Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Biology

Método avançado da imunoprecipitação da reticulação (eCLIP) para a identificação eficiente do RNA proteína-ligado no testis do rato

doi: 10.3791/59681 Published: May 10, 2019
* These authors contributed equally

Summary

Aqui, nós apresentamos um protocolo de eCLIP para determinar alvos principais do RNA de candidatos do RBP no testis.

Abstract

A espermatogênese define um processo altamente ordenado de diferenciação de células germinativas masculinas em mamíferos. No testis, a transcrição e a tradução são desacopladas, sublinhando a importância da regulação pós-transcripcional da expressão gênica orquestrada por RBPs. Para elucidar papéis mecanísticos de um RBP, a metodologia da imunoprecipitação da reticulação (grampo) pode ser usada para capturar seus alvos diretos endógenos do RNA e para definir os locais reais da interação. O grampo realçado (eCLIP) é um método recentemente desenvolvido que ofereça diversas vantagens sobre os grampos convencionais. No entanto, o uso do eCLIP foi até agora limitado a linhas de célula, chamando para aplicativos expandidos. Aqui, nós empregamos eCLIP para estudar MOV10 e MOV10L1, dois helicases conhecidos do RNA-emperramento, no testis do rato. Como esperado, nós encontramos que MOV10 se liga predominantly a 3 ' as regiões Untranslated (UTRs) de mRNA e MOV10L1 ligam seletivamente às transcrições do precursor do RNA Piwi-interagindo (piRNA). Nosso método eCLIP permite a determinação rápida de espécies de RNA principais vinculadas por vários RBPs através de sequenciamento em pequena escala de subclones e, portanto, disponibilidade de bibliotecas qualificadas, como um mandado para prosseguir com sequenciamento profundo. Este estudo estabelece uma base aplicável para eclip no testis mamíferos.

Introduction

O testis mammalian representa um modelo desenvolvente excelente onde um programa intricado da diferenciação da pilha funcione ciclicamente para render espermatozóides numerosos. Um valor único deste modelo reside no surgimento da inativação transcricional em determinados estágios da espermatogênese, tipicamente quando a inativação do cromossomo meiótico (MSCI) ocorre1,2 e quando os espermatozídeos redondos sofrem compactação nuclear drástica durante a spermiogênese3. Estes eventos transcricional inconsecutivos necessitam a regulação borne-transcricional do gene, em que as proteínas RNA-obrigatórias (rbps) jogam um papel crucial, dando forma ao transcriptoma e mantendo a fertilidade masculina.

Para identificar os alvos de RNA de bona fide de uma RBP individual in vivo, o método da imunoprecipitação de reticulação (clip) foi desenvolvido4,5, com base no mas além da imunoprecipitação de RNA regular (RIP)6,7 , pela incorporação de etapas chaves que incluem a reticulação ultravioleta (UV), a lavagem estrita e a transferência do gel para melhorar a especificidade do sinal. A aplicação avançada do grampo combinada com o seqüenciamento da elevado-taxa de transferência provocou o grande interesse na interação da proteína-RNA do perfil em níveis do genoma-largo8. Além do que estudos genéticos na função de RBP, tais métodos bioquímicos que identificam a interação direta da proteína endógena e do RNA foram indispensáveis para elucidar exatamente os papéis regulatórios do RNA de RBPs. Por exemplo, MOV10L1 é um helicase do RNA do testis-específico exigido para a fertilidade masculina e a biogênese Piwi-interagindo do RNA (piRNA)9. Seu MOV10 do parálogo é sabido como um helicase ubiquitously expressado e multifunctional do RNA com papéis em aspectos múltiplos da biologia do RNA10,11,12,13,14 , 15 anos de , 16 anos de , 17 anos de , 18. empregando o clip-Seq convencional, nós encontramos que MOV10L1 liga e regula precursores preliminares de Pirna para iniciar o processamento adiantado de Pirna19,20, e esse MOV10 liga UTRs de mRNA 3 ' e assim como o RNA RNAs espécies em células germinativas testiculares (dados não mostrados).

No entanto, CLIP é originalmente um procedimento laborioso, radioativo seguido de sequenciamento de preparação da biblioteca com uma notável perda de Tags CLIP. No clipe convencional, uma biblioteca de cDNA é preparada usando adaptadores ligados em ambas as extremidades do RNA. Após a digestão da proteína, os polypeptídeos curtos reticulados permanecem unidos aos fragmentos do RNA. Esta marca de reticulação bloqueia parcialmente a progressão da transcriptase reversa (RTase) durante a síntese do cDNA, resultando em cDNAs truncados que representam cerca de 80% da biblioteca do cDNA21,22. Assim, apenas os fragmentos de cDNA resultantes de RTase ignorando o site de reticulação (read-through) são seqüenciados. Recentemente, as várias aproximações do grampo, tais como PAR-grampo, iCLIP, eCLIP e uvCLAP, foram empregadas para identificar os locais da ligação cruzada de RBPs em pilhas vivas. O par-grampo envolve a aplicação da radiação UV de 365 nanômetro e dos análogos photoactivatable do nucleotide e é conseqüentemente exclusivo às pilhas vivas in-culturing, e a incorporação de análogos do nucleosídeo em transcritos recentemente sintetizados é propenso a produzir a polarização onde o RNA interage fisicamente com a proteína23,24. No iCLIP, apenas um único adaptador é ligado à extremidade 3 ' de fragmentos de RNA reticulado. Após a transcrição reversa (RT), ambos os cDNAs truncados e lidos são obtidos por circularização intramolecularmente e relinearização seguida pela amplificação da reação em cadeia da polimerase (PCR)25,26. Entretanto, a eficiência da circularização intramolecular é relativamente baixa. Embora os protocolos mais velhos do grampo precisem de etiquetar do RNA reticulado com um radioisótopo, reticulação ultravioleta e purificação da afinidade (uvCLAP), com um processo de purificação em tandem estrita da afinidade, não confia na radioactividade27. Não obstante, uvCLAP é limitado às pilhas cultivadas que devem ser transfected com o vetor da expressão que carreg a etiqueta de 3x FLAG-HBH para a purificação em tandem da afinidade.

Em eCLIP, os adaptadores foram ligados primeiramente na extremidade 3 ' do RNA seguido pelo RT, e em seguida na extremidade 3 ' dos cDNAs em uma modalidade intermolecular. Assim, o eCLIP é capaz de capturar todos os cDNA28truncados e lidos. Além disso, não é restrito à rotulagem radioativa, nem ao uso de linhas celulares com base em seu princípio, mantendo a resolução de nucleotídeo único.

Aqui, nós fornecemos uma descrição passo a passo de um protocolo eCLIP adaptado para testagem do mouse. Momentaneamente, este protocolo de eCLIP começa com reticulação UV de tubules testicular, seguidos pela digestão parcial de RNase e pela imunoprecipitação usando um anticorpo proteína-específico. Em seguida, o RNA proteína-ligado é dephosphorylated, e o adaptador é ligado a sua extremidade 3 '. Após a electroforese do gel da proteína e a transferência da gel-à-membrana, o RNA é isolado cortando a área da membrana de uma escala esperada do tamanho. Após RT, o adaptador do ADN é ligado à extremidade 3 ' do cDNA seguido pela amplificação do PCR. O rastreamento de subclones antes do sequenciamento de alta taxa de transferência é tomado como um controle de qualidade de biblioteca. Este protocolo é eficiente na identificação das principais espécies de RNA proteico-dependente de RBPs, exemplificada pelos dois testamentos expressando RNA helicases MOV10L1 e MOV10.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Todos os experimentos realizados em animais foram aprovados pelo Comitê da universidade médica de Nanjing. Camundongos machos C57BL/6 foram mantidos condições controladas de fotoperíodo e foram fornecidos com alimentos e água.

1. colheita de tecidos e reticulação UV

  1. Eutanizar 2 camundongos adultos usando dióxido de carbono (CO2) por 1-2 min ou até que a respiração pare. Em seguida, realize a deslocação cervical em cada rato.
  2. Colha cerca de 100 mg de testículos de camundongos de idade apropriada (um testículo adulto neste estudo) para cada experimento de imunoprecipitação e coloque os tecidos em soro fisiológico tamponado com fosfato frio (PBS).
  3. Retire a túnica albugínea suavemente com um par de pinças de ponta fina.
  4. Adicione 3 mL de PBS gelado em um moedor de tecido e triturar o tecido pela força mecânica suave usando um pilão de vidro frouxo (tipo um pilão de vidro).
    Nota: O objetivo desta etapa não é a lyse células, mas para separar o tecido. A preservação da viabilidade celular e da integridade é importante.
  5. Transfira a suspensão do tecido para um prato de cultura celular (10 cm de diâmetro) e adicione PBS gelado até 6 mL.
  6. Agite a placa rapidamente para que o líquido cubra a parte inferior do prato uniformemente. Se o tecido é terra corretamente, os túbulos seminíferos uniformente distribuídos serão visíveis, visto que a presença de grupos do tecido indica que a dispersão do tecido é suboptimal.
  7. Crosslink a suspensão três vezes com 400 mJ/cm2 em 254 nm no gelo. Misture a suspensão entre cada irradiação.
    Nota: Para cada novo experimento, a reticulação deve ser otimizada.
  8. Colete a suspensão em um tubo cônico de 15 mL e pellet em 1.200 x g por 5 min a 4 ° c. Retire o sobrenadante, Ressuspender o pellet em 1 mL de PBS e, em seguida, transferir a suspensão para um tubo de centrifugação de 1,5 mL. Girar a 4 ° c e 1.000 x g por 2 min, e remover o sobrenadante.
  9. Neste ponto, proceder imediatamente com o resto do protocolo, ou congelar a pressão das pelotas em nitrogênio líquido e armazenar a-80 ° c até o uso.

2. preparação de grânulos

  1. Adicionar 125 μL de proteína A grânulos magnéticos por amostra (pellet) a um tubo de centrífuga fresco.
    Nota: Use grânulos magnéticos da proteína G para anticorpos do rato.
  2. Coloque o tubo no íman para separar os grânulos da solução. Após 10 s, retire o sobrenadante. Lave os grânulos duas vezes com 1 mL de tampão de Lise gelado.
    Nota: Subsequente separação da proteína um grânulos magnéticos segue esta etapa. A composição do tampão do lysis é 50 milímetros Tris-HCl, pH 7,5; 100 mM NaCl; 1% NP-40; 0,1% SDS; 0,5% de desoxicolato de sódio; 1/50 ácido etilenodiaminotetracético (EDTA)-cocktail livre do inibidor de protease (adicione fresco).
  3. Resuspender os grânulos em 100 μL de tampão de Lise a frio com anticorpo 10 μg de eCLIP. Gire os tubos à temperatura ambiente por 45 min.
    Nota: A concentração final de anticorpos para a imunoprecipitação é de 10 μg/mL. Se a concentração de anticorpos for desconhecida, a quantidade de anticorpos deve ser otimizada.
  4. Lave os grânulos duas vezes com 1 mL de tampão de Lise gelado.

3. lise tecidual e digestão de RNA parcial

  1. Resuspend pelotas do tecido em 1 mL do amortecedor frio do lysis (adicione 22 μL do cocktail do inibidor de proteína 50x (EDTA)-livre e 11 μL do inibidor de RNase a 1 mL do amortecedor do lysis).
    1. Resuspend duas pelotas UV-reticuladas e duas pelotas non-reticuladas por o grupo de experiências: UV-reticulado-1 pelotas para a biblioteca de eCLIP (UV-1); UV-crosslinked-2 pelotas para a biblioteca eCLIP (UV-2); Não-reticulado-1 pelotas para eCLIP biblioteca como um controle (não-UV); pelotas não-reticuladas-2 para o IP de IgG para demonstrar a especificidade dos anticorpos.
      Nota: o controle ideal para a biblioteca eCLIP do UV-crosslinked testes de tipo largo é o dos testículos de nocaute UV-reticulado de camundongos da mesma maca.
  2. Mantenha lise as amostras no gelo por 15 minutos (para impedir a degradação da proteína e do RNA).
  3. SONICATE em um sonicador digital em 10% de amplitude por 5 min, em 30 s on/30 s off. Coloque sempre a amostra no gelo e limpe a sonda com água sem nuclease entre cada amostra.
  4. Adicione 4 μL de DNase a cada tubo e misture bem. Incubar durante 10 min a 37 ° c, agitando a 1.200 rpm.
  5. Adicionar 10 μL de RNase I diluída (4 U/μL RNase I em PBS) e misturar bem. Incubar durante 5 min a 37 ° c, agitando a 1.200 rpm.
  6. Limpe o lisado por centrifugação a 15.000 x g durante 20 min (a 4 ° c).
  7. Colete cuidadosamente o sobrenadante. Deixar 50 μL de lisado e descartar o pellet com ele.
  8. Salvar amostras de insumos como RWB (executar para Western blot) e RRI (executar para isolamento de RNA). Poupe 20 μL (2%) de UV-1, UV-2, amostras não-UV e de IgG como entradas para o carregamento do gel de RWB. Poupe 20 μL (2%) de amostras UV-1 ou UV-2 como entradas para o carregamento de gel RRI.

4. imunoprecipitação

  1. Adicionar 1 mL do lisado (da etapa 3,7) às esferas (preparadas na secção 2) e rodar as amostras a 4 ° c durante 2 h ou durante a noite.
  2. Colete as contas com um suporte magnético e descarte o sobrenadante. Lave as contas duas vezes com 900 μL de tampão de sal elevado (50 mM Tris-HCl, pH 7,5; 1 M NaCl; 1 mM EDTA; 1% NP-40; 0,1% SDS; 0,5% Deoxycholate de sódio), e então lave contas duas vezes com 900 μL de tampão de lavagem (20 mM Tris-HCl, pH 7,5; 10 mM MgCl2; 0,2% Tween-20).
    Nota: Para a amostra de IgG, pause o procedimento aqui e armazene no gelo no tampão de lavagem.
  3. Lave os grânulos uma vez com 500 μL de tampão do desfosforilação 1x (10 milímetros Tris-HCl, pH 7,5; 5 milímetros MgCl2; 100 milímetros KCl; 0, 2% Triton X-100).

5. dephosphorylation de RNA 3 ' extremidades

  1. Colete as contas com um suporte magnético e descarte o sobrenadante. Remova o líquido residual usando pontas finas da pipeta. Adicionar 100 μl de mistura mestra de dephosphorilação (10 μL de tampão de desfosforilação 10x [100 mm Tris-HCl, pH 8,0; 50 mm MgCl2; 1 M KCl; 0,2% Triton X-100; 1 mg/ml albumina sérica bovina (BSA)]; 78 μL de água sem nuclease; 2 μL de inibidor de RNase; 2 μL de DNase; 8 μL de Al fosfatase de Kaline) a cada amostra, e incubar por 15 minutos em 37 ° c, agitando em 1.200 rpm.
  2. Adicionar 300 μL de mistura mestra de polinucleotídeo quinase (PNK) (60 μL de 5x PNK pH 6,5 tampão [350 mM Tris-HCl, pH 6,5; 50 mM MgCl2]; 223 μL de água sem nuclease; 5 μL de inibidor de RNase; 2 μL de DNase; 7 μL de enzima PNK; 3 μl de 0,1 M dithiothreitol) a cada amostra , incubar durante 20 min a 37 ° c, agitando a 1.200 rpm.
  3. Colete as contas com um suporte magnético e descarte o sobrenadante. Lave os grânulos uma vez com 500 μL de tampão de lavagem a frio. Em seguida, lave os grânulos uma vez com 500 μL de tampão de sal alto frio. Repita estas lavagens mais uma vez nesta ordem.
  4. Lave os grânulos uma vez com 500 μL do tampão da lavagem fria e então duas vezes com 300 μL do tampão frio da ligadura 1x (nenhum dithiothreitol, 50 milímetro Tris-HCl, pH 7,5; 10 milímetros MgCl2).

6. ligadura do adaptador do RNA às extremidades do RNA 3

  1. Descarte o sobrenadante e remova o líquido residual com pontas finas da pipeta. Adicionar 25 μL de 3 ' mistura mestra de ligadura a cada amostra. Misture cuidadosamente com pipetagem. Este passo é propenso a produzir bolhas.
    Nota: A mistura mestra de ligadura contém 3 μL de tampão de ligadura de 10x [500 mM Tris-HCl, pH 7,5; 100 mM MgCl2]; 9 μL de água sem nuclease; 0,4 μL de inibidor de RNase; 0,3 μL de 0,1 M ATP; 0,8 μL de dimetil sulfóxido (DMSO); 9 μL de 50% de polietileno glicol (PEG) 8000; 2,5 μL de ligase de RNA [30 U/μL].
  2. Adicionar 2,5 μL de RNA adaptador X1A (tabela 1) e 2,5 ΜL de RNA adaptador X1B (tabela 1) para cada amostra. Misture cuidadosamente com pipetagem ou flicking, e incubar por 75 min a 25 ° c, flicking para misturar a cada 10 min.
  3. Lave os grânulos uma vez com 500 μL de tampão de lavagem a frio (retomar a amostra de IgG aqui).
  4. Lave os grânulos uma vez com 500 μL de tampão de sal alto frio e, em seguida, com 500 μL tampão de lavagem a frio. Repita estas lavagens mais uma vez.
  5. Grânulos magneticamente separados, e remova o líquido residual com pontas finas da pipeta.
  6. Ressuspender os grânulos em 100 μL de tampão de lavagem a frio (Pause a amostra de IgG aqui e guarde no gelo no tampão de lavagem). Mova 20 μL para tubos novos como amostras de RWB. Separe magneticamente os restantes 80 μL como amostras de RRI. Retire o sobrenadante das amostras RRI e ressuspender as esferas em 20 μL de tampão de lavagem.
  7. Adicionar 37,5 μL de tampão de amostra do dodecil sulfate do lítio 4x (LDS) e 15 μl do agente de diminuição da amostra 10x à amostra de IgG. Adicionar 7,5 μL de tampão de amostra de 4x LDS e 3 μL de agente redutor de amostra 10x às amostras (restantes). (Não misture com pipetagem). Incubar durante 10 min a 70 ° c, agitando a 1.200 rpm. Esfrie no gelo por 1 minuto, e centrifugue em 1.000 x g por 1 minuto em 4 ° c.

7. SDS-página e transferência de membrana

  1. Carregar géis.
    1. Para o gel de RRI (gel da proteína do BIS-Tris de 4-12%, 10 poços, 1,5 milímetros) coloc os tubos em um ímã e a proteína separada eluato dos grânulos. Carregar 30 μL de amostra por poço. As amostras são espaçadas pelo marcador de tamanho de proteína pré-manchado.
    2. Para o gel de RWB (gel da proteína do BIS-Tris de 4-12%, 10 poços, 1,5 milímetros) coloc os tubos em um ímã e a proteína separada eluato dos grânulos. Carregar 15 μL de amostra por poço. Guarde as restantes amostras a-20 ° c como backups.
  2. Adicionar 500 μL de antioxidante a 500 mL de tampão de funcionamento de SDS 1x. Funcione em 200 V no tampão running do SDS 1x para o minuto 50 ou até que a parte dianteira da tintura esteja na parte inferior.
    Nota: Antioxidante contém N, N-dimetilformamida, bissulfito de sódio, que migra com proteínas reduzidas para evitar a reoxidação de aminoácidos sensíveis, como metionina e triptofano.
  3. Transferir complexos de proteína-RNA do gel para uma membrana de nitrocelulose a 10 V para 70 min em tampão 1xtransfer com 10% de metanol (Vol/Vol). Enxagúe a membrana RRI em PBS frio, enrole-a em plástico e armazene a-80 ° c.
  4. Bloqueie a membrana RWB em 5% de leite em TBST à temperatura ambiente durante 1 h. Enxague a membrana em TBST. Incubar com o anticorpo preliminar em TBST em 4 ° c durante a noite. Lave duas vezes com TBST por 5 min. Incubar com anticorpo secundário (1:5000 HRP cabra anti-Rabbit IgG) em TBST à temperatura ambiente durante 1 h. Lave três vezes com TBST por 5 min, 10 min e 15 min, respectivamente.
  5. Misturar volumes iguais de electroquimioluminescência (ECL) tampão A e tampão B, adicionar à membrana e incubar durante 1 min. Cubra a membrana com o envoltório plástico, e exponha-a a uma película de raio X na temperatura ambiente para o minuto 2-3. Em seguida, desenvolver o filme.
    Nota: O filme com superexposição mostrará claramente a forma das bordas da membrana, pela qual o filme pode ser alinhado de volta para a membrana RWB. Em seguida, alinhe as membranas RWB e RRI com base nas posições dos marcadores nele. Em camadas em ordem de baixo para cima são o filme, a membrana RWB e a membrana RRI em seqüência.

8. isolamento de RNA

  1. Corte a região da faixa da proteína a 75 kDa (aproximadamente 220 NT do RNA) acima dele, usando a membrana e a película de RWB como guias.
    Nota: Porque uma molécula proteína-protegida do RNA pode ter um comprimento máximo de 225 bases, com aproximadamente 340 da por a base, é razoável cortar a região aproximadamente 75 kDa acima da faixa de RBP para recuperar todos os complexos da proteína-RNA.
  2. Corte a parte extirpada da membrana em diversas fatias pequenas, e coloc as em um tubo de centrifugador fresco de 1,5 mL. Adicionar 200 μL de tampão de proteinase K (PK) (100 mM Tris-HCl pH 7,5; 50 mM NaCl; 10 mM EDTA) com 40 μL de PK para as peças da membrana. Misture e incubar durante 20 min a 37 ° c, agitando a 1.200 rpm.
  3. Adicionar 200 μL de tampão de ureia PK (100 mM Tris-HCl pH 7,4; 50 mM NaCl; 10 mM EDTA; 7 M ureia) a cada amostra. Incubar durante 20 min a 37 ° c, agitando a 1.200 rpm.
  4. Adicionar 400 μL de ácido fenol/clorofórmio/álcool isoamílico (25:24:1), misture bem e incubar durante 5 min a 37 ° c, agitando a 1.200 rpm.
  5. Coloc o tubo pesado do gel da fase do fechamento de 2 mL (PLG) no centrifugador e gire em 15.000 x g por 25 s.
  6. Transfira todo o conteúdo, exceto fatias de membrana para tubo pesado PLG. Incubar durante 5 min a 37 ° c, agitando a 1.200 rpm.
  7. Gire à temperatura ambiente e 15.000 x g por 15 min. Transfira a camada aquosa para um novo tubo cônico de 15 ml.
  8. Use as colunas de purificação e concentração de RNA para extrair RNA.
    1. Adicione 2 volumes (800 μL) do tampão de ligação do RNA a cada amostra (da etapa 8,7) e misture. Adicionar um volume igual (1200 μL) de 100% de etanol e mistura.
    2. Transferir 750 μL de amostra (da etapa 8.8.1) para as colunas de purificação e concentração de RNA em um tubo de coleta e centrifugação a 15.000 x g por 30 s. descarte o fluxo.
    3. Repita a etapa 8.8.2 até que todos os exemplos sejam passados através da coluna. Adicionar 400 μL de tampão de preparação de RNA à coluna e centrifugar a 15.000 x g durante 30 s. descarte o fluxo, aplique 700 μL de tampão de lavagem de RNA e centrifugue a coluna a 15.000 x g durante 30 s. descarte o fluxo.
    4. Adicionar 400 μL de tampão de lavagem de RNA à coluna e centrifugar a 15.000 x g durante 2 min. Transfira a coluna cuidadosamente para um novo tubo de 1,5 ml. Adicione 10 μL de água sem nuclease à matriz da coluna, deixe-se sentar por 2 min, e centrifugue em 15.000 x g por 30 s. Armazene amostras de eclip em-80 ° c até RT (etapa 11,1).

9. dephosphorylation de entrada RNA 3 ' extremidades

  1. Adicionar 15 μL de mistura mestra de dephosphorilação (2,5 μL de tampão de desfosforilação 10x [100 mm Tris-HCl, pH 8,0; 50 mm MgCl2; 1 M KCl; 0,2% Triton X-100; 1 mg/ml BSA]; 9,5 μL de água sem nuclease; 0,5 μL de inibidor de RNase; 2,5 μL de fosfatase alcalina) a 10 μL de amostras de entrada (a partir do passo 8.8.4). Incubar durante 15 min a 37 ° c, agitando a 1.200 rpm.
  2. Adicionar 75 μL de PNK Master Mix (20 μL de 5x PNK PH 6,5 tampão [350 mM Tris-HCl, pH 6,5; 50 mM MgCl2]; 44 μL de água sem nuclease; 1 μL de inibidor de RNase; 2 μL de DNase; 7 μL de enzima PNK; 1 μl de 0,1 M dithiothreitol) a amostras. Incubar durante 20 min a 37 ° c, agitando a 1.200 rpm.
  3. Limpeza do RNA de entrada
    1. Resuspend a extração de ácidos thenucleic magnética cristalina beadsin o frasco (Vortex para mais de 30 s). Adicione 20 μL de grânulos magnéticos de extração de ácidos nucleicos para cada amostra a novos tubos. Colete as contas com um suporte magnético e descarte o sobrenadante.
    2. Lave os grânulos uma vez com 1 mL de tampão de lise de purificação de RNA (tampão RLT). Coloque o tubo sobre um íman por 30 s e descarte o sobrenadante.
      Nota: A separação subseqüente de grânulos magnéticos da extração dos ácidos nucleicos seguiu esta etapa.
    3. Ressuspender os grânulos com 300 μL de tampão RLT e acrescentar à amostra. Adicionar 10 μL de 5 M de NaCl e 615 μL de 100% de álcool etílico (EtOH) e misturar por pipetagem. Gire à temperatura ambiente por 15 min. magneticamente separe os grânulos e remova o sobrenadante.
    4. Ressuspender os grânulos em 1 mL de EtOH de 75% e transferir para um novo tubo. Após 30 s, colete as contas com um suporte magnético e descarte o sobrenadante. Lave duas vezes com 75% EtOH, magneticamente separe os grânulos, e descarte o líquido residual com pontas finas da pipeta. Ar seco por 5 min (Evite a secagem excessiva).
    5. Resuspender os grânulos com 10 μL de água sem nuclease e incubatê-lo durante 5 min. magneticamente separar grânulos, e mover 5 μL de sobrenadante para um novo tubo (para 3 ' ligadura do adaptador abaixo). O RNA remanescente pode ser armazenado a-80 ° c como backups.

10. ligadura do adaptador do RNA à entrada RNA 3 ' extremidades

  1. Adicionar 1,5 μL de DMSO e 0,5 μL de adaptador RiL19 (tabela 1) a 5 ΜL de RNA de entrada (da etapa 9.3.5), incubar por 2 min a 65 ° c e colocar no gelo por mais de 1 min. adicionar 13,5 μL de 3 ' mistura mestra de ligadura a cada amostra , misture por pipetagem, e incubar para 75 min a 25 ° c, com flicking para misturar a cada 15 min.
    Nota: A ligadura Master Mix contém 2 μL de tampão de ligadura de 10x [500 mM Tris-HCl, pH 7,5; 100 mM MgCl2; 10 mm dithiothreitol]; 1,5 μL de água sem nuclease; 0,2 μL de inibidor de RNase; 0,2 μL de 0,1 M ATP; 0,3 μL de DMSO; 8 μL de 50% PEG8000; 1,3 μL de ligase de RNA [30 U/μL].
  2. Limpeza do RNA de entrada ligado
    1. Separe magneticamente 20 μL de grânulos magnéticos de extração de ácidos nucleicos para cada amostra e remova o sobrenadante. Lave os grânulos uma vez com 1 mL de tampão RLT.
    2. Ressuspender os grânulos em 61,6 μL de tampão RLT e suspensão de transferência para cada amostra. Adicionar 61,6 μL de 100% EtOH. Use a pipeta para misturar por 15 min a cada 5 min. magneticamente grânulos separados, e remover sobrenadante.
    3. Repita a etapa 9.3.4.
    4. Resuspend grânulos com 10 μL de água nuclease-livre, e deixe-o sentar-se por 5 minutos. magneticamente separar os grânulos e transferir 10 μL do sobrenadante para um novo tubo.
      Nota: Este é um ponto de parada possível (as amostras de entrada podem ser armazenadas em-80 ° c até o dia seguinte).

11. transcrição reversa, ligadura do adaptador do ADN ao cDNA 3 ' extremidades

  1. Adicionar 0,5 μL de primer RT (tabela 1) a 10 ΜL de RNA de entrada (a partir do passo 10.2.4) e 10 ΜL de RNA clip (do passo 8.8.4), respectivamente, incubar durante 2 min em bloco PCR pré-aquecido a 65 ° c, colocar no gelo por mais de 1 min.
  2. Adicionar 10 μL de RT Master Mix (2 μL de tampão RT [500 mM Tris-HCl, pH 8,3; 750 mM KCl; 30 mM MgCl2]; 4 μL de água sem nuclease; 0,3 μL de inibidor de RNase; 2 μl de 0,1 m dithiothreitol; 0,2 μl de 0,1 m dATP; 0,2 μl de 0,1 m dctp; 0,2 μL de 0,1 M dGTP; 0,2 μL de 0,1 M dTTP; 0,9 μL de transcriptase reversa) a cada amostra, misture, incubar a 55 ° c por 45 min em um bloco PCR pré-aquecido.
  3. Misture 20 μL de produto de reacção RT com 3,5 μL de reagente de limpeza do produto PCR. Incubar durante 15 min a 37 ° c.
  4. Adicionar 1 μL de 0,5 M EDTA, misturar com pipetagem. Adicionar 3 μL de 1 M de NaOH, misturar por pipetagem e incubar durante 12 min a 70 ° c num bloco PCR para hidrolisar o modelo RNA.
  5. Adicionar 3 μL de 1 M HCl, pipeta-misture para neutralizar o tampão.
  6. Limpeza do cDNA
    1. Separe magneticamente 10 μL de grânulos magnéticos de extração de ácido nucleico para cada amostra, retire o sobrenadante. Lave uma vez com 500 μL de tampão RLT.
    2. Ressuspender os grânulos em 93 μL de tampão RLT e suspensão de transferência para a amostra. Adicionar 111,6 μL de 100% EtOH, incubar-lo por 5 min, e misture a pipeta a cada 2 min. colete as contas com um suporte magnético e descarte o sobrenadante. Ressuspender os grânulos com 1 mL de EtOH de 80% e passar para um novo tubo.
    3. Após 30 s, colete as contas com um suporte magnético e descarte o sobrenadante. Lave duas vezes com 80% EtOH. Separe magneticamente e descarte o líquido residual com ponta fina. Ar seco por 5 min (Evite a secagem excessiva). Resuspender os grânulos em 5 μL de Tris-HCl de 5 mM e incubatê-lo durante 5 min.
  7. Adicionar 0,8 μL de adaptador de DNA (tabela 1) e 1 ΜL de DMSO às esferas, incubar por 2 min a 75 ° c. Coloque no gelo por mais de 1 min.
  8. Preparar 12,8 μL de mistura mestra de ligadura (2 μL de tampão de ligadura de 10x [500 mM Tris-HCl; 100 mM MgCl2; 10 mm dithiothreitol]; 1,1 μL de água sem nuclease; 0,2 μl de 0,1 M ATP; 9 μl de 50% PEG8000; 0,5 μL de LIGASE de RNA [30 U/μl]) , mexa a mistura, gire brevemente em uma centrífuga e adicione-a a cada amostra, mexa a amostra com a ponta da pipeta lentamente.
  9. Adicione outro 1 μL de ligase de RNA [30 U/μL] a cada amostra e mexa o dedo para misturar. Incubar durante 30 s a 25 ° c, agitando a 1.200 rpm. Incubar a 25 ° c durante a noite. Flick para misturar levemente 5 a 6 vezes, uma vez por hora.
  10. Limpeza de cDNA ligado
    1. Separe magneticamente 5 μL de grânulos magnéticos de extração de ácidos nucleicos para cada amostra e remova o sobrenadante.
    2. Lave uma vez com 500 μL de tampão RLT.
    3. Ressuspender grânulos em 60 μL de tampão RLT para grânulos e suspensão de transferência para cada amostra. Adicionar 60 μL de 100% EtOH, incubar-lo por 5 min e misture a pipeta a cada 2 min. magneticamente separado, descarte sobrenadante.
    4. Repita a etapa 9.3.4.
    5. Resuspend grânulos com 27 μL de Tris-HCl de 10 mM, incubar-lo por 5 min. magneticamente separado, e mova 25 μL de amostra para um novo tubo. Diluir o 1 μL de cDNA ligada com 9 μL de água sem nuclease num novo tubo. Guarde as restantes amostras a-20 ° c até ao passo 13,1.

12. quantificação do cDNA por PCR quantitativo em tempo real (qPCR)

  1. Adicionar 9 μL de mistura mestra de qPCR (5 μL de mistura mestre 2x; 3,6 μL de água sem nuclease; 0,4 μL de mistura de primer [10 μM PCR-F-D50X e 10 μM PCR-R-D70X]) a uma placa de qPCR de 96 poços. Adicionar 1 μL de 1:10 diluídos (em H2O) cDNA (a partir do passo 11.10.5), selar e misturar.
  2. Execute o programa de qPCR em um thermocycler: 2 minuto em 50 ° c; 2 min a 95 ° c; 3 s a 95 ° c seguidos de 30 s a 68 ° c para 40 ciclos; 15 s a 95 ° c seguido de 60 s a 68 ° c seguido de 15 s a 95 ° c durante 1 ciclo. Nota CT (limiar de ciclo) valor.

13. amplificação do PCR de cDNA

  1. Dispensar 35 μL de mistura mestra de PCR (25 μL de mistura mestra de PCR 2x; 5 μL de água sem nuclease; 5 μL de mistura de primer [20 μM PCR-F-D50X e 20 μM PCR-R-D70X]) em tiras de 8 poços. Para o grupo CLIP, adicionar 12,5 μL de amostra de CLIP + 2,5 μL de H2O; para o grupo de insumos, adicionar 10 μL de entradas + 5 μL de H2O. Misture bem e gire brevemente em centrífuga.
  2. Execute o programa PCR: 30 s a 98 ° c; 15 s a 98 ° c seguidos de 30 s a 68 ° c seguidos de 40 s a 72 ° c durante 6 ciclos; 15 s a 98 ° c seguido de 60 s a 72 ° c para N ciclos = (qPCR CT Values-3)-6; 60 s a 72 ° c; preensão de 4 ° c.
    Nota: É melhor executar 1 a 2 ciclos extra do PCR para os primeiros pares de grampos.

14. purificação de gel

  1. Carregue amostras em um gel de agarose de alta resolução de 3%. Deixando 1 poço vazio entre as amostras, e usar uma escada em ambos os lados do gel. Executar em 100 V para 75 min em 1x tampão Tris-borato-EDTA (TBE).
  2. iluminação de luz azul, corte de fatias de gel 175-350 BP usando lâminas de barbear frescas para cada amostra. Coloque-os em 15 mL de tubos cônicos.
    1. Pesar a fatia de gel, e elute o gel usando um kit de extração de gel.
    2. Adicionar 6x volumes de tampão dissolvendo gel para derreter o gel (100 mg gel = 600 μL de tampão de dissolução de gel). Dissolva o gel à temperatura ambiente. (Agitar para misturar a cada 15 min até que a fatia de gel esteja completamente dissolvida). Adicionar 1 volume de gel de 100% isopropanol e misture bem.
    3. Transferir 750 μL de amostra (da etapa 14.2.2) para a coluna em um tubo de coleta e centrifugar a 17.900 x g por 1 min. descarte o fluxo.
    4. Repita a etapa 14.2.3 até que todas as amostras tenham passado através da coluna, lave uma vez com 500 μL de tampão de dissolução do gel.
    5. Adicionar 750 μL de tampão de lavagem (do kit de extracção de gel) à coluna e centrifugar a 17.900 x g durante 1 min. descartar o caudal, girar a 17.900 x g durante 2 min. Coloque a coluna num novo tubo de 1,5 ml.
    6. Remova todo o tampão de lavagem restante da borda roxa plástica da coluna. Ar seco por 2 min. Adicionar 12,5 μL de água sem nuclease ao centro da membrana. Deixe a coluna ficar por 2 min em temperatura ambiente e gire em 17.900 x g por 1 min (para um rendimento melhorado, repita a etapa de eluição).

15. TOPO clone do produto PCR

  1. Prepare a mistura de reação de clonagem do TOPO (1 μL de produto de PCR do passo 14.2.6; 1 μL de mistura de clonagem; 3 μL de água estéril). Misture suavemente e incubar durante 5 min a 20-37 ° c. Esfrie no gelo.
  2. Thaw quimicamente competentes E. coli bactérias no gelo. Adicionar 5 μL do produto de clonagem TOPO a 100 μL de bactérias competentes29. Misture suavemente bem. Incubar no gelo por 30 min.
  3. Calor-choque para 60 s em 42 ° c. Em seguida, arrefecer no gelo durante 2 min. Adicionar 900 μL de caldo de lisogenia (LB), incubar a 37 ° c durante 1 h, agitando a 225 rpm. Girar a 1.000 x g por 1 min e, em seguida, remover 900 μL de sobrenadante. Resuspend o resto da solução.
  4. Placa de bactérias transformadas em 1,5% LB placas de agar contendo ampicilina (100 μg/mL), e incubar durante a noite a 37 ° c.
  5. Prepare pelo menos 20 tubos de centrífuga de 1,5 mL para cada constructo. Encha um conjunto com 500 μL de meio LB contendo 100 μg/mL de ampicilina. Use uma ponta de pipeta estéril para arranhar uma colônia bacteriana aleatoriamente e misture (por pipetagem) com 500 μL de meio LB. Incubar a 37 ° c durante 5 h, agitando a 225 rpm.
  6. Sequenciar o fragmento de pastilha usando o primer reverso M13: CAGGAAACAGCTATGAC por Sanger seqüenciamento30.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

O procedimento eclip e os resultados são ilustrados na figura 1, figura 2, figura 3, Figura 4. Camundongos foram eutanasiados com dióxido de carbono e uma pequena incisão foi feita no abdome inferior por meio de tesoura cirúrgica (Figura 2a,B). Os testículos do camundongo foram removidos, desligados e então reticulados por UV após a moagem (Figura 2C-I). Os resultados representativos de eCLIP de usar dois helicases conhecidos do RNA-emperramento em tecidos do testis são descritos em Figura 3 e 4. Nós executamos MOV10 eCLIP nos testículos dos ratos Wild-Type adultos, com concentração comum de 40 U/mL de RNase I que trata o lysate reticulado. O painel superior da Figura 3a mostra que a proteína alvo de tamanho aproximadamente 114 kDa foi enriquecida com sucesso. O borrão ocidental das proteínas MOV10L1 Immunoprecipitated foi executado com as duas concentrações (5 ou 40 U/mL) de RNase I durante o processo de eCLIP (Figura 3a). A Figura 3B mostra qpcr usando 1:10 cDNA diluído (já ligado com adaptador de DNA) de MOV10 e MOV10L1 UV-crosslinked, não-reticulado, e a amostra de entrada combinada de tamanho emparelhada (SMInput). Amostras não reticuladas mostram diminuição da recuperação do RNA. Observou-se que os valores de TC do grupo não reticulado foram, em geral, 5 vezes mais do que o grupo reticulado por UV. A figura 4a mostra a amplificação do PCR e a seleção do tamanho através da electroforese do gel do agarose (corte 175-350 BP). Primer-dímero produto aparece em cerca de 140 BP. Figura 4B mostra a visão do navegador do genoma UCSC de duas sequências subclone representativas. MOV10-Bound eCLIP Tags são encontrados para ser localizado dentro do 3 ' UTR do gene FTO; A taxa aproximada de 3 ' metas UTR responde por 75% (Figura 4C), consistente com a maioria dos alvos MOV10 em células HEK29310 e em testículos (dados não mostrados). Por outro lado, MOV10L1-Bound eCLIP marcas são encontradas para ser localizado dentro de um cluster piRNA indicando MOV10L1 alvos piRNA precursores. A taxa aproximada de metas precursoras de piRNA responde por 42% (Figura 4E), o que reflete uma tendência do nosso anterior experimento clip convencional20. MOV10L1 eCLIP com 40 U/mL RNase I a digestão produz relativamente mais sequências com menos de 20 BP (Figura 4D).

Figure 1
Figura 1 : Representação esquemática do eCLIP. Os túbulos seminíferos UV-cruzados do rato (etapa 1) são lisados no tampão do lysis de eclip e sonicated (etapa 2). O lisado é tratado com RNase I para fragmentar RNA, após o qual os complexos proteína-RNA são imunoprecipitados usando o anticorpo anti-RBP (etapa 3-4). A dephosphorylation de fragmentos do RNA e a ligadura do adaptador do RNA 3 ′ são executadas (etapa 5-6). Os complexos proteína-RNA são executados em um gel SDS-PAGE e transferidos para as membranas de nitrocelulose (etapa 7). O RNA é recuperado da membrana digerindo a proteína com proteinase K e Urea que deixa um polypeptide curto que permanece no local do Crosslink. Dephosphorylation de fragmentos do RNA de amostras da entrada e da ligadura do adaptador do RNA de 3 ′ é executado (etapa 8). Realize RT de RNA e ligadura do adaptador de DNA de 3 ′ (passo 9-10). Realize a amplificação do PCR da biblioteca do cDNA, da extração do gel, e do clonagem do Blunt-end PCR para o controle preliminar da qualidade da biblioteca (etapa 11). Finalmente, execute o sequenciamento de alta taxa de transferência (etapa 12). Estale por favor aqui para ver uma versão maior desta figura.

Figure 2
Figura 2 : Colheita do tecido do testis e reticulação UV. (A) a exposição do abdômen do rato. (B) uma incisão de 0,5 cm na parede abdominal expondo o peritônio. (C) um par de testículos são retirados puxando para fora as almofadas de gordura. (D) o tecido testicular é retirado e colocado em um pequeno prato contendo PBS frio. (E) retire suavemente a túnica albuginea. (F) Pressione o pilão solto para triturar o tecido em um moedor de tecido dounce. (G) túbulos seminíferos distribuídos em uma placa de 10 cm. (H) reticulação UV com 400 MJ/cm2 energia. (I) as amostras cruzadas são coletadas em 1,5 tubos de centrífuga ml. Estale por favor aqui para ver uma versão maior desta figura.

Figure 3
Figura 3 : Resultados representativos de MOV10 e MOV10L1 eCLIP. (A) Western blot validação de MOV10 e MOV10L1 imunoprecipitados. (B) qpcr em 1:10 bibliotecas eclip DILUÍDAS de MOV10 e MOV10L1, com repetições para amostras de UV, não-UV e SMInput pareadas. Estale por favor aqui para ver uma versão maior desta figura.

Figure 4
Figura 4 : preparação da biblioteca eclip e avaliação da qualidade. (A) as imagens do gel da amplificação do PCR são mostradas. O asterisco indica o dímero da primeira demão. A linha pontilhada vermelha indica regiões extirpada para o produto do PCR do cDNA, em algum lugar entre 175 e 350 BP. (B) opinião do navegador do genoma de UCSC de duas seqüências representativas do subclone31. (C) análise de sequenciamento de subclone em pequena escala de MOV10. (D) as etiquetas MOV10L1-Bound indicam testes padrões distintos da distribuição do comprimento quando processados por duas concentrações diferentes de RNase. (E) análise de sequenciamento de subclone em pequena escala de MOV10L1. Estale por favor aqui para ver uma versão maior desta figura.

Nome da sequência Informações de sequência Descrição
Adaptadores de RNA
RNA X1A /5Phos/AUAUAGGNNNNNAGAUCGGAAGAGCGUCGUGUAG/3SpC3/ estoque em 200 μM; trabalhando a 20 μM
RNA X1B /5Phos/AAUAGCANNNNNAGAUCGGAAGAGCGUCGUGUAG/3SpC3/ estoque em 200 μM; trabalhando a 20 μM
RiL19 /5phos/AGAUCGGAAGAGCGUCGUG/3SpC3/ estoque em 200 μM; trabalhando em 40 μM
Adaptador do ADN
Rand103tr3 /5Phos/NNNNNNNNNNAGATCGGAAGAGCACACGTCTG/3SpC3/ estoque em 200 μM; trabalhando em 80 μM
Primer RT
AR17 ACACGACGCTCTTCCGA estoque em 200 μM; trabalhando a 20 μM
Primers de PCR

PCR-F-D 501
AATGATACGGCGACCACCGAGATCTACACTATAGCCTACACTCTTTCCCTACACGACGCTCTTCCGATCT estoque em 100 μM; trabalhando a 20 μM
PCR-R-D 701 CAAGCAGAAGACGGCATACGAGATCGAGTAATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC estoque em 100 μM; trabalhando a 20 μM
(Consulte a carta de serviço ao cliente Illumina para D502-508, D702-712)

Tabela 1: seqüências do adaptador e da primeira demão. O adaptador contém um em-linha aleatório-Mer (ou N5 ou N10) para determinar se duas leituras seqüenciais idênticas indicam dois fragmentos originais do RNA ou duplicatas do PCR do mesmo fragmento do RNA. "5 Phos" significa 5 ' fosforilação, que é necessário se um oligo é usado como um substrato para a ligase de DNA/RNA. "3SpC3" carrinhos para o espaçador de 3 ' C3, que pode impedir a ligadura entre adaptadores.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Com a compreensão crescente do papel universal de rbps contextos biológicos e patológicos, os métodos do grampo foram utilizados extensamente para revelar a função molecular de rbps20,32,33, 34,35. O protocolo descrito aqui representa uma aplicação adaptada do método de eCLIP ao testis do rato.

Um desafio em executar eCLIP no testis está mantendo a viabilidade e a integridade de pilhas testicular frescas, que é igualmente importante para crosslinking eficaz. Cortando o testis com a força mecânica suave usando o pilão frouxo pode impedir o lysis32da pilha,36. A digestão apropriada do RNA é igualmente crítica para ensaios bem sucedidos de eCLIP. Os fragmentos do RNA podiam ser mais convergentes após a digestão, mas o comprimento menos de 20 BP pode ser removido através do Pre-Processing da biblioteca lê. A fim adotar uma dosagem ideal de RNase para um candidato de RBP, nós sugerimos um teste preliminar baseado nos resultados do sequenciamento subclone das bibliotecas de eCLIP que podem ser preparadas pelo tratamento de RNase com as concentrações que variam de 0 você a 40 U (por mililitro do lysate). A análise de sequenciamento de subclone em pequena escala é uma etapa recomendada para um exame confiável da qualidade da biblioteca em nosso método eCLIP. Em primeiro lugar, a percentagem de inserções inferiores a 20 BP não deve ser demasiado elevada, ou, o subsequente pré-processamento da biblioteca eCLIP causará uma perda dispendiosa de leituras. Em segundo lugar, a eficiência da ligadura correta de ambos os adaptadores deve ser verificada. As amostras substandard podem ser eliminadas sem sequenciamento profundo para garantir um sequenciamento profundo bem-sucedido, cujos resultados geralmente demoram muito mais para analisar.

Embora a viabilidade de eCLIP no testis do rato seja limitada ainda pela especificidade do anticorpo para a etapa da imunoprecipitação, eCLIP é vantajoso sobre métodos convencionais do grampo em diversos aspectos. Primeiro, é um método não-radioativo. Por eCLIP, os alvos do RNA de RBPs são capturados diretamente in vivo sem ter que recorrer às técnicas labor-intensivas usando materiais radioactivos. Em segundo lugar, o método é menos tempo intensivo. Todo o procedimento leva apenas 4 dias através da preparação da biblioteca eCLIP. Terceiro, diversidade de sequências. Comparado com o ciclo unificado convencional da amplificação de 25-35 ciclos, eclip refere os valores do CT de qPCR para ajustar especificamente o número de ciclos do PCR. Por último, fornece uma relação sinal-ruído mais forte. A entrada com correspondência de tamanho serve como um plano de fundo apropriado para alvos autênticos.

Em resumo, nossos resultados do eCLIP consolidam as conclusões que MOV10 e MOV10L1 têm uma preferência obrigatória aos precursores UTR e piRNA de mRNA 3, respectivamente. O protocolo descrito neste documento representa o primeiro emprego do método eCLIP na reprodução, uma área em que o conhecimento de interação RNA-RBP é bastante insuficiente, embora estudos genéticos tenham fornecido amplas informações sobre os papéis biológicos de RBPs. a visualização deste protocolo de eCLIP pode ajudar a guiar suas aplicações difundidas em áreas mais largas.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Os autores não têm nada a divulgar.

Acknowledgments

Agradecemos a Eric L Van Nostrand e a Gene W Yeo por uma orientação útil com o protocolo original. K.Z. foi apoiado pelo programa nacional da chave R & D de China (2016YFA0500902, 2018YFC1003500), e Fundação Nacional da ciência natural de China (31771653). Ly foi apoiado pela National natural Science Foundation da China (81471502, 31871503) e programa inovador e empreendedor da província de Jiangsu.

Materials

Name Company Catalog Number Comments
Antibodies
Anti-mouse MOV10  antibody Proteintech, China 10370-1-AP
Anti-mouse MOV10L1 antibody Zheng et al.20109 polyclonal antisera UP2175 provided by P. Jeremy Wang lab, University of Pennsylvania
HRP Goat Anti-Rabbit IgG  ABclonal AS014
Rabbit IgG Beyotime, China A7016
Equipment
Centrifuge Eppendorf, Hamburg, Germany 5242R
Digital sonifier BRANSON,USA BBV12081048A 450 Watts; 50/60 Hz
DynaMag-2 Magnet Invitrogen,USA 12321D
Mini Blot Module Invitrogen,USA B1000
Mini Gel Tank Invitrogen,USA A25977
Shaking incubator Eppendorf, Hamburg, Germany Thermomixer comfort 
Tissue Grinder, Dounce PYREX, USA 1234F35 only  the "loose" pestle is used in this protocol
TProfessional standard 96 Gradient Biometra, Germany serial no.: 2604323
Tube Revolver  Crystal, USA serial no.: 3406051
UV-light cross-linker UVP, USA CL-1000
Materials
TC-treated Culture Dish Corning, USA 430167 100 mm 
Tubes Corning, USA 430791 15 mL
Microtubes tubes AXYGEN , USA MCT-150-C 1.5 mL 
Reagents 
Acid phenol/chloroform/isoamyl alcohol  Solarbio, China P1011 25:24:01
AffinityScript Enzyme Agilent, USA 600107
Antioxidant Invitrogen,USA NP0005
DH5α competent bacteria Thermo Scientific, USA 18265017 these economical cells yield >1 x 106 transformants/µg control DNA per 50 µL reaction.
DMSO Sigma-Aldrich, USA D8418
DNA Ladder Invitrogen, USA 10416014
dNTP Sigma-Aldrich, USA DNTP100-1KT
Dynabeads Protein A  Invitrogen, USA 10002D
ECL reagent Vazyme, China E411-04
EDTA Invitrogen, USA AM9260G
EDTA free protease inhibitor cocktail Roche, USA 04693132001 add fresh
Exo-SAP-IT Affymetrix, USA 78201 PCR Product Cleanup Reagent 
FastAP enzyme Thermo Scientific, USA EF0652
LDS Sample Buffer Thermo Scientific, USA NP0007
MetaPhor Agarose  lonza, Switzerland 50180
MgCl2 Invitrogen, USA AM9530G
MiniElute gel Extraction QIAGEN, Germany 28604 column store at 4 ?; buffer QG=gel dissolving buffer; buffer PE= wash buffer(for step 14)
MyONE Silane beads Thermo Scientific, USA 37002D nucleic acids extraction magnetic beads
NaCl Invitrogen,USA AM9759
 
NP-40 Amresco, USA M158-500ML
NuPAGE Bis-Tris Protein Gels Invitrogen, USA NP0336BOX 4%–12%,1.5 mm, 15-well
NuPAGE MOPS SDS Buffer Kit  Invitrogen, USA NP0050
PBS Gibco, USA 10010023
Phase-Locked Gel (PLG) heavy tube   TIANGEN, China WM5-2302831
PowerUp SYBR Green Master Mix Applied Biosystems, USA A25742
Proteinase K NEB, New England  P8107S
Q5 PCR master mix  NEB, New England  M0492L
RLT buffer QIAGEN, Germany 79216 RNA purification lysis buffer 
RNA Clean & Concentrator-5 columns  ZYMO RESEARCH, USA R1016 RNA purification and concentration columns
RNase I  Invitrogen, USA AM2295
RNase Inhibitor Promega, USA N251B
RQ1 DNase Promega,USA M610A
Sample Reducing Agent Invitrogen,USA NP0009
SDS Solution Invitrogen, USA 15553027 10%
Sodium deoxycholate Sigma-Aldrich, USA 30970 protect from light
T4 PNK enzyme NEB, New England  M0201L
T4 RNA ligase 1 high conc NEB, New England  M0437M
TA/Blunt-Zero Cloning Mix Vazyme, China C601-01
TBE Invitrogen,USA AM9863
Tris-HCI Buffer Invitrogen, USA 15567027
Triton X-100 Sangon Biotech, China A600198 
Tween-20 Sangon Biotech, China A600560
Urea Sigma-Aldrich, USA U5378
X-ray Films Caresteam, Canada 6535876

DOWNLOAD MATERIALS LIST

References

  1. Turner, J. M., Mahadevaiah, S. K., Ellis, P. J., Mitchell, M. J., Burgoyne, P. S. Pachytene asynapsis drives meiotic sex chromosome inactivation and leads to substantial postmeiotic repression in spermatids. Developmental Cell. 10, (4), 521-529 (2006).
  2. Turner, J. M. A. Meiotic sex chromosome inactivation. Development. 134, (10), 1823-1831 (2007).
  3. Kimmins, S., Sassone-Corsi, P. Chromatin remodelling and epigenetic features of germ cells. Nature. 434, (7033), 583-589 (2005).
  4. Ule, J., et al. CLIP identifies Nova-regulated RNA networks in the brain. Science. 302, (5648), 1212-1215 (2003).
  5. Ule, J., Jensen, K., Mele, A., Darnell, R. B. CLIP: a method for identifying protein-RNA interaction sites in living cells. Methods. 37, (4), 376-386 (2005).
  6. Trifillis, P., Day, N., Kiledjian, M. Finding the right RNA: identification of cellular mRNA substrates for RNA-binding proteins. RNA. 5, (8), 1071-1082 (1999).
  7. Tenenbaum, S. A., Carson, C. C., Lager, P. J., Keene, J. D. Identifying mRNA subsets in messenger ribonucleoprotein complexes by using cDNA arrays. Proceedings of National Acadamy of Sciences U S A. 97, (26), 14085-14090 (2000).
  8. Chi, S. W., Zang, J. B., Mele, A., Darnell, R. B. Argonaute HITS-CLIP decodes microRNA-mRNA interaction maps. Nature. 460, (7254), 479-486 (2009).
  9. Zheng, K., et al. Mouse MOV10L1 associates with Piwi proteins and is an essential component of the Piwi-interacting RNA (piRNA) pathway. Proceedings of National Acadamy of Sciences U S A. 107, (26), 11841-11846 (2010).
  10. Gregersen, L. H., et al. MOV10 Is a 5' to 3' RNA helicase contributing to UPF1 mRNA target degradation by translocation along 3' UTRs. Molecular Cell. 54, (4), 573-585 (2014).
  11. Banerjee, S., Neveu, P., Kosik, K. S. A coordinated local translational control point at the synapse involving relief from silencing and MOV10 degradation. Neuron. 64, (6), 871-884 (2009).
  12. Choi, J., Hwang, S. Y., Ahn, K. Interplay between RNASEH2 and MOV10 controls LINE-1 retrotransposition. Nucleic Acids Research. 46, (4), 1912-1926 (2018).
  13. Goodier, J. L., Cheung, L. E., Kazazian, H. H. Jr MOV10 RNA helicase is a potent inhibitor of retrotransposition in cells. PLoS Genetics. 8, (10), e1002941 (2012).
  14. Haussecker, D., et al. Capped small RNAs and MOV10 in human hepatitis delta virus replication. Nature Structural & Molecular Biology. 15, (7), 714-721 (2008).
  15. Kenny, P. J., et al. MOV10 and FMRP regulate AGO2 association with microRNA recognition elements. Cell Reports. 9, (5), 1729-1741 (2014).
  16. Messaoudi-Aubert, S. E., et al. Role for the MOV10 RNA helicase in Polycomb-mediated repression of the INK4a tumor suppressor. Nature Structural & Molecular Biology. 17, (7), 862-868 (2010).
  17. Sievers, C., Schlumpf, T., Sawarkar, R., Comoglio, F., Paro, R. Mixture models and wavelet transforms reveal high confidence RNA-protein interaction sites in MOV10 PAR-CLIP data. Nucleic Acids Research. 40, (20), e160 (2012).
  18. Skariah, G., et al. Mov10 suppresses retroelements and regulates neuronal development and function in the developing brain. BMC Biology. 15, (1), 54 (2017).
  19. Zheng, K., Wang, P. J. Blockade of pachytene piRNA biogenesis reveals a novel requirement for maintaining post-meiotic germline genome integrity. PLoS Genetics. 8, (11), e1003038 (2012).
  20. Vourekas, A., et al. The RNA helicase MOV10L1 binds piRNA precursors to initiate piRNA processing. Genes & Development. 29, (6), 617-629 (2015).
  21. Hocq, R., Paternina, J., Alasseur, Q., Genovesio, A., Le Hir, H. Monitored eCLIP: high accuracy mapping of RNA-protein interactions. Nucleic Acids Research. 46, (21), 11553-11565 (2018).
  22. Huppertz, I., et al. iCLIP: protein-RNA interactions at nucleotide resolution. Methods. 65, (3), 274-287 (2014).
  23. Hafner, M., et al. Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 141, (1), 129-141 (2010).
  24. Hafner, M., et al. PAR-CliP--a method to identify transcriptome-wide the binding sites of RNA binding proteins. Journal of Visualized Experiments. (41), (2010).
  25. Konig, J., et al. iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nature Structural & Molecular Biology. 17, (7), 909-915 (2010).
  26. Konig, J., et al. iCLIP--transcriptome-wide mapping of protein-RNA interactions with individual nucleotide resolution. Journal of Visualized Experiments. (50), (2011).
  27. Maticzka, D., Ilik, I. A., Aktas, T., Backofen, R., Akhtar, A. uvCLAP is a fast and non-radioactive method to identify in vivo targets of RNA-binding proteins. Nature Communications. 9, (1), 1142 (2018).
  28. Van Nostrand, E. L., et al. Robust transcriptome-wide discovery of RNA-binding protein binding sites with enhanced CLIP (eCLIP). Nature Methods. 13, (6), 508-514 (2016).
  29. Radulovich, N., Leung, L., Tsao, M. S. Modified gateway system for double shRNA expression and Cre/lox based gene expression. BMC Biotechnology. 11, 24 (2011).
  30. Breunig, C. T., et al. A Customizable Protocol for String Assembly gRNA Cloning (STAgR). Journal of Visualized Experiments. (142), (2018).
  31. Kuhn, R. M., Haussler, D., Kent, W. J. The UCSC genome browser and associated tools. Briefings in Bioinformatics. 14, (2), 144-161 (2013).
  32. Vourekas, A., et al. Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis. Nature Structural & Molecular Biology. 19, (8), 773-781 (2012).
  33. Preitner, N., et al. APC is an RNA-binding protein, and its interactome provides a link to neural development and microtubule assembly. Cell. 158, (2), 368-382 (2014).
  34. Meyer, C., et al. The TIA1 RNA-Binding Protein Family Regulates EIF2AK2-Mediated Stress Response and Cell Cycle Progression. Molecular Cell. 69, (4), 622-635 (2018).
  35. Gerstberger, S., Hafner, M., Tuschl, T. A census of human RNA-binding proteins. Nature Reviews Genetics. 15, (12), 829-845 (2014).
  36. Vourekas, A., Mourelatos, Z. HITS-CLIP (CLIP-Seq) for mouse Piwi proteins. Methods in Molecular Biology. 1093, 73-95 (2014).
Método avançado da imunoprecipitação da reticulação (eCLIP) para a identificação eficiente do RNA proteína-ligado no testis do rato
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Xu, Q., Wang, C., Ling, L., Yue, Q., Liu, M., Zhang, S., Fu, K., Ye, L., Zheng, K. Enhanced Crosslinking Immunoprecipitation (eCLIP) Method for Efficient Identification of Protein-bound RNA in Mouse Testis. J. Vis. Exp. (147), e59681, doi:10.3791/59681 (2019).More

Xu, Q., Wang, C., Ling, L., Yue, Q., Liu, M., Zhang, S., Fu, K., Ye, L., Zheng, K. Enhanced Crosslinking Immunoprecipitation (eCLIP) Method for Efficient Identification of Protein-bound RNA in Mouse Testis. J. Vis. Exp. (147), e59681, doi:10.3791/59681 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter