
dNTP Sigma-Aldrich, USA DNTP100-1KT
Dynabeads Protein A  Invitrogen, USA 10002D
ECL reagent Vazyme, China E411-04
EDTA Invitrogen, USA AM9260G
EDTA free protease inhibitor cocktail Roche, USA 04693132001 add fresh
Exo-SAP-IT Affymetrix, USA 78201 PCR Product Cleanup Reagent 
FastAP enzyme Thermo Scientific, USA EF0652
LDS Sample Buffer Thermo Scientific, USA NP0007
MetaPhor Agarose  lonza, Switzerland 50180
MgCl2 Invitrogen, USA AM9530G
MiniElute gel Extraction QIAGEN, Germany 28604 column store at 4 ?; buffer QG=gel dissolving buffer; buffer PE= wash buffer(for step 14)
MyONE Silane beads Thermo Scientific, USA 37002D nucleic acids extraction magnetic beads
NaCl Invitrogen,USA AM9759
 
NP-40 Amresco, USA M158-500ML
NuPAGE Bis-Tris Protein Gels Invitrogen, USA NP0336BOX 4%–12%,1.5 mm, 15-well
NuPAGE MOPS SDS Buffer Kit  Invitrogen, USA NP0050
PBS Gibco, USA 10010023
Phase-Locked Gel (PLG) heavy tube   TIANGEN, China WM5-2302831
PowerUp SYBR Green Master Mix Applied Biosystems, USA A25742
Proteinase K NEB, New England  P8107S
Q5 PCR master mix  NEB, New England  M0492L
RLT buffer QIAGEN, Germany 79216 RNA purification lysis buffer 
RNA Clean & Concentrator-5 columns  ZYMO RESEARCH, USA R1016 RNA purification and concentration columns
RNase I  Invitrogen, USA AM2295
RNase Inhibitor Promega, USA N251B
RQ1 DNase Promega,USA M610A
Sample Reducing Agent Invitrogen,USA NP0009
SDS Solution Invitrogen, USA 15553027 10%
Sodium deoxycholate Sigma-Aldrich, USA 30970 protect from light
T4 PNK enzyme NEB, New England  M0201L
T4 RNA ligase 1 high conc NEB, New England  M0437M
TA/Blunt-Zero Cloning Mix Vazyme, China C601-01
TBE Invitrogen,USA AM9863
Tris-HCI Buffer Invitrogen, USA 15567027
Triton X-100 Sangon Biotech, China A600198 
Tween-20 Sangon Biotech, China A600560
Urea Sigma-Aldrich, USA U5378
X-ray Films Caresteam, Canada 6535876

DOWNLOAD MATERIALS LIST

References

  1. Turner, J. M., Mahadevaiah, S. K., Ellis, P. J., Mitchell, M. J., Burgoyne, P. S. Pachytene asynapsis drives meiotic sex chromosome inactivation and leads to substantial postmeiotic repression in spermatids. Developmental Cell. 10, (4), 521-529 (2006).
  2. Turner, J. M. A. Meiotic sex chromosome inactivation. Development. 134, (10), 1823-1831 (2007).
  3. Kimmins, S., Sassone-Corsi, P. Chromatin remodelling and epigenetic features of germ cells. Nature. 434, (7033), 583-589 (2005).
  4. Ule, J., et al. CLIP identifies Nova-regulated RNA networks in the brain. Science. 302, (5648), 1212-1215 (2003).
  5. Ule, J., Jensen, K., Mele, A., Darnell, R. B. CLIP: a method for identifying protein-RNA interaction sites in living cells. Methods. 37, (4), 376-386 (2005).
  6. Trifillis, P., Day, N., Kiledjian, M. Finding the right RNA: identification of cellular mRNA substrates for RNA-binding proteins. RNA. 5, (8), 1071-1082 (1999).
  7. Tenenbaum, S. A., Carson, C. C., Lager, P. J., Keene, J. D. Identifying mRNA subsets in messenger ribonucleoprotein complexes by using cDNA arrays. Proceedings of National Acadamy of Sciences U S A. 97, (26), 14085-14090 (2000).
  8. Chi, S. W., Zang, J. B., Mele, A., Darnell, R. B. Argonaute HITS-CLIP decodes microRNA-mRNA interaction maps. Nature. 460, (7254), 479-486 (2009).
  9. Zheng, K., et al. Mouse MOV10L1 associates with Piwi proteins and is an essential component of the Piwi-interacting RNA (piRNA) pathway. Proceedings of National Acadamy of Sciences U S A. 107, (26), 11841-11846 (2010).
  10. Gregersen, L. H., et al. MOV10 Is a 5' to 3' RNA helicase contributing to UPF1 mRNA target degradation by translocation along 3' UTRs. Molecular Cell. 54, (4), 573-585 (2014).
  11. Banerjee, S., Neveu, P., Kosik, K. S. A coordinated local translational control point at the synapse involving relief from silencing and MOV10 degradation. Neuron. 64, (6), 871-884 (2009).
  12. Choi, J., Hwang, S. Y., Ahn, K. Interplay between RNASEH2 and MOV10 controls LINE-1 retrotransposition. Nucleic Acids Research. 46, (4), 1912-1926 (2018).
  13. Goodier, J. L., Cheung, L. E., Kazazian, H. H. Jr MOV10 RNA helicase is a potent inhibitor of retrotransposition in cells. PLoS Genetics. 8, (10), e1002941 (2012).
  14. Haussecker, D., et al. Capped small RNAs and MOV10 in human hepatitis delta virus replication. Nature Structural & Molecular Biology. 15, (7), 714-721 (2008).
  15. Kenny, P. J., et al. MOV10 and FMRP regulate AGO2 association with microRNA recognition elements. Cell Reports. 9, (5), 1729-1741 (2014).
  16. Messaoudi-Aubert, S. E., et al. Role for the MOV10 RNA helicase in Polycomb-mediated repression of the INK4a tumor suppressor. Nature Structural & Molecular Biology. 17, (7), 862-868 (2010).
  17. Sievers, C., Schlumpf, T., Sawarkar, R., Comoglio, F., Paro, R. Mixture models and wavelet transforms reveal high confidence RNA-protein interaction sites in MOV10 PAR-CLIP data. Nucleic Acids Research. 40, (20), e160 (2012).
  18. Skariah, G., et al. Mov10 suppresses retroelements and regulates neuronal development and function in the developing brain. BMC Biology. 15, (1), 54 (2017).
  19. Zheng, K., Wang, P. J. Blockade of pachytene piRNA biogenesis reveals a novel requirement for maintaining post-meiotic germline genome integrity. PLoS Genetics. 8, (11), e1003038 (2012).
  20. Vourekas, A., et al. The RNA helicase MOV10L1 binds piRNA precursors to initiate piRNA processing. Genes & Development. 29, (6), 617-629 (2015).
  21. Hocq, R., Paternina, J., Alasseur, Q., Genovesio, A., Le Hir, H. Monitored eCLIP: high accuracy mapping of RNA-protein interactions. Nucleic Acids Research. 46, (21), 11553-11565 (2018).
  22. Huppertz, I., et al. iCLIP: protein-RNA interactions at nucleotide resolution. Methods. 65, (3), 274-287 (2014).
  23. Hafner, M., et al. Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 141, (1), 129-141 (2010).
  24. Hafner, M., et al. PAR-CliP--a method to identify transcriptome-wide the binding sites of RNA binding proteins. Journal of Visualized Experiments. (41), (2010).
  25. Konig, J., et al. iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nature Structural & Molecular Biology. 17, (7), 909-915 (2010).
  26. Konig, J., et al. iCLIP--transcriptome-wide mapping of protein-RNA interactions with individual nucleotide resolution. Journal of Visualized Experiments. (50), (2011).
  27. Maticzka, D., Ilik, I. A., Aktas, T., Backofen, R., Akhtar, A. uvCLAP is a fast and non-radioactive method to identify in vivo targets of RNA-binding proteins. Nature Communications. 9, (1), 1142 (2018).
  28. Van Nostrand, E. L., et al. Robust transcriptome-wide discovery of RNA-binding protein binding sites with enhanced CLIP (eCLIP). Nature Methods. 13, (6), 508-514 (2016).
  29. Radulovich, N., Leung, L., Tsao, M. S. Modified gateway system for double shRNA expression and Cre/lox based gene expression. BMC Biotechnology. 11, 24 (2011).
  30. Breunig, C. T., et al. A Customizable Protocol for String Assembly gRNA Cloning (STAgR). Journal of Visualized Experiments. (142), (2018).
  31. Kuhn, R. M., Haussler, D., Kent, W. J. The UCSC genome browser and associated tools. Briefings in Bioinformatics. 14, (2), 144-161 (2013).
  32. Vourekas, A., et al. Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis. Nature Structural & Molecular Biology. 19, (8), 773-781 (2012).
  33. Preitner, N., et al. APC is an RNA-binding protein, and its interactome provides a link to neural development and microtubule assembly. Cell. 158, (2), 368-382 (2014).
  34. Meyer, C., et al. The TIA1 RNA-Binding Protein Family Regulates EIF2AK2-Mediated Stress Response and Cell Cycle Progression. Molecular Cell. 69, (4), 622-635 (2018).
  35. Gerstberger, S., Hafner, M., Tuschl, T. A census of human RNA-binding proteins. Nature Reviews Genetics. 15, (12), 829-845 (2014).
  36. Vourekas, A., Mourelatos, Z. HITS-CLIP (CLIP-Seq) for mouse Piwi proteins. Methods in Molecular Biology. 1093, 73-95 (2014).
Verbesserte Vernetzung der Immunoptierungsmethode (eCLIP) zur effizienten Identifizierung der proteingebundenen RNA in Mäusetestis
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Xu, Q., Wang, C., Ling, L., Yue, Q., Liu, M., Zhang, S., Fu, K., Ye, L., Zheng, K. Enhanced Crosslinking Immunoprecipitation (eCLIP) Method for Efficient Identification of Protein-bound RNA in Mouse Testis. J. Vis. Exp. (147), e59681, doi:10.3791/59681 (2019).More

Xu, Q., Wang, C., Ling, L., Yue, Q., Liu, M., Zhang, S., Fu, K., Ye, L., Zheng, K. Enhanced Crosslinking Immunoprecipitation (eCLIP) Method for Efficient Identification of Protein-bound RNA in Mouse Testis. J. Vis. Exp. (147), e59681, doi:10.3791/59681 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter