Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Biology

משופרת Crosslinking Immunoprecipitation (eCLIP) שיטה לזיהוי יעיל של רנ א חלבון מאוגד ב העכבר בתוך הראש

doi: 10.3791/59681 Published: May 10, 2019
* These authors contributed equally

Summary

כאן, אנו מציגים פרוטוקול eCLIP כדי לקבוע מטרות של RNA הגדולות של מועמדים RBP בתוך בנות.

Abstract

הזרע מגדיר תהליך מאוד מסודר של הבחנה של תא נבט זכר ביונקים. בתוך הראש, התמלול והתרגום אינם מצמידים, מפנים את החשיבות של בקרת הגנים שלאחר ההמרה של הביטוי הגנטי שאורגן על ידי RBPs. כדי להבהיר תפקידים מכניסטיים של RBP, מתודולוגיית immunoprecipitation מקשרת (CLIP) ניתן להשתמש כדי ללכוד מטרות ה-RNA הישיר שלה ולהגדיר את אתרי האינטראקציה בפועל. ה-CLIP המשופר (eCLIP) הוא שיטה שפותחה לאחרונה ומציעה מספר יתרונות על פני הקליפים הקונבנציונליים. עם זאת, השימוש ב-eCLIP הוגבל עד כה לקווי תאים, הקורא ליישומים מורחבים. כאן, העסקנו eCLIP ללמוד MOV10 ו MOV10L1, שני ידוע האליסים מחייב RNA, בתוך ביקורות העכבר. כצפוי, אנו מוצאים כי MOV10 בעיקר נקשר ל 3 ' אזורים בלתי מתורגמים (UTRs) של mRNA ו MOV10L1 בררנית נקשר Piwi-אינטראקציה RNA (piRNA) התעתיקים הקודמי. שיטת ה-eCLIP שלנו מאפשרת הגדרה מהירה של מינים מרכזיים של RNA המאוגדים על ידי RBPs שונים באמצעות רצף בקנה מידה קטן של תת-שיבוטים ובכך זמינות של ספריות מאושרות, כצו להליך ברצף עמוק. מחקר זה מבסס את הבסיס הרלוונטי ל-eCLIP בתוך בנות היונקים.

Introduction

התמיינות של מיונקים מייצגים מודל התפתחותי מעולה שבו תוכנית בידול התא מסובכים מפעילה מחזוריות להניב מספר רב של זרע. ערך ייחודי של מודל זה טמון הופעתה של הפעלה החוצה בשלבים מסוימים של הזרע, בדרך כלל כאשר כרומוזום הסקס meiotic הפעלה (msci) מתרחש1,2 וכאשר מסתובבים spermatogenesis קיצוני מדחס גרעיני במהלך spermiogenesis3. האירועים הללו ברציפות מחייבים את התקנה לאחר ההמרה של הגנים, שבו ה-RNA-כריכת חלבונים (RBPs) לשחק תפקיד מכריע, עיצוב הטרנססקריפט ושמירה על פוריות הגבר.

כדי לזהות את מטרות ה-RNA בתום בודד של rbp הפרט ב-vivo, השיטה מרובי קישור immunoprecipitation (קליפ) פותחה4,5, על בסיס אבל מעבר RNA רגיל immunoprecipitation (RIP)6,7 , על ידי שילוב של שלבים מרכזיים כולל אולטרה סגול (UV) הקישור, לשטוף מחמירים ולהעביר ג'ל כדי לשפר את האות ספציפיות. היישום המתקדם של ה-CLIP בשילוב עם רצף תפוקה גבוהה עורר עניין רב ביצירת פרופיל של אינטראקציה חלבון-RNA ברמותהגנום-שמונה. בנוסף למחקרים גנטיים על הפונקציה RBP, כגון שיטות ביוכימיים המזהות את הגומלין הישיר של חלבון אנדוסוגני ו-RNA היו הכרחי כדי להבהיר במדויק את תפקידי הרגולציה של ה-RNA של Rbp. לדוגמה, MOV10L1 הוא הליקאז RNA הספציפי ביותר הנדרש עבור פוריות הגברי ו-Piwi-אינטראקציה RNA (piRNA) biogenesis9. Paralogue MOV10 שלה הוא ידוע בתור אוביקוויל rna הליקאז ו משולבות עם תפקידים בהיבטים רבים של ביולוגיה rna10,11,12,13,14 , מיכל בן 15 , מיכל בן 16 , מיכל בן 17 , 18. על ידי העסקת קליפ קונבנציונאלי-seq, מצאנו כי MOV10L1 נקשר ומסדיר pirna הראשונית מראש כדי ליזום עיבוד pirna מוקדם19,20, וכי MOV10 נקשר mrna 3 ' utrs ו כמו גם שאינם קידוד RNA מינים בתאי נבט האשכים (נתונים לא מוצגים).

עם זאת, CLIP הוא במקור הליך מפרך ורדיואקטיבי ואחריו הכנה לספריות ברצף עם אובדן מרשים של תגי CLIP. ב-CLIP המקובל, ספריית cDNA מוכנה באמצעות מתאמים משני הקצוות של RNA. לאחר עיכול החלבון, polypeptides קצרים קצר להישאר מקושרים שברי RNA. מארק זה מקשר באופן חלקי בלוקים לאחור טרנססקריפט (התקדמות) במהלך סינתזה cdna, וכתוצאה מכך cdnas המייצגים כ 80% של ספריית cdna21,22. כך, רק שברי cDNA הנובע RTase בורסה עוקף את האתר המקשר (קריאה-דרך) הם ברצף. לאחרונה, מספר הגישות השונות של CLIP, כגון PAR-קליפ, iCLIP, eCLIP ועובדה, מועסקים כדי לזהות אתרים מרובי קישורים של RBPs בתאי החיים. PAR-CLIP כולל את היישום של 365 ננומטר קרינת UV ו-photoהפעלות מקבילים והוא ולכן בלעדית לתאי החיים בתוך-culturing, והתאגדות של האנלוגיות של נוקלאוטיד לתוך תעתיקים מסונתז החדש נוטה לייצר הטיה כאשר RNA אינטראקציה פיזית עם חלבון23,24. ב-iCLIP, רק מתאם יחיד מחובר ל -3 הגפיים של קטעי RNA מקושרים. לאחר תמלול הפוכה (RT), שניהם מעוגלים ולקרוא על-ידי cdnas מתקבלים על ידי מעגליות ולינריזציה מחדש ואחריו תגובת שרשרת פולימראז (PCR) הגברה25,26. עם זאת, היעילות של מעגליות מולקולארית היא נמוכה יחסית. למרות שפרוטוקולי קליפ ישנים יותר זקוקים לתיוג של RNA מקושר עם רדיואיזוטופ, אולטרה-סגול מקשר וטיהור אהדה (למחוא כף), עם תהליך של טיהור דו-מושביים מחמירים, אינו מסתמך על רדיואקטיביות27. אף על פי כן, עובדה מוגבלת לתאים מתורבתים שחייבים להיות מצוידים עם וקטור הביטוי נושאת 3x דגל-HBH תג עבור טיהור האהדה הדו.

ב eCLIP, המתאמים היו ליגלו הראשון ב 3 ' הגפיים של RNA ואחריו RT, ובהמשך ב 3 ' הגפיים של cDNAs במצב הבין-מולקולרי. מכאן, eCLIP מסוגל ללכוד את כל מעוגלים ולקרוא ב-cDNA28. גם, זה לא מוגבל תיוג רדיואקטיבי, וגם לא באמצעות קווי התאים המבוססים על העיקרון שלה, תוך שמירה על הרזולוציה יחיד-נוקלאוטיד.

כאן, אנו מספקים תיאור צעד אחר צעד של פרוטוקול eCLIP המותאם לגבי בעלי העכבר. בקצרה, זה הפרוטוקול eCLIP מתחיל עם מרובי UV המקשר של tubules האשכים, ואחריו העיכול חלקית RNase ו immunoprecipitation באמצעות נוגדן ספציפי חלבון. לאחר מכן, ה-RNA המאוגד לחלבון הוא בדיזאט, והמתאם מוגבל לקצה של שלושת האחרים. לאחר אלקטרופורזה ג'ל חלבונים ו ג'ל ל-ממברנה העברה, RNA מבודד על ידי חיתוך אזור הקרום של טווח בגודל צפוי. לאחר RT, מתאם DNA הוא ליגאל הקצה 3 ' של cDNA ואחריו הגברה PCR. הקרנה של תת-שיבוטים לפני רצף התפוקה הגבוהה נלקח כבקרת איכות בספרייה. פרוטוקול זה יעיל בזיהוי מינים עיקריים של רנ א חלבון מאוגד של RBPs, לידי ביטוי על ידי שתי הטיות ביטוי RNA האליסים MOV10L1 ו MOV10.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

כל ניסויים בבעלי חיים אושרו על ידי ועדת נאנג'ינג באוניברסיטה הרפואית. זכר C57BL/6 עכברים נשמרו תחת התנאים photoperiod נשלט וסופקו עם מזון ומים.

1. קצירת רקמות ומקרוקישור UV

  1. המתת חסד 2 עכברים מבוגרים באמצעות פחמן דו חמצני (CO2) עבור 1-2 דקות או עד עצירת נשימה. הבא, לבצע פריקה צוואר הרחם על כל עכבר.
  2. הקציר על 100 מ ג של אשכים מעכברים בגיל המתאים (אחד ביקורות בוגרים במחקר זה) עבור כל ניסוי immunoprecipitation, ולמקם את הרקמות בקרח קר פוספט מלוחים באגירה (PBS).
  3. הסירו את האלבומין בעדינות עם זוג מלקחיים משובחים.
  4. הוסיפו 3 מ ל של PBS קר קרח במטחנה רקמה וטריטוראט את הרקמה על ידי כוח מכני מתון באמצעות כתש זכוכית רופף (סוג של זכוכית).
    הערה: מטרת השלב הזה היא לא להוציא תאים, אלא להפריד את הרקמה. שימור הכדאיות התאית והיושרה חשוב.
  5. העבר את השעיית הרקמה לצלחת תרבות תא (10 ס מ בקוטר) והוסף PBS קר הקרח עד 6 מ ל.
  6. טלטל את הצלחת במהירות כך שהנוזל יכסה את תחתית המנה באופן שווה. אם הרקמה היא הקרקע כראוי, מופץ באופן שווה tubules מבוזרים יהיה גלוי, בעוד נוכחות של גושים רקמה מציין כי פיזור הרקמה היא תת אופטימלית.
  7. Crosslink את ההשעיה שלוש פעמים עם 400 mJ/cm2 ב 254 ננומטר על הקרח. מערבבים השעיה בין כל הקרנה.
    הערה: עבור כל ניסוי חדש, הקשר החוצה צריך להיות מיטבי.
  8. לאסוף את ההשעיה של 15 מ"ל שפופרת חרוטי ו גלולה ב 1,200 x g עבור 5 דקות ב 4 ° c. הסר את הסופרנטאנט, השהה מחדש את הגלולה ב 1 מ ל של PBS ולאחר מכן העבר את ההשעיה לשפופרת צנטריפוגה 1.5 mL. ספין ב 4 ° צ' ו 1,000 x g עבור 2 דקות, ולהסיר supernatant.
  9. בשלב זה, להמשיך מיד עם שאר הפרוטוקול, או להקפיא את כדורי בחנקן נוזלי ולאחסן ב-80 ° צ' עד השימוש.

2. הכנת חרוזים

  1. הוסף 125 μL של חלבון חרוזים מגנטיים לכל מדגם (גלולה) לשפופרת צנטריפוגה טרייה.
    הערה: השתמש בחרוזי חלבון G מגנטיים עבור נוגדנים לעכבר.
  2. מניחים את הצינור על המגנט כדי להפריד את החרוזים מהפתרון. , אחרי 10 ס מ. הסר את הסופרנטאנט לשטוף חרוזים פעמיים עם 1 מ ל של מאגר לפירוק קרח קר.
    הערה: הפרדת החלבון לאחר מכן חרוזים מגנטיים משלבים את השלב הזה. מאגר לליזה הרכב הוא 50 mM טריס-HCl, pH 7.5; 100 מ"מ; 1% NP-40; 0.1% SDS; 0.5% נתרן המרה; 1/50 אטייילאדיאמיאמארבחומצה (EDTA)-מעכב פרוטאז חינם קוקטייל (להוסיף טריים).
  3. השעיה מחדש חרוזים ב 100 μL של מאגר לפירוק קר עם הנוגדן 10 μg eCLIP. לסובב צינורות בטמפרטורת החדר עבור 45 דקות.
    הערה: ריכוז הנוגדן הסופי עבור immunoprecipitation הוא 10 μg/mL. אם ריכוז נוגדן אינו ידוע, כמות הנוגדן צריך להיות ממוטב.
  4. לשטוף חרוזים פעמיים עם 1 מ ל של מאגר לפירוק קרח קר.

3. הליזה רקמה ועיכול חלקי RNA

  1. השעיה מחדש של כדורי רקמת 1 מ ל של מאגר לפירוק קר (להוסיף 22 μL של 50x (EDTA)-מעכב חלבון חינם קוקטייל 11 μL של מעכב RNase 1 mL של מאגר לליזה).
    1. השהה מחדש שתי כדורי UV-crosslinked קושרים ושתי כדורי בלתי מקושרים לקבוצה של ניסויים: UV-crosslinked קושרים-1 כדורי עבור ספריית eCLIP (UV-1); UV-crosslinked קושרים-2 כדורי עבור ספריית eCLIP (UV-2); כדורי לא-מקושרות 1 עבור ספריית eCLIP כפקד (לא UV); כדורי לא-crosslinked 2 עבור IgG IP כדי להדגים את הספציפיות של נוגדנים.
      הערה: השליטה האידיאלית עבור הספריה eCLIP של האשכים מסוג UV-crosslinked הוא זה של האשכים מקושרים UV-crosslinked עכברים של אותו הזבל.
  2. המשיכו לשיר את הדגימות על הקרח במשך 15 דקות (כדי למנוע השפלה של חלבונים ו-RNA).
  3. Sonicate ב sonicator דיגיטלי ב 10% משרעת עבור 5 דקות, ב 30 s על/30 s off. תמיד למקם את המדגם על הקרח ולנקות את החללית עם nuclease-מים חינם בין כל דוגמה.
  4. הוסף 4 μL של DNase לכל צינורית, וערבב היטב. מודטה עבור 10 דקות ב 37 ° c, רועד ב 1,200 סל ד.
  5. הוסף 10 μL של מדולל RNase I (4 U/μL RNase אני ב PBS), ומערבבים היטב. מודטה עבור 5 דקות ב 37 ° c, רועד ב 1,200 סל ד.
  6. נקה את הליפוסט על ידי צנטריפוגה ב 15,000 x g עבור 20 דקות (ב 4 ° c).
  7. בזהירות לאסוף את סופרנטנט. השאר 50 μL של ליפוסט ולהשליך את הגלולה עם זה.
  8. שמור דגימות תשומות כ- Rwb (הפעלה לאבן חשופה מערבית) ו- rwb (הפעלה עבור בידוד RNA). שמור 20 μL (2%) של UV-1, UV-2, non-UV ו-IgG דגימות כקלט עבור טעינת RWB ג'ל. שמור 20 μL (2%) של UV-1 או UV-2 דגימות כתשומות לטעינת RRI ג'ל.

4. Immunoprecipitation

  1. הוסיפו 1 מ ל של הליפוסט (משלב 3.7) לחרוזים (המוכנים בסעיף 2) וסובבו את הדגימות ב -4 ° c עבור 2 או למשך הלילה.
  2. לאסוף את החרוזים עם עמדה מגנטית ולהשליך את supernatant. לשטוף את החרוזים פעמיים עם 900 μL של מאגר מלח גבוה (50 mM טריס-HCl, pH 7.5; 1 M היום; 1 מ"מ EDTA; 1% NP-40; 0.1% SDS; 0.5% נתרן המרה), ולאחר מכן לשטוף חרוזים פעמיים עם 900 μL של כביסה מאגר (20 מ"מ טריס-HCl, pH 7.5; 10 מ"מ MgCl2; 0.2 x רצף-20).
    הערה: עבור הדוגמה IgG, להשהות את ההליך כאן ולאחסן על קרח במאגר לשטוף.
  3. לשטוף את החרוזים פעם אחת עם 500 μL של מאגר הדיזלציה 1x (10 מ"מ טריס-HCl, pH 7.5; 5 מ"מ MgCl2; 100 מ"מ kcl; 0.02% טריטון X-100).

5. דירחון של RNA 3 ' קצוות

  1. לאסוף את החרוזים עם עמדה מגנטית ולהשליך את supernatant. להסיר נוזל שיורית באמצעות טיפים משובחים בצנרת. הוסף 100 μL של שילוב מאסטר של דיזלציה (10 μL של מאגר הדזלציה 10x [100 mM טריס-HCl, pH 8.0; 50 mM MgCl2; 1 M kcl; 0.2% טריטון X-100; 1 Mg/mL סרום הפרה אלבומין (bsa)]; 78 μl של nuclease-מים ללא תשלום; 2 μl של מעכבי RNase; 2 Μl של dnase; 8 μl של אל kaline פוספאטאז) לכל מדגם, ו דגירה עבור 15 דקות ב 37 ° c, רועד ב 1,200 rpm.
  2. הוסף 300 μL of פולינופיאס קינאז (PNK) שילוב מאסטר (60 μL של 5x PNK pH 6.5 מאגר [350 mM טריס-HCl, pH 6.5; 50 mM MgCl2]; 223 μl של nuclease-מים חינם; 5 Μl rnase מעכב; 2 Μl dnase; 7 μl של אנזים pnk; 3 μl של 0.1 M dithioitol) לכל מדגם , דגירה של 20 דקות ב 37 ° צ', רועד ב 1,200 סל ד.
  3. לאסוף את החרוזים עם עמדה מגנטית ולהשליך את supernatant. שטוף חרוזים פעם עם 500 μL של מאגר כביסה קר. ואז לשטוף חרוזים פעם עם 500 μL של מאגר מלח גבוה קר. חזור על השטף שוב בסדר זה.
  4. לשטוף את החרוזים פעם אחת עם 500 μL של מאגר לשטוף קר ולאחר מכן פעמיים עם 300 μL של מאגר לאחר 1 x קר (אין dithiogol, 50 mM טריס-HCl, pH 7.5; 10 מ"מ MgCl2).

6. מתאם רנ א ליטל RNA 3 ' קצוות

  1. הסירו את הסופרנטאנט, והוציאו את הנוזל השאריות מהצנרת העדינה. הוסף 25 μL של שילוב מאסטר של 3 לדוגמה לכל מדגם. מערבבים בזהירות על ידי ליטוף. שלב זה נוטה לייצר בועות.
    הערה: לערבב מאסטר מכיל 3 μL של מאגר לימוד 10x [500 mM טריס-HCl, pH 7.5; 100 mM MgCl2]; 9 μL של nuclease-מים ללא תשלום; 0.4 μL של מעכב RNase; 0.3 μL של 0.1 M ATP; 0.8 μL של דימתיל סולפוקסיד (DMSO); 9 μL של 50% פוליאתילן גליקול (פג) 8000; 2.5 μl של RNA ליגאז [30 U/μl].
  2. הוסף 2.5 μL של מתאם RNA X1A (טבלה 1) ו 2.5 μl של מתאם rna X1B (טבלה 1) לכל דוגמה. מערבבים בקפידה על ידי ליטוף או מצליף, ו דגירה עבור 75 דקות ב 25 ° c, מצליף לערבב כל 10 דקות.
  3. לשטוף חרוזים פעם עם 500 μL של מאגר לשטוף קר (לחדש IgG לדגום כאן).
  4. לשטוף חרוזים פעם עם 500 μL של מאגר מלח גבוה קר ולאחר מכן עם 500 μL קר מאגר לשטוף. . חזור על השטף הזה שוב
  5. חרוזים נפרדים ממגנטים, ומסירים נוזל שיורית עם טיפים עדינים בצנרת.
  6. להשעות את החרוזים ב 100 μL של מאגר לשטוף קר (להשהות את המדגם IgG כאן ולאחסן על קרח במאגר לשטוף). הזז 20 μL לצינורות חדשים כדגימות RWB. הפרד מגנטוסטי את שאר 80 μL כדגימות RRI. הסר את הדוגמאות RRI ' supernatant והשהה מחדש את החרוזים ב 20 μL של מאגר לשטוף.
  7. הוסף 37.5 μL של 4x ליתיום dodecyl סולפט מאגר לדוגמה 15 μL של הסוכן הפחתת דגימה של 10x למדגם IgG. הוסף 7.5 μL של מאגר לדוגמה של המוהמלד 4x ו -3 μL של הסוכן הפחתת דגימה של 10x לדגימות (שנותרו). (אל תערבב באמצעות ליטוף). מודטה עבור 10 דקות ב 70 ° c, רועד ב 1,200 סל ד. קריר על קרח עבור 1 דקות, ו צנטריפוגה ב 1,000 x g עבור 1 דקות ב 4 ° c.

7. SDS-העברת עמוד וממברנה

  1. לטעון ג'לים.
    1. עבור RRI ג'ל (4-12% החלבון Bis-טריס ג'ל, 10-ובכן, 1.5 מ"מ) מקום צינורות על מגנט וחלבון נפרד משחררי מן החרוזים. טען 30 μL של דגימה לכל טוב. דגימות מרווחים על ידי סימון מוכתם מראש חלבון גודל.
    2. עבור RWB ג'ל (4-12% החלבון Bis-Tris, 10-ובכן, 1.5 מ"מ) מקום צינורות על מגנט וחלבון נפרד מהחרוזים. טען 15 μL של דגימה לכל טוב. שמור את הדגימות הנותרות ב-20 ° צ' כגיבויים.
  2. הוסף 500 μL של נוגדי חמצון כדי 500 mL של 1x SDS פועל מאגר. הפעל ב 200 V ב-1x SDS פועל מאגר עבור 50 דקות או עד החזית לצבוע הוא בתחתית.
    הערה: נוגדי חמצון מכיל N, N-Diמתילתמיד, נתרן ביסולפיט, הנודד עם חלבונים מופחתים כדי למנוע חמצון של חומצות אמינו רגישות כגון מתיונין ו טריפטופן.
  3. העברת חלבון-RNA מכלולי מהג לממברנה תאית ב-10 V עבור 70 דקות ב-1xtransfer עברה מאגר עם 10% מתנול (vol/vol). לשטוף את קרום RRI ב-PBS קר, לעטוף אותו לעטוף פלסטיק, ולאחסן ב-80 ° c.
  4. לחסום את קרום RWB ב 5% חלב ב TBST בטמפרטורת החדר עבור 1 h. לשטוף את הקרום ב TBST. דגירה עם נוגדן ראשוני ב TBST ב 4 ° c ללילה. לשטוף פעמיים עם TBST עבור 5 דקות. מארג עם נוגדן משני (1:5000 HRP עז אנטי ארנב IgG) ב TBST בטמפרטורת החדר עבור 1 h. לשטוף שלוש פעמים עם TBST עבור 5 דקות, 10 דקות ו 15 דקות, בהתאמה.
  5. מערבבים כמויות שוות של מאגר אלקטרוכימי (ECL) ומאגר B, להוסיף קרום וממברנה עבור 1 דקות. לכסות את קרום עם ניילון לעטוף, ולחשוף אותו לסרט רנטגן בטמפרטורת החדר עבור 2-3 דקות. לאחר מכן לפתח את הסרט.
    הערה: הסרט עם חשיפה יתר בבירור להראות את הצורה של קצות הקרום, שבו הסרט יכול להיות מיושר חזרה קרום RWB. לאחר מכן, יישר את ממברנות RWB ו-RWB בהתבסס על מיקומי הסמנים הכלולים בו. שכבתית בסדר מלמטה למעלה הם הסרט, קרום RWB ואת קרום RWB ברצף.

8. בידוד רנ א

  1. חותכים את האזור מלהקת החלבון כדי 75 kDa (כ 220 nt של RNA) מעל זה, באמצעות קרום RWB והסרט מדריכים.
    הערה: כמו חלבון מוגן RNA מולקולה יכול להיות אורך מירבי של 225 בסיסים, עם כ 340 Da לבסיס, זה סביר לחתוך את האזור על 75 kDa מעל הלהקה RBP לאחזר את כל החלבון-RNA מתחמי.
  2. חותכים את פיסת הקרום לתוך מספר פרוסות קטנות, ומניחים אותם לתוך צינור הצנטריפוגה חדש 1.5 mL. הוסף 200 μL של מאגר פרוטטינואז K (PK) (100 mM טריס-HCl pH 7.5; 50 mM הנאל; 10 מ"מ EDTA) עם 40 μL של PK לחתיכות קרום. מערבבים ומודדים עבור 20 דקות ב 37 ° c, רועד ב 1,200 סל ד.
  3. הוסף 200 μL של מאגר אוריאה שתנן (100 mM טריס-HCl pH 7.4; 50 מ"מ; 10 מ"מ EDTA; 7 M שתנן) לכל מדגם. דגירה של 20 דקות ב 37 ° צ', רועד ב 1,200 סל ד.
  4. הוסף 400 μL של חומצה פנול/כלורופורם/isoamyl אלכוהול (25:24:1), מערבבים היטב ו-דגירה עבור 5 דקות ב 37 ° צ', רועד ב 1,200 rpm.
  5. מקום 2 mL מנעול שלב ג'ל (PLG) צינור כבד בצנטריפוגה ו ספין ב 15,000 x g עבור 25 s.
  6. העבר את כל התוכן מלבד פרוסות ממברנה לצינור כבד PLG. מודטה עבור 5 דקות ב 37 ° c, רועד ב 1,200 סל ד.
  7. ספין בטמפרטורת החדר ו 15,000 x g עבור 15 דקות. להעביר את השכבה מימית לתוך הצינור החדש 15 mL חרוט.
  8. השימוש RNA טיהור ועמודות ריכוז כדי לחלץ RNA.
    1. הוסף 2 אמצעי אחסון (800 μL) של מאגר איגוד RNA לכל מדגם (משלב 8.7) וערבב. הוסף אמצעי אחסון שווה (1200 μL) של 100% אתנול ומיקס.
    2. העברת 750 μL של מדגם (משלב 8.8.1) אל ה-RNA טיהור ועמודות ריכוז בתוך שפופרת אוסף ו צנטריפוגה ב 15,000 x g עבור 30 s. להשליך זרימה-through.
    3. חזור על שלב 8.8.2 עד שכל הדגימות יועברו דרך העמודה. הוסף 400 μL של מאגר הכנה RNA לעמודה ו צנטריפוגה ב 15,000 x g עבור 30 s. להשליך זרימה-דרך, להחיל 700 ΜL של RNA לשטוף מאגר וצנטריפוגה את העמודה ב 15,000 x g עבור 30 s. למחוק את הזרימה.
    4. הוסף 400 μL של ה-RNA מאגר לשטוף את העמודה ואת צנטריפוגה ב 15,000 x g עבור 2 דקות. העבר את העמודה בזהירות לתוך שפופרת חדש מבית 1.5 mL. הוסף 10 μL של המים חינם של nuclease אל מטריצת העמודה, לבוא לשבת 2 דקות, ו צנטריפוגה ב 15,000 x g עבור 30 s. Store דגימות eclip ב-80 ° צ' עד RT (שלב 11.1).

9. דירחון של כניסת RNA 3 ' מסתיים

  1. הוסף 15 μL של שילוב מאסטר של דיזילציה (2.5 μL של מאגר הדזלציה 10x [100 mM טריס-HCl, pH 8.0; 50 mM MgCl2; 1 M kcl; 0.2% טריטון X-100; 1 מ"ג/ML bsa]; 9.5 μl של nuclease-מים ללא תשלום; 0.5 μl של מעכב RNase; 2.5 μl של פוספספטאז אלקליין) עד 10 μl של דגימות קלט (משלב 8.8.4). דגירה של 15 דקות ב 37 ° c, רועד ב 1,200 סל ד.
  2. להוסיף 75 μL של מיקס מאסטר PNK (20 μL של 5x PNK PH 6.5 מאגר [350 mM טריס-HCl, pH 6.5; 50 mM MgCl2]; 44 μl של nuclease-מים ללא תשלום; 1 Μl של rnase מעכב; 2 Μl של dnase; 7 μl של האנזים pnk; 1 μl של 0.1 M dithiothreitol) כדי לקבל דגימות. דגירה של 20 דקות ב 37 ° צ', רועד ב 1,200 סל ד.
  3. ניקוי של קלט RNA
    1. השהה מחדש את חומצות החילוץ מגנטי beadsin המבחנה (מערבולת עבור יותר מ -30 s). הוסף 20 μL של חומצות גרעין הפקת חרוזים מגנטיים עבור כל מדגם לצינורות חדשים. לאסוף את החרוזים עם עמדה מגנטית ולהשליך את supernatant.
    2. לשטוף את החרוזים פעם אחת עם 1 מ ל של מאגר לפירוק לטיהור של RNA (מאגר RLT). מניחים את הצינור על מגנט של 30 s ולהיפטר supernatant.
      הערה: הפרדה נוספת של חומצות גרעין הפקת חרוזים מגנטיים בעקבות שלב זה.
    3. השהה חרוזים מחדש עם 300 μL של מאגר RLT והוסף למדגם. הוסף 10 μL של 5 M הנאל ו-615 μL של 100% אתיל אלכוהול (אטוח) ולערבב על ידי ליטוף. סובב בטמפרטורת החדר במשך 15 דקות. הפרד מגנזיום את החרוזים ומסיר את הסופרנטאנט.
    4. השהה חרוזים מחדש 1 מ ל של 75% אטוח והעבר לשפופרת חדשה. לאחר 30 s, לאסוף את החרוזים עם עמדה מגנטית להיפטר supernatant. שטפו פעמיים עם 75% אטוח, הפרידו את החרוזים ומשחדים נוזלים בעזרת מפית משובחת. האוויר יבש עבור 5 דקות (להימנע ייבוש מוגזם).
    5. השהה מחדש את החרוזים עם 10 μL של המים ללא החכירה ו מודלת אותו עבור 5 דקות. חרוזים נפרדים מגנטוסטי, ולהעביר 5 μL של סופרנטאנט לצינור חדש (עבור 3 ' מתאם הקשר להלן). ה-RNA הנותר ניתן לאחסון ב--80 ° c כגיבויים.

10. מתאם רנ א הארכה לקלט RNA 3 ' קצוות

  1. הוסף 1.5 μL של DMSO ו 0.5 μL של מתאם RiL19 (טבלה 1) עד 5 μl של קלט RNA (משלב 9.3.5), מודטה עבור 2 דקות ב-65 ° c, ומניחים על קרח עבור יותר מ 1 דקות. הוסף 13.5 μl של 3 שילוב תבנית בסיס לתוך כל מדגם , מערבבים על ידי ליטוף, ו דגירה עבור 75 דקות ב 25 ° c, עם מצליף לערבב כל 15 דקות.
    הערה: שילוב מאסטר מכיל 2 μL של מאגר ליפטיים 10x [500 mM טריס-HCl, pH 7.5; 100 mM MgCl2; 10 מ"מ dithioitol]; 1.5 μL של nuclease-מים ללא תשלום; 0.2 μL של מעכב RNase; 0.2 μL של 0.1 M ATP; 0.3 μL של DMSO; 8 μL של 50% PEG8000; 1.3 μl של RNA ליגאז [30 U/μl].
  2. ניקוי של קלט ליגנטי (RNA)
    1. הפרדה מגנטית 20 μL של חומצות גרעין הפקת חרוזים מגנטיים עבור כל מדגם, ולהסיר את supernatant. שטוף חרוזים פעם אחת עם 1 מ ל של מאגר RLT.
    2. השעיית חרוזים מחדש ב-61.6 μL של מאגר RLT והשעיית העברה לכל דוגמה. הוסף 61.6 μL של 100% אטוח. השתמש בצנרת כדי לערבב עבור 15 דקות כל 5 דקות. חרוזים נפרדים מגנזיום, ולהסיר supernatant.
    3. חזור על שלב ה9.3.4.
    4. להשעות חרוזים עם 10 μL של nuclease-מים ללא תשלום, ולתת לו לשבת 5 דקות. מגנטונטי להפריד את החרוזים ולהעביר 10 μL של הסופרנטאנט לצינור חדש.
      הערה: זוהי נקודת עצירה אפשרית (ניתן לאחסן דגימות קלט ב-80 ° c עד היום הבא).

11. תעתיק הפוך, מתאם ה-DNA הארכה ל-cDNA 3 מסתיים

  1. הוסף 0.5 μL של RT פריימר (טבלה 1) כדי 10 μl של קלט rna (משלב 10.2.4) ו 10 ΜL של קליפ rna (משלב 8.8.4) בהתאמה, דגירה עבור 2 דקות בלוק PCR מחומם מראש ב 65 ° c, מקום על קרח עבור יותר מ 1 דקות.
  2. להוסיף 10 μL של לערבב מאסטר (2 μL של RT מאגר [500 mM טריס-HCl, pH 8.3; 750 mM KCl; 30 מ"מ MgCl2]; 4 μl של nuclease-מים ללא תשלום; 0.3 Μl של Rnase מעכב; 2 μl של 0.1 m dithiorol; 0.2 μl של 0.1 m datp; 0.2 μl של 0.1 m dctp; 0.1 M dGTP; 0.2 μL של 0.1 מטרים בלבד; 0.9 μL של היפוך הטרנססקריפט לדוגמה, מערבבים, מודסות ב-55 ° c עבור 45 דקות בבלוק PCR מחומם מראש.
  3. מערבבים 20 μL של המוצר התגובה RT עם 3.5 μL של ניקוי המוצר PCR מגיב. דגירה של 15 דקות ב 37 ° c.
  4. הוסף 1 μL של 0.5 M EDTA, לערבב על ידי ליטוף. הוסף 3 μL של 1 M NaOH, מערבבים על ידי ליטוף, ו מודטת עבור 12 דקות ב 70 ° c על בלוק PCR כדי hydrolyze התבנית RNA.
  5. הוסף 3 μL של הHCl 1 M, פיפטה-mix כדי לנטרל את המאגר.
  6. ניקוי cDNA
    1. הפרדה מגנטית 10 μL של חומצות גרעין הפקת חרוזים מגנטיים עבור כל מדגם, להסיר את supernatant. שטוף פעם אחת עם 500 μL של מאגר RLT.
    2. השעיית חרוזים מחדש ב-93 μL של מאגר RLT והשעיית העברה למדגם. הוסף 111.6 μL של 100% אטוח, מודלת אותו עבור 5 דקות, ו פיפטה מערבבים כל 2 דקות. לאסוף את החרוזים עם עמדה מגנטית ולהשליך את הסופרנטאנט. השהה חרוזים מחדש עם 1 מ ל של 80% אטוח ועבור לצינור חדש.
    3. לאחר 30 s, לאסוף את החרוזים עם עמדה מגנטית להיפטר supernatant. שטוף פעמיים עם 80% אטוח. הפרד באופן מגנט ומתעלם משאריות של נוזל עם תשר דק. האוויר יבש עבור 5 דקות (להימנע ייבוש מוגזם). השעיה מחדש חרוזים ב 5 μL של 5 mM טריס-HCl ו-דגירה זה 5 דקות.
  7. הוסף 0.8 μL של מתאם ה-DNA (טבלה 1) ו-1 ΜL של dmso כדי החרוזים, דגירה עבור 2 דקות ב 75 ° c. הניחו על הקרח במשך יותר מ-1 דקות.
  8. הכינו 12.8 μl של שילוב מאסטר מעורב (2 μl של מאגר ליפטיים 10x [500 mM טריס-HCl; 100 מ"מ mgcl2; 10 מ"מ מילימטר; 1.1 μl של nuclease-מים ללא תשלום; 0.2 μl של 0.1 M ATP; 9 μl של 50% PEG8000; 0.5 μl של RNA ליגאז [30 U/μl]) , קפיצי כדי לערבב, להסתובב בקצרה בצנטריפוגה, ולהוסיף אותו לכל מדגם, מערבבים מדגם עם טיפ של פיפטה לאט.
  9. הוסף עוד 1 μl של RNA ליגאז [30 U/μl] לכל מדגם ותנועה כדי לערבב. מודטה עבור 30 s ב 25 ° c, רועד ב 1,200 סל ד. מודטה ב -25 ° c בלילה. קפיצי לערבב בקלות 5 כדי 6 פעמים, פעם בשעה.
  10. ניקוי של cDNA ליגציה
    1. הפרדה מגנטית 5 μL של חומצות גרעין הפקת חרוזים מגנטיים עבור כל מדגם, ולהסיר supernatant.
    2. לשטוף פעם אחת עם 500 μL RLT מאגר.
    3. השעיה מחדש חרוזים ב-60 μL של מאגר RLT כדי חרוזים והעברת השעיה לכל מדגם. הוסף 60 μL של 100% אטוח, מודלת אותו עבור 5 דקות ו-הפיפטה מערבבים כל 2 דקות. נפרדים מגנזיום, למחוק supernatant.
    4. חזור על שלב ה9.3.4.
    5. מחדש חרוזים עם 27 μL של 10 מ"מ Tris-HCl, מכריית אותו עבור 5 דקות. מגנט נפרד, ולהעביר 25 μL של דגימה לצינור חדש. לדלל את 1 μL של cDNA ליגציה עם 9 μL של nuclease-מים חינם בצינור חדש. אחסן את הדגימות הנותרות ב-20 ° צ' עד לשלב 13.1.

12. קוונפיקציה של cDNA על ידי בזמן אמת כמותי PCR (qPCR)

  1. הוסף 9 μL של שילוב מאסטר qPCR (5 μL של שילוב בסיס של 2x; 3.6 μL של nuclease-מים ללא תשלום; 0.4 μL של פריימר לערבב [10 μM PCR-F-D50X ו 10 μM PCR-R-D70X]) כדי 96-ובכן qPCR הצלחת. הוסף 1 μL של 1:10 מדולל (ב H2O) cdna (משלב 11.10.5), לאטום ולערבב.
  2. הפעל את תוכנת ה-qPCR בתוך התרקוטרנר: 2 דקות ב 50 ° c; 2 דקות בשעה 95 ° c; 3 s ב 95 ° c ואחריו 30 s ב 68 ° צ' עבור 40 מחזורים; 15 s ב 95 ° c ואחריו 60 s ב 68 ° c ואחריו 15 s ב 95 ° צ' עבור 1 מחזור. הערה ערך Ct (סף מחזור).

13. PCR הגברה של cDNA

  1. לחלק 35 μL של שילוב מאסטר של PCR (25 μL של שילוב מאסטר של 2x PCR; 5 μL של nuclease-מים ללא תשלום; 5 μL של פריימר לערבב [20 μM PCR-F-D50X ו 20 μM PCR-R-D70X]) לתוך 8-ובכן רצועות. עבור קבוצת CLIP, הוסף 12.5 μL של מדגם CLIP + 2.5 μL של H2O; עבור קבוצת תשומות, להוסיף 10 μL של תשומות +5 μL של H2O. מערבבים היטב ומסתובבים בקצרה בצנטריפוגה.
  2. הפעל את התוכנית PCR: 30 s ב 98 ° צ'; 15 s ב 98 ° c ואחריו 30 s ב 68 ° c ואחריו 40 s ב 72 ° צ' עבור 6 מחזורים; 15 s ב 98 ° c ואחריו 60 s ב 72 ° צ' עבור N מחזורים = (ערכי qPCR-3)-6; 60 s בשעה 72 ° c; 4 ° c להחזיק.
    הערה: עדיף לבצע 1 עד 2 מחזורי PCR נוספים עבור הזוג הראשון של קליפים.

14. ג'ל טיהור

  1. לטעון דגימות על 3% ברזולוציה גבוהה agarose ג'ל. משאיר 1 ריק היטב בין דגימות, ולהשתמש סולם משני צידי הג. רוץ ב 100 V עבור 75 דקות ב-1x טריס-Borate-EDTA (TBE) מאגר.
  2. תחת תאורה כחולה אור, לגזור פרוסות ג'ל 175-350 bp באמצעות סכיני גילוח טרי עבור כל דוגמה. מניחים אותם ל 15 מ ל של צינורות חרוט.
    1. שוקלים את פרוסת הג ומשתמשים בערכת הפקת ג'ל.
    2. הוסף כרכים 6x של ג'ל המסת מאגר להמיס את ג'ל (100 mg ג'ל = 600 μL של ג'ל המסת מאגר). מפזר את הג'ל בטמפרטורת החדר. (לנענע כדי לערבב כל 15 דקות עד פרוסת ג'ל התפרקה לחלוטין). הוסף נפח 1 ג'ל של 100% איזופנול וערבב היטב.
    3. העבר 750 μL של מדגם (משלב 14.2.2) לעמודה בצינור אוסף וצנטריפוגה ב 17,900 x g עבור 1 דקות. לבטל את הזרימה.
    4. חזור על שלב 14.2.3 עד שכל הדגימות עברו בעמודה, לשטוף פעם אחת עם 500 μL של ג'ל המסת מאגר.
    5. הוסף 750 μL של מאגר כביסה (מתוך ערכת החילוץ ג'ל) אל העמודה ואת צנטריפוגה ב 17,900 x g עבור 1 דקות. למחוק את הזרימה-דרך, ספין ב 17,900 x g עבור 2 דקות. המקום את העמודה לצינור החדש 1.5 mL.
    6. הסר את כל מאגר הכביסה הנותר משפת הפלסטיק הסגולה של העמודה. האוויר יבש עבור 2 דקות. הוסף 12.5 μL של nuclease-מים ללא תשלום למרכז קרום. תן לעמודה לעמוד 2 דקות בטמפרטורת החדר, ולסובב ב 17,900 x g עבור 1 דקות (עבור תשואה משופרת, חזור על שלב הימנעות).

15. כפיל TOPO של המוצר PCR

  1. הכינו את שכפול התגובה TOPO שיבוט (1 μL של המוצר PCR משלב 14.2.6; 1 μL של ערבוב שיבוט; 3 μL של מים סטריליים). מערבבים בעדינות ומודגרות עבור 5 דקות ב 20-37 ° c. . מגניב על הקרח
  2. להפשיר בקטריה כימית. של חיידק החיידק על הקרח הוסף 5 μL של המוצר שיבוט TOPO כדי 100 μL של חיידקים המוסמכים29. מערבבים בעדינות היטב. . מודקון על קרח במשך 30 דקות
  3. הלם חום עבור 60 s ב 42 ° c. ואז להתקרר על הקרח עבור 2 דקות. הוסף 900 μL של ציר הקימוט (LB) בינוני, מודטה ב 37 ° צ' עבור 1 h, רועד ב 225 rpm. ספין ב 1,000 x g עבור 1 דקות, ולאחר מכן להסיר 900 μl של סופרנטאנט. . השהה מחדש את שאר הפתרונות
  4. צלחת החיידקים שהפכו על 1.5% ליברות אגר לוחות המכילים אמפיצילין (100 μg/mL), ו-דגירה לילה ב 37 ° c.
  5. הכינו לפחות 20 1.5 מ"ל שפופרות צנטריפוגה עבור כל מבנה. מלא ערכה אחת עם 500 μL של ליברות בינונית המכילה 100 μg/mL אמפיצילין. השתמש בקצה הצינורות הסטרילי כדי לשרוט מושבה אחת בקטריאלי באופן אקראי ולערבב (על ידי ליטוף) עם 500 μL של LB מדיום. מודטה ב 37 ° c עבור 5 h, רועד ב 225 סל ד.
  6. רצף את קטע ההוספה באמצעות M13 היפוך הפוך: מגאגאכאוקקיםעל ידי הסדרה30.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

הליך eclip והתוצאות מומחשים באיור 1, איור 2, איור 3, איור 4. עכברים מורדמים עם דו תחמוצת הפחמן וחתך קטן נעשה בבטן התחתונה באמצעות מספריים כירורגיים (איור 2A,B). האשכים לעכבר הוסרו, detunicated ואז UV-crosslinked קושרים לאחר שחיקה (איור 2C-I). הנציגה eCLIP התוצאות של שימוש בשני הליסים ידועים RNA ברקמות מתוארים באיור 3 ו- 4. אנחנו ביצעו MOV10 eCLIP באשכים ממבוגר מסוג פראי עכברים, עם ריכוז משותף של 40 U/mL של RNase אני מתייחס לליפוסט מקושרת. הפאנל העליון של איור 3A מראה כי חלבון היעד בגודל של כ 114 kda היה מועשר בהצלחה. הכתם המערבי של החלבונים immunoprecipitated MOV10L1 בוצע עם שני ריכוזים (5 או 40 U/mL) של RNase I במהלך תהליך eCLIP (איור 3A). איור 3B מראה qpcr באמצעות 1:10 מדולל cdna (כבר ליגיום עם מתאם DNA) מ MOV10 ו MOV10L1 UV-crosslinked, לא crosslinked ואת גודל לזווג הקלט (SMInput) לדוגמה. דגימות שאינן מקושרות להראות ירידה התאוששות RNA. הבחנו בכך, ערכי ה-Ct של הקבוצה הלא מקושרת היה בדרך כלל 5 פעמים יותר מאשר הקבוצה UV-crosslinked. איור 4A מציג הגברה PCR ובחירת גודל דרך האלקטרופורזה ג'ל (לחתוך 175-350 bp). פריימר-dimer המוצר מופיע על 140 bp. איור 4b מציג את תצוגת הגנום ucsc של שני רצפי משנה נציג שיבוט. תגי eCLIP מאוגדים MOV10 מצויים בתוך 3 ' UTR של הגן Fto; שיעור משוער של 3 ' UTR מטרות חשבונות עבור 75% (איור 4C), עקבי עם רוב מטרות MOV10 HEK293 תאים10 ו באשכים (נתונים לא מוצגים). לעומת זאת, תגי eCLIP מאוגדים ב-MOV10L1 מצויים בתוך אשכול piRNA המציין MOV10L1 מטרות מראש של piRNA. הקצב המשוער של piRNA מטרות קודבן חשבונות עבור 42% (איור 4E), אשר משקף מגמה של הניסוי הקודם שלנו המקובל קליפ20. MOV10L1 eCLIP עם 40 U/mL RNase I העיכול התשואות רצפים יחסית יותר עם פחות מ 20 bp (איור 4D).

Figure 1
איור 1 : ייצוג סכימטי של eCLIP. UV-crosslinked עכבר מקושרים tubules (שלב 1) הם לאחר מאגר פירוק eCLIP ו sonicated (שלב 2). Lysate היא מטופלת עם RNase I לחלק RNA, לאחר אשר מתחמי חלבון-RNA הם immunoprecipitated באמצעות הנוגדן נגד RBP (שלב 3-4). Dephosphorylation של שברי RNA והארכה של 3 ′ מתאם RNA מתבצעים (שלב 5-6). חלבון-RNA מתחמי מופעל על-ידי ג'ל לעמוד-SDS והועבר לממברנות תאית (שלב 7). RNA הוא התאושש מן הקרום על ידי עיכול החלבון עם פרוטטינואז K ו שתנן אשר משאיר פוליפטידים קצר נשאר באתר crosslink. Dephosphorylation של שברי RNA של דגימות קלט והארכה של 3 ′ מתאם RNA מבוצע (שלב 8). לבצע RT של RNA והארכה של 3 ′ מתאם DNA (שלב 9-10). בצע הגברה של ה-PCR של ספריית cDNA, חילוץ הג ושיבוט ה-PCR הקהה לבקרת איכות הספרייה הראשונית (שלב 11). לבסוף, בצע רצף התפוקה הגבוה (שלב 12). אנא לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.

Figure 2
איור 2 : לאסוף רקמות ולהצליב UV הקישור. (א) חשיפת הבטן של העכבר. (ב) חתך של 0.5 ס מ בקיר הבטן וחשיפת הצפק. (ג) זוג אשכים נלקחים על ידי משיכת החוצה רפידות שומן. (ד) רקמת האשכים מוסר ומושם במנה קטנה המכילה הקרח קר PBS. (ה) הסר בעדינות את אלבומין המנהרה. (ו) לחץ על הקלף הרפוי כדי לשלש את הרקמה בתוך מטחנת הרקמה. (ז) מופץ בצורת שיניים בצלחת 10 ס מ. (ח) UV מקשר עם 400 mJ/cm2 אנרגיה. (I) הדגימות מקושרות נאספו בצינורות צנטריפוגה 1.5 mL. אנא לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.

Figure 3
איור 3 : תוצאות מייצגות של MOV10 ו-MOV10L1 eCLIP. (א) אימות כתמי מערבי של MOV10 ו-MOV10L1 immunoprecipitates. (ב) qpcr על 1:10 מדולל בספריות ECLIP של MOV10 ו MOV10L1, עם משכפל עבור uv, NON-uv ואת הדגימות SMInput לזווג. אנא לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.

Figure 4
איור 4 : הכנה לספריות Eclip והערכת איכות. (א) את התמונות ג'ל של הגברה PCR מוצגים. כוכבית מציין פריימר dimer. קו אדום מנוקד מציין אזורים המגורש עבור המוצר PCR של cDNA, במקום כלשהו בין 175 ו 350 bp. (ב) ucsc הגנום תצוגת דפדפן של שני רצפי משנה נציג שיבוט31. (ג) אנליזה בקנה מידה קטן לשכפול משנה של MOV10. (ד) MOV10L1 בתגים מאוגדים מציגים דפוסים שונים של התפלגות אורך כאשר הם מעובדים על-ידי שני ריכוזי RNase שונים. (ה) אנליזה בקנה מידה קטן לשכפול משנה של MOV10L1. אנא לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.

שם הרצף מידע על רצף תיאור/
מתאמי RNA
RNA X1A /המנון ה, ב, ה, ה, ה, שלישי מלאי ב-200 μM; עבודה בגיל 20 μM
RNA X1B /ליאת מיכאל/מיכל שואגנים5acg3d/ מלאי ב-200 μM; עבודה בגיל 20 μM
RiL19 /5phos/AGAUCGGAAGAGCGUCGUG/3SpC3/ מלאי ב-200 μM; עבודה ב 40 μM
מתאם דנ א
Rand103tr3 /5Phos/NNNNNNNNNNAGATCGGAAGAGCACACGTCTG/3SpC3/ מלאי ב-200 μM; עבודה ב 80 μM
פריימר
AR17 ACACGACGCTCTTCCGA מלאי ב-200 μM; עבודה בגיל 20 μM
צבעי היסוד המולקולארית

501-PCR
AATGATACGGCGACCACCGAGATCTACACTATAGCCTACACTCTTTCCCTACACGACGCTCTTCCGATCT מלאי ב-100 μM; עבודה בגיל 20 μM
PCR-R-D 701 CAAGCAGAAGACGGCATACGAGATCGAGTAATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC מלאי ב-100 μM; עבודה בגיל 20 μM
(ראה הארה באות שירות לקוחות עבור D502-508, D702-712)

טבלה 1: רצף מתאם ותחל. המתאם מכיל אקראי מקוון-mer (או N5 או N10) כדי לקבוע אם שתי קריאות רצף זהות מציינות שני שברי מקטעי RNA ייחודיים או כפילויות PCR של אותו מקטע RNA. "5 phos" עומד על 5 ' זירחון, אשר נדרש אם oligo משמש מצע עבור DNA/RNA ligase. "3SpC3" עומד על 3 ' מרווח C3, אשר יכול למנוע הקשר בין מתאמים.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

עם ההבנה הגוברת של התפקיד האוניברסלי של rbps תחת שני ההקשרים ביולוגיים ופתולוגיים, שיטות הקליפ נוצל רבות כדי לחשוף את הפונקציה המולקולרית של rbps20,32,33, 34,35. הפרוטוקול המתואר כאן מייצג יישום מותאם של שיטת eCLIP לתוך החשבון של העכבר.

אתגר אחד בביצוע eCLIP ב בדיקת שמירה על יכולת הקיום והיושרה של תאי האשכים טריים, אשר גם חשוב עבור הקישור האפקטיבי. הטיית הבנות עם כוח מכני קל באמצעות כתש רופף יכול למנוע את הליזה התאים32,36. העיכול הנכונה של RNA הוא גם קריטי עבור eCLIP assays מוצלחת. שברי RNA יכול להיות יותר מתכנסת אחרי העיכול, אבל אורך פחות מ 20 bp ניתן להסיר באמצעות טרום עיבוד של הספרייה קורא. על מנת לאמץ מינון RNase אידיאלי עבור מועמד RBP, אנו מציעים בדיקה ראשונית מבוסס על התוצאות של רצף משנה של ספריות eCLIP שניתן להכין על ידי טיפול RNase עם ריכוזים החל 0 לך כדי 40 U (למילי ליטר של ליפוסט). ניתוח הרצף הקטן של השכפול הוא צעד מומלץ לבדיקה אמינה של איכות הספרייה בשיטת eCLIP שלנו. ראשית, האחוז של מוסיף קצר יותר מ-20 bp לא צריך להיות גבוה מדי, או, העיבוד הקודם של הספרייה eCLIP יגרום לאובדן יקר של קריאות. שנית, יש לבדוק את היעילות של הארכה נכונה של שני המתאמים. דגימות תקניים ניתן לחסל ללא רצף עמוק כדי להבטיח רצף מוצלח מוצלחת, התוצאות של אשר בדרך כלל לוקח הרבה יותר זמן לנתח.

למרות הכדאיות של eCLIP בתוך בדיקת העכבר עדיין מוגבל על ידי הספציפיות של הנוגדן לשלב של immunoprecipitation, eCLIP הוא יתרון על שיטות ה-CLIP קונבנציונאלי במספר היבטים. ראשית, זוהי שיטה שאינה רדיואקטיבית. על ידי eCLIP, מטרות RNA של RBPs שנתפסו ישירות בvivo מבלי לפנות לטכניקות עתירות עבודה באמצעות חומרים רדיואקטיביים. שנית, השיטה מאומצת פחות זמן. התהליך כולו לוקח רק 4 ימים דרך הכנת ספריית eCLIP. . שלישית, רצף מגוון לעומת מחזור מאוחד קונבנציונאלי הגברה של 25-35 מחזורים, eclip מתייחס ערכי Ct של qpcr כדי להגדיר את מספר מחזורי ה-PCR באופן ספציפי. לבסוף, הוא מספק יחס חזק יותר של אות לרעש. הקלט התואם לגודל משמש כרקע מתאים למטרות אותנטיות.

לסיכום, תוצאות ה-eCLIP שלנו מאחד את המסקנות שMOV10 ו-MOV10L1 מחייבות העדפה מחייבת ל-mRNA 3 ' UTR ו-piRNA מראש, בהתאמה. הפרוטוקול שתיארנו להלן מייצג את התעסוקה הראשונה של שיטת eCLIP ברבייה, אזור שבו הידע באינטראקציה של RNA-RBP אינו מספיק, למרות שמחקרים גנטיים סיפקו מידע מספיק על התפקידים הביולוגיים של RBPs. הדמיה של פרוטוקול eCLIP זה עשויה לסייע להנחות את היישומים הנפוצים באזורים רחבים יותר.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

. למחברים אין מה לגלות

Acknowledgments

אנו מודים לאריק ל ואן נוסטרנד ולג ' יו על הנחיות מועילות עם הפרוטוקול המקורי. K.Z. היה נתמך על ידי תוכנית מפתח לאומי R & D של סין (2016YFA0500902, 2018YFC1003500), הקרן הלאומית למדע הטבע של סין (31771653). L.Y. נתמכת על ידי הקרן הלאומית למדע הטבע של סין (81471502, 31871503) ותוכנית חדשנית ויזמית של מחוז ג'יאנגסו.

Materials

Name Company Catalog Number Comments
Antibodies
Anti-mouse MOV10  antibody Proteintech, China 10370-1-AP
Anti-mouse MOV10L1 antibody Zheng et al.20109 polyclonal antisera UP2175 provided by P. Jeremy Wang lab, University of Pennsylvania
HRP Goat Anti-Rabbit IgG  ABclonal AS014
Rabbit IgG Beyotime, China A7016
Equipment
Centrifuge Eppendorf, Hamburg, Germany 5242R
Digital sonifier BRANSON,USA BBV12081048A 450 Watts; 50/60 Hz
DynaMag-2 Magnet Invitrogen,USA 12321D
Mini Blot Module Invitrogen,USA B1000
Mini Gel Tank Invitrogen,USA A25977
Shaking incubator Eppendorf, Hamburg, Germany Thermomixer comfort 
Tissue Grinder, Dounce PYREX, USA 1234F35 only  the "loose" pestle is used in this protocol
TProfessional standard 96 Gradient Biometra, Germany serial no.: 2604323
Tube Revolver  Crystal, USA serial no.: 3406051
UV-light cross-linker UVP, USA CL-1000
Materials
TC-treated Culture Dish Corning, USA 430167 100 mm 
Tubes Corning, USA 430791 15 mL
Microtubes tubes AXYGEN , USA MCT-150-C 1.5 mL 
Reagents 
Acid phenol/chloroform/isoamyl alcohol  Solarbio, China P1011 25:24:01
AffinityScript Enzyme Agilent, USA 600107
Antioxidant Invitrogen,USA NP0005
DH5α competent bacteria Thermo Scientific, USA 18265017 these economical cells yield >1 x 106 transformants/µg control DNA per 50 µL reaction.
DMSO Sigma-Aldrich, USA D8418
DNA Ladder Invitrogen, USA 10416014
dNTP Sigma-Aldrich, USA DNTP100-1KT
Dynabeads Protein A  Invitrogen, USA 10002D
ECL reagent Vazyme, China E411-04
EDTA Invitrogen, USA AM9260G
EDTA free protease inhibitor cocktail Roche, USA 04693132001 add fresh
Exo-SAP-IT Affymetrix, USA 78201 PCR Product Cleanup Reagent 
FastAP enzyme Thermo Scientific, USA EF0652
LDS Sample Buffer Thermo Scientific, USA NP0007
MetaPhor Agarose  lonza, Switzerland 50180
MgCl2 Invitrogen, USA AM9530G
MiniElute gel Extraction QIAGEN, Germany 28604 column store at 4 ?; buffer QG=gel dissolving buffer; buffer PE= wash buffer(for step 14)
MyONE Silane beads Thermo Scientific, USA 37002D nucleic acids extraction magnetic beads
NaCl Invitrogen,USA AM9759
 
NP-40 Amresco, USA M158-500ML
NuPAGE Bis-Tris Protein Gels Invitrogen, USA NP0336BOX 4%–12%,1.5 mm, 15-well
NuPAGE MOPS SDS Buffer Kit  Invitrogen, USA NP0050
PBS Gibco, USA 10010023
Phase-Locked Gel (PLG) heavy tube   TIANGEN, China WM5-2302831
PowerUp SYBR Green Master Mix Applied Biosystems, USA A25742
Proteinase K NEB, New England  P8107S
Q5 PCR master mix  NEB, New England  M0492L
RLT buffer QIAGEN, Germany 79216 RNA purification lysis buffer 
RNA Clean & Concentrator-5 columns  ZYMO RESEARCH, USA R1016 RNA purification and concentration columns
RNase I  Invitrogen, USA AM2295
RNase Inhibitor Promega, USA N251B
RQ1 DNase Promega,USA M610A
Sample Reducing Agent Invitrogen,USA NP0009
SDS Solution Invitrogen, USA 15553027 10%
Sodium deoxycholate Sigma-Aldrich, USA 30970 protect from light
T4 PNK enzyme NEB, New England  M0201L
T4 RNA ligase 1 high conc NEB, New England  M0437M
TA/Blunt-Zero Cloning Mix Vazyme, China C601-01
TBE Invitrogen,USA AM9863
Tris-HCI Buffer Invitrogen, USA 15567027
Triton X-100 Sangon Biotech, China A600198 
Tween-20 Sangon Biotech, China A600560
Urea Sigma-Aldrich, USA U5378
X-ray Films Caresteam, Canada 6535876

DOWNLOAD MATERIALS LIST

References

  1. Turner, J. M., Mahadevaiah, S. K., Ellis, P. J., Mitchell, M. J., Burgoyne, P. S. Pachytene asynapsis drives meiotic sex chromosome inactivation and leads to substantial postmeiotic repression in spermatids. Developmental Cell. 10, (4), 521-529 (2006).
  2. Turner, J. M. A. Meiotic sex chromosome inactivation. Development. 134, (10), 1823-1831 (2007).
  3. Kimmins, S., Sassone-Corsi, P. Chromatin remodelling and epigenetic features of germ cells. Nature. 434, (7033), 583-589 (2005).
  4. Ule, J., et al. CLIP identifies Nova-regulated RNA networks in the brain. Science. 302, (5648), 1212-1215 (2003).
  5. Ule, J., Jensen, K., Mele, A., Darnell, R. B. CLIP: a method for identifying protein-RNA interaction sites in living cells. Methods. 37, (4), 376-386 (2005).
  6. Trifillis, P., Day, N., Kiledjian, M. Finding the right RNA: identification of cellular mRNA substrates for RNA-binding proteins. RNA. 5, (8), 1071-1082 (1999).
  7. Tenenbaum, S. A., Carson, C. C., Lager, P. J., Keene, J. D. Identifying mRNA subsets in messenger ribonucleoprotein complexes by using cDNA arrays. Proceedings of National Acadamy of Sciences U S A. 97, (26), 14085-14090 (2000).
  8. Chi, S. W., Zang, J. B., Mele, A., Darnell, R. B. Argonaute HITS-CLIP decodes microRNA-mRNA interaction maps. Nature. 460, (7254), 479-486 (2009).
  9. Zheng, K., et al. Mouse MOV10L1 associates with Piwi proteins and is an essential component of the Piwi-interacting RNA (piRNA) pathway. Proceedings of National Acadamy of Sciences U S A. 107, (26), 11841-11846 (2010).
  10. Gregersen, L. H., et al. MOV10 Is a 5' to 3' RNA helicase contributing to UPF1 mRNA target degradation by translocation along 3' UTRs. Molecular Cell. 54, (4), 573-585 (2014).
  11. Banerjee, S., Neveu, P., Kosik, K. S. A coordinated local translational control point at the synapse involving relief from silencing and MOV10 degradation. Neuron. 64, (6), 871-884 (2009).
  12. Choi, J., Hwang, S. Y., Ahn, K. Interplay between RNASEH2 and MOV10 controls LINE-1 retrotransposition. Nucleic Acids Research. 46, (4), 1912-1926 (2018).
  13. Goodier, J. L., Cheung, L. E., Kazazian, H. H. Jr MOV10 RNA helicase is a potent inhibitor of retrotransposition in cells. PLoS Genetics. 8, (10), e1002941 (2012).
  14. Haussecker, D., et al. Capped small RNAs and MOV10 in human hepatitis delta virus replication. Nature Structural & Molecular Biology. 15, (7), 714-721 (2008).
  15. Kenny, P. J., et al. MOV10 and FMRP regulate AGO2 association with microRNA recognition elements. Cell Reports. 9, (5), 1729-1741 (2014).
  16. Messaoudi-Aubert, S. E., et al. Role for the MOV10 RNA helicase in Polycomb-mediated repression of the INK4a tumor suppressor. Nature Structural & Molecular Biology. 17, (7), 862-868 (2010).
  17. Sievers, C., Schlumpf, T., Sawarkar, R., Comoglio, F., Paro, R. Mixture models and wavelet transforms reveal high confidence RNA-protein interaction sites in MOV10 PAR-CLIP data. Nucleic Acids Research. 40, (20), e160 (2012).
  18. Skariah, G., et al. Mov10 suppresses retroelements and regulates neuronal development and function in the developing brain. BMC Biology. 15, (1), 54 (2017).
  19. Zheng, K., Wang, P. J. Blockade of pachytene piRNA biogenesis reveals a novel requirement for maintaining post-meiotic germline genome integrity. PLoS Genetics. 8, (11), e1003038 (2012).
  20. Vourekas, A., et al. The RNA helicase MOV10L1 binds piRNA precursors to initiate piRNA processing. Genes & Development. 29, (6), 617-629 (2015).
  21. Hocq, R., Paternina, J., Alasseur, Q., Genovesio, A., Le Hir, H. Monitored eCLIP: high accuracy mapping of RNA-protein interactions. Nucleic Acids Research. 46, (21), 11553-11565 (2018).
  22. Huppertz, I., et al. iCLIP: protein-RNA interactions at nucleotide resolution. Methods. 65, (3), 274-287 (2014).
  23. Hafner, M., et al. Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 141, (1), 129-141 (2010).
  24. Hafner, M., et al. PAR-CliP--a method to identify transcriptome-wide the binding sites of RNA binding proteins. Journal of Visualized Experiments. (41), (2010).
  25. Konig, J., et al. iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nature Structural & Molecular Biology. 17, (7), 909-915 (2010).
  26. Konig, J., et al. iCLIP--transcriptome-wide mapping of protein-RNA interactions with individual nucleotide resolution. Journal of Visualized Experiments. (50), (2011).
  27. Maticzka, D., Ilik, I. A., Aktas, T., Backofen, R., Akhtar, A. uvCLAP is a fast and non-radioactive method to identify in vivo targets of RNA-binding proteins. Nature Communications. 9, (1), 1142 (2018).
  28. Van Nostrand, E. L., et al. Robust transcriptome-wide discovery of RNA-binding protein binding sites with enhanced CLIP (eCLIP). Nature Methods. 13, (6), 508-514 (2016).
  29. Radulovich, N., Leung, L., Tsao, M. S. Modified gateway system for double shRNA expression and Cre/lox based gene expression. BMC Biotechnology. 11, 24 (2011).
  30. Breunig, C. T., et al. A Customizable Protocol for String Assembly gRNA Cloning (STAgR). Journal of Visualized Experiments. (142), (2018).
  31. Kuhn, R. M., Haussler, D., Kent, W. J. The UCSC genome browser and associated tools. Briefings in Bioinformatics. 14, (2), 144-161 (2013).
  32. Vourekas, A., et al. Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis. Nature Structural & Molecular Biology. 19, (8), 773-781 (2012).
  33. Preitner, N., et al. APC is an RNA-binding protein, and its interactome provides a link to neural development and microtubule assembly. Cell. 158, (2), 368-382 (2014).
  34. Meyer, C., et al. The TIA1 RNA-Binding Protein Family Regulates EIF2AK2-Mediated Stress Response and Cell Cycle Progression. Molecular Cell. 69, (4), 622-635 (2018).
  35. Gerstberger, S., Hafner, M., Tuschl, T. A census of human RNA-binding proteins. Nature Reviews Genetics. 15, (12), 829-845 (2014).
  36. Vourekas, A., Mourelatos, Z. HITS-CLIP (CLIP-Seq) for mouse Piwi proteins. Methods in Molecular Biology. 1093, 73-95 (2014).
משופרת Crosslinking Immunoprecipitation (eCLIP) שיטה לזיהוי יעיל של רנ א חלבון מאוגד ב העכבר בתוך הראש
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Xu, Q., Wang, C., Ling, L., Yue, Q., Liu, M., Zhang, S., Fu, K., Ye, L., Zheng, K. Enhanced Crosslinking Immunoprecipitation (eCLIP) Method for Efficient Identification of Protein-bound RNA in Mouse Testis. J. Vis. Exp. (147), e59681, doi:10.3791/59681 (2019).More

Xu, Q., Wang, C., Ling, L., Yue, Q., Liu, M., Zhang, S., Fu, K., Ye, L., Zheng, K. Enhanced Crosslinking Immunoprecipitation (eCLIP) Method for Efficient Identification of Protein-bound RNA in Mouse Testis. J. Vis. Exp. (147), e59681, doi:10.3791/59681 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter