Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Biology

Gelişmiş Crosslinking Immünoprecipitation (eCLIP) fare testis protein bağlı RNA verimli tanımlaması için yöntem

doi: 10.3791/59681 Published: May 10, 2019
* These authors contributed equally

Summary

Burada, testis 'teki RBP adaylarının büyük RNA hedeflerini belirlemek için bir eCLIP Protokolü sunuyoruz.

Abstract

Spermatogenesis, memelilerde erkek germ hücresi farklılaşma yüksek sipariş edilen bir süreç tanımlar. Testis, transkripsiyon ve çeviri unoupled, RBPs tarafından düzenlenmiş Gen ifadesinin Post-transcriptional düzenleme önemini vurgulayarak. Bir RBP 'nin mekanik rollerini yenilemek için, endojen doğrudan RNA hedeflerini yakalamak ve gerçek etkileşim sitelerini tanımlamak için çapraz bağlama immünopresipitasyon (CLIP) metodolojisi kullanılabilir. Gelişmiş CLıP (eCLIP), geleneksel klipler üzerinde çeşitli avantajlar sunan yeni geliştirilen bir yöntemdir. Ancak, eCLIP kullanımı şimdiye kadar genişletilmiş uygulamalar için arama, hücre hatları ile sınırlı olmuştur. Burada, biz MOV10 ve MOV10L1, iki RNA-bağlayıcı helicases, fare testis okumak için eCLIP istihdam. Beklendiği gibi, biz MOV10 ağırlıklı olarak mRNA 3 ' tercüme edilmemiş bölgelere (UTRs) bağlar ve MOV10L1 seçmeli olarak Piwi-etkileşim RNA (piRNA) öncüsü transkriptler bağlar bulabilirsiniz. ECLIP yöntemimiz, alt klonların küçük ölçekli sıralaması ve böylece nitelikli kütüphanelerin kullanılabilirliği ile çeşitli RBPs 'lerin bağlı olduğu büyük RNA türlerinin hızlı bir şekilde belirlenmesini sağlar ve bu da derin sıralamaya devam etmek için bir emir olarak kullanılabilir. Bu çalışma, memeliyen testis içinde eCLIP için geçerli bir temel kurar.

Introduction

Mammalian testis bir karmaşık hücre farklılaşma programı cyclically çok sayıda spermatozoa verim çalışır burada mükemmel bir gelişimsel model temsil eder. Bu modelin benzersiz bir değeri, genellikle Mayoz bölünmenin seks kromozom inaktivasyonu (MSCI)1,2 ve yuvarlak spermatids geçmesi zaman oluşur spermatogenesis belirli aşamalarında transkripsiyonel inaktivasyonu ortaya çıkması yatıyor spermiogenesis sırasında şiddetli nükleer sıkıştırma3. Bu ardışık transkripsiyonel olaylar, RNA bağlayıcı proteinlerin (rbps) transscriptome şekillendirme ve Erkek fertilitesini sürdürmek için önemli bir rol oynadığı transkripsiyon sonrası gen düzenlemesini gerektirmektedir.

Tek bir RBP in vivo ın bona fide RNA hedeflerini belirlemek için, çapraz immünoprecipitation (klip) yöntemi4,5, dayalı ancak normal RNA immünoprecipitation (RIP), istinaden geliştirilmiştir5/6 , ultraviyole (UV) Crosslinking, sıkı yıkama ve jel transferi dahil olmak üzere önemli adımlar eklenmesi ile sinyal özgüllüğü geliştirmek için. KLIBIN yüksek verimlilik sıralaması ile birlikte gelişmiş uygulaması, genom çapında8düzeylerinde PROTEIN-RNA etkileşiminin profiline büyük ilgi yarattı. RBP fonksiyonunda genetik çalışmalarda ek olarak, endojen proteinin ve RNA 'nın doğrudan etkileşimlerini belirleyen bu tür biyokimyasal Yöntemler, RBPs 'in RNA düzenleyici rollerini doğru bir şekilde elükte etmek için vazgeçilmez olmuştur. Örneğin, MOV10L1 erkek fertilite ve Piwi etkileşim RNA (piRNA) biyogenesis9için gerekli olan bir TESTIS özgü RNA helikaz olduğunu. Onun Parme MOV10 RNA biyoloji10,11,12,13,14 birden fazla açıdan roller ile bir her yerde ifade ve çok fonksiyonlu RNA helikazı olarak bilinir , 15 , 16 , 17 , 18. geleneksel klip-Seq istihdam ederek, biz MOV10L1 bağlar ve erken Pirna işleme19,20başlatmak için birincil Pirna öncüleri düzenler ve MOV10 mRNA 3 ' utrs ve yanı sıra kodlamayan RNA bağlar bulundu Testis germ hücrelerinde türler (veri gösterilmez).

Yine de, CLıP orijinal bir zahmetli, radyoaktif prosedür KLIPS etiketleri dikkat çekici bir kaybı ile dizi kitaplık hazırlama izledi. Geleneksel KLIPS 'de, her iki RNA ekstremitesinde birleştirilmiş adaptörler kullanılarak cDNA Kütüphanesi hazırlanır. Protein sindirimi sonrasında, çapraz bağlantılı kısa polipeptit RNA parçalarına bağlı kalır. Bu çapraz işareti kısmen blok ters transkriptaz (rtase) ilerlemesi cDNA sentezi sırasında, yaklaşık 80% cDNA Kütüphanesi21,22temsil eden kesilmiş cdnas sonuçlanan. Bu nedenle, yalnızca cDNA parçaları (okuma-through) çapraz bağlantı sitesi atlayarak RTase kaynaklanan sıralanmış. Son zamanlarda, PAR-CLıP, ıclip, eCLIP ve uvCLAP gibi çeşitli CLıP yaklaşımlar, yaşam hücrelerinde RBPs Crosslink sitelerini tanımlamak için istihdam edilmiştir. PAR-CLıP 365 Nm UV radyasyon ve photoactivatable nüklitid analogları uygulama içerir ve bu nedenle içinde-kültür yaşam hücrelerine özeldir, ve yeni sentezlenmiş transkriptler içine nükliside analogların birleşmesi önyargı üreten eğilimli RNA fiziksel olarak protein23,24ile etkileşime girer. Iclip 'de, sadece tek bir adaptör, çapraz bağlı RNA parçalarının 3 ' ekstremite için bağlanır. Ters transkripsiyon (RT) sonrasında, hem kesilmiş hem de okunan cdnas, intramolecularly döngülü ve yeniden doğruylama ile polimeraz zincir reaksiyonu (PCR) amplifikasyonu tarafından elde edilir25,26. Ancak, intramoleküler devre verimliliği nispeten düşüktür. Eski CLIP protokolleri bir radyoizotop ile çapraz bağlı RNA etiketleme gerekir rağmen, ultraviyole çapraz ve yakınlık arıtma (uvclap), sıkı tandem benzeşme arıtma bir süreç ile, radyoaktivite27güvenmez. Yine de, uvclap tandem benzeşimi arıtma için 3x Flag-HBH etiketini taşıyan ifade vektörü ile transfekte olmalıdır kültürlü hücreler ile sınırlıdır.

ECLIP 'de, adaptörler ilk olarak RNA 'nın 3 ' ekstremite altında RT 'nin ardından, sonra da cDNAs 'ın 3 ' ekstremite içinde moleküllü bir modda bağlanıldı. Bu nedenle, eCLIP tüm kesilmiş ve okunan cDNA28ile yakalamak mümkün. Ayrıca, ne radyoaktif etiketleme sınırlıdır, ne de kendi ilkesine göre hücre hatları kullanarak, tek nüklemotid çözünürlüğü korurken.

Burada, fare testis için uyarlanmış bir eCLIP protokolünün adım adım açıklamasını sağlıyoruz. Kısaca, bu Eclip protokolü, testis tübüllerin UV çapraz ile başlar, kısmi RNase sindirim ve immünoprecipitation bir protein özgü antikor kullanarak izledi. Sonra, protein bağlı RNA dephosphorylated, ve adaptör 3 ' sonuna bağlanır. Protein jeli Elektroforez ve jel-membran transferinden sonra RNA, beklenen bir boyut aralığının membran alanını keserek izole edilir. RT sonra, DNA adaptörü PCR amplifikasyon tarafından izlenen cDNA 3 ' sonuna bağlandı. Yüksek verimlilik sıralamasının öncesinde subklonlar taraması Kütüphane kalite kontrolü olarak alınır. Bu protokol, iki testis ifade RNA helikazlar MOV10L1 ve MOV10 tarafından örneklenmiş rbps protein bağlı RNA büyük türlerin belirlenmesi, etkilidir.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Yapılan tüm hayvan deneyleri Nanjing Tıp Üniversitesi Komitesi tarafından onaylanmıştır. Erkek C57BL/6 fareler kontrollü fotoperiyodun koşullarında tutulur ve gıda ve su ile birlikte verildi.

1. doku hasat ve UV Crosslinking

  1. 1-2 dk veya solunum durur kadar karbondioksit (CO2) kullanarak 2 yetişkin fareler euthanize. Ardından, her fare üzerinde servikal çıkığı gerçekleştirin.
  2. Her immünoprecipitation deney için uygun yaş fareler (Bu çalışmada bir yetişkin testis) gelen testis yaklaşık 100 mg hasat ve buz-soğuk fosfat tamponlu tuzlu (PBS) dokuları yerleştirin.
  3. İnce uçlu cımbız bir çift ile hafifçe tunika albuginea çıkarın.
  4. Bir doku değirmeni içinde buz soğuk PBS 3 ml ekleyin ve gevşek bir cam havaneli (tip a cam havaneli) kullanarak hafif mekanik kuvvet ile doku triturate.
    Not: Bu adımın amacı hücreler için değil, dokuyu ayırmak. Hücre canlılığını ve bütünlüğünü korumak önemlidir.
  5. Doku süspansiyonunu bir hücre kültürü yemine (çapı 10 cm) aktarın ve 6 mL 'ye kadar buz gibi PBS ekleyin.
  6. Sıvı tabak alt eşit olarak kaplar böylece hızlı bir şekilde plaka sallayın. Eğer doku doğru şekilde yerse, eşit olarak dağıtılmış seminifer tübüller görünür olacaktır, ancak doku kümeleri varlığı doku dağılımının yetersiz olduğunu gösterir.
  7. Buz üzerinde 254 nm 400 mJ/cm2 ile süspansiyon üç kez Crosslink. Her ışınlama arasında karıştırma süspansiyonu.
    Not: Her yeni deney için çapraz optimize edilmelidir.
  8. 4 °c ' de 5 dakika boyunca 1.200 x g 'de 15 ml konik tüp ve Pelet içinde süspansiyonu toplayın. Supernatant kaldırmak, PBS 1 ml Pelet pelletini ve daha sonra bir 1,5 ml Santrifüjü tüp süspansiyon transfer. 4 °C ' de spin ve 2 dakika için 1.000 x g ve supernatant çıkarın.
  9. Bu noktada, hemen protokol geri kalanı ile devam edin, ya da Snap sıvı nitrojen ve mağaza içinde Pelet dondurmak-80 °C kullanım kadar.

2. boncuk hazırlama

  1. 125 μL protein ekleyin örnek başına bir manyetik boncuk (Pelet) yeni bir santrifüj tüpüne.
    Not: Fare antikorları için protein G manyetik boncuklar kullanın.
  2. Boncuk çözeltinin ayırmak için mıknatıs üzerinde tüp yerleştirin. 10 s sonra, supernatant çıkarın. 1 mL buz soğuk liziz tamponu ile iki kez yıkayın boncuk.
    Not: Proteinin sonraki ayrımı manyetik boncuklar bu adımı izler. Lysis tampon bileşimi 50 mM Tris-HCl, pH 7,5; 100 mM NaCl; 1% NP-40; 0,1% SDS; 0,5% sodyum deoxycholate; 1/50 etilendiamintetraasetik asit (EDTA)-ücretsiz proteaz inhibitörü kokteyl (taze ekleyin).
  3. 10 μg eCLIP antikor ile 100 μL soğuk lizis tamponunun içinde resuspend boncuk. 45 dk için oda sıcaklığında çevirin tüpler.
    Not: İmmünoptasyonitasyon için son antikor konsantrasyonu 10 μg/mL 'dir. Antikor konsantrasyonu bilinmiyorsa, antikor miktarı optimize edilmelidir.
  4. 1 mL buz soğuk liziz tamponu ile iki kez yıkayın boncuk.

3. doku lizis ve kısmi RNA sindirim

  1. 1 ml soğuk lizis tamponunun içinde resuspend doku peleti (22 μL 50x (EDTA)-ücretsiz protein inhibitörü kokteyli ve 11 μL RNase inhibitörü 1 mL liziz tamponu).
    1. Resuspend iki UV-crosslinked Pellet ve deney grubu başına iki olmayan crosslinked Pellet: UV-crosslinked-1 eCLIP Kütüphanesi için peleler (UV-1); UV-crosslinked-2 eCLIP Kütüphanesi için granül (UV-2); bir kontrol olarak eCLIP Kütüphanesi için olmayan-crosslinked-1 Pellet (non-UV); IgG IP için non-crosslinked-2 granül antikorların özgüllüğü göstermek için.
      Not: UV-crosslinked geniş tip testis Eclip Kütüphanesi için ideal kontrol aynı çöp fareler gelen UV-crosslinked nakavt testis olduğunu.
  2. 15 dakika (protein ve RNA bozulmasını önlemek için) buz üzerinde numuneleri parçalanması tutun.
  3. Bir dijital sonicator içinde sonikat% 10 amplitüd 5 dakika, 30 s/30 s kapalı. Her zaman numuneyi buzun üzerine yerleştirin ve her numune arasında çekirdeksiz su ile prob temizleyin.
  4. Her tüp için 4 μL DNase ekleyin ve iyi karıştırın. 37 °C ' de 10 dakika boyunca inküye, 1.200 rpm 'de sallayarak.
  5. 10 μL seyreltilmiş RNase ı (4 U/μL RNase ı PBS) ekleyin ve iyi karıştırın. 37 °C ' de 5 dk için inküye, 1.200 rpm 'de sallayarak.
  6. 15.000 x g 'de 20 dakika (4 °c ' de) santrifüjleme ile lysate temizleyin.
  7. Dikkatle supernatant toplamak. 50, lysate 'den ayrılın ve onunla birlikte Pelet 'i atın.
  8. Girişler örnekleri RWB (Batı Blot için çalıştırın) ve RRI (RNA yalıtım için çalıştırın) olarak kaydedin. 20 μL (% 2) tasarruf edin UV-1, UV-2, UV ve IgG örnekleri RWB jel yükleme için girişler olarak. 20 μL (% 2) tasarruf edin RRı jel yükleme için giriş olarak UV-1 veya UV-2 örnekleri.

4. immünopaperasyonu

  1. 1 mL lysate ekleyin (adım 3,7) boncuklar (Bölüm 2 ' de hazırlanmıştır) ve örnekleri 4 °C ' de 2 saat veya gecede döndürün.
  2. Bir manyetik stand ile boncuklar toplayın ve supernatant atın. 900 μL yüksek tuz tamponu (50 mM Tris-HCl) ile boncukları iki kez yıkayın. pH 7,5; 1 M NaCl; 1 mM EDTA; 1% NP-40; 0,1% SDS; 0,5% sodyum deoxycholate) ve sonra iki kez, 900 μL yıkama tamponu ile yıkama boncukları (20 mM Tris-HCl, pH 7,5; 10 mM MgCl2; 0,2% Tween-20).
    Not: IgG örneği için, burada prosedürü duraklatın ve yıkama tamponunun içinde buzda saklayın.
  3. 500 μL 1x olan tampon (10 mm Tris-HCL, pH 7,5; 5 mm MgCl2; 100 mm KCL; 0,02% Triton X-100) ile yıkama boncukları.

5. RNA 3 ' lerin dephosphorylation

  1. Bir manyetik stand ile boncuklar toplayın ve supernatant atın. İnce pipet uçları kullanarak kalan sıvıyı çıkarın. 100 eklemek μL olan Master Mix (10 μL 10X olan tampon [100 mm Tris-HCL, pH 8,0; 50 mm MgCl2; 1 M KCl; 0,2% Triton X-100; 1 mg/ml Sığır serum albümin (BSA)]; 78 plazması serbest su; 2 μL RNase inhibitörü; 2 μL DNase; 8 μL al Kaline fosfataz) her örneğe, ve 37 °C ' de 15 dakika boyunca inküye, 1.200 rpm 'de sallayarak.
  2. 300 μL polynucleotid kinaz (PNK) ana karışımı (60 μL 5x PNK pH 6,5 tampon [350 mM Tris-HCl, pH 6,5; 50 mM MgCl2]; 223 μL çekirdeksiz su; 5 μL RNase inhibitörü; 2 μL DNase; 7 ΜL PNK enzim; 3 μl, 0,1 M dithiothreitol) her örnek için , 37 °C ' de 20 dk, 1.200 rpm 'de sallayarak inkübe.
  3. Bir manyetik stand ile boncuklar toplayın ve supernatant atın. 500 μL soğuk yıkama tamponunu içeren boncuklar bir kez yıkayın. Sonra 500 μL soğuk yüksek tuz tampon ile boncuklar bir kez yıkayın. Bu düzenin bir kez daha bu yıkanır tekrarlayın.
  4. 500 μL soğuk yıkama tampon ile bir kez yıkama boncuk ve sonra iki kez 300 μL soğuk 1x ligasyon tampon (No dithiothreitol, 50 mM Tris-HCl, pH 7,5; 10 mM MgCl2).

6. RNA adaptörüne RNA adaptörü ligasyonu 3 ' uçları

  1. Supernatant atın ve ince pipet uçları ile kalan sıvı çıkarın. Her örneğe 25 μL 3 ' ligasyon ana karışımı ekleyin. Pipetleme ile dikkatlice karıştırın. Bu adım kabarcıklar üreten eğilimli.
    Not: Ligasyon ana karışımı 3 μL 10X ligasyon tamponu içerir [500 mM Tris-HCl, pH 7,5; 100 mM MgCl2]; 9 μL çekirdeksiz su; 0,4 μL RNase Inhibitörü; 0,3 μL 0,1 M ATP; 0,8 μL dimetil sülfoxid (DMSO); 9 μL 50% Polietilen glikol (PEG) 8000; 2,5 μL RNA ligaz [30 U/μL].
  2. Her örneğe 2,5 μL RNA adaptörü X1A (Tablo 1) ve 2,5 ΜL RNA adaptörü X1B (Tablo 1) ekleyin. Pipetleme veya Flicking ile dikkatlice karıştırın ve 25 °C ' de 75 dk için kuluçatlı, her 10 dakikada bir karıştırmak için Flicking.
  3. 500 μL soğuk yıkama tampon ile bir kez yıkama boncuk (IgG örnek burada devam).
  4. 500 μL soğuk yüksek tuz tamponunu ve ardından 500 μL soğuk yıkama tamponunu içeren boncuklar bir kez yıkayın. Bu yıkıları bir kez daha tekrarlayın.
  5. Manyetik olarak ayrı boncuk ve ince pipet uçları ile kalan sıvıyı çıkarın.
  6. 100 μL soğuk yıkama tamponunun içinde boncuk resuspend (IgG örnek burada Duraklat ve yıkama tampon buz üzerinde saklayın). 20 μL 'i yeni tüplere RWB örnekleri olarak taşıyın. Kalan 80 μL 'yi RRı örnekleri olarak manyetik olarak ayırın. RRI örnekleri ' süpernatant çıkarın ve 20 μl yıkama tampon içinde boncuklar pelletini.
  7. 37,5 μL 4X Lityum Dodesil sülfat (LDS) örnek tampon ve IgG örnek için 15 μL 10X örnek azaltma aracı ekleyin. 7,5 μL 4X LDS örnek tampon ve 3 μL (kalan) örneklere 10X örnek azaltma aracı ekleyin. (Pipetleme ile karıştırmayın). 70 °C ' de 10 dakika boyunca inküye, 1.200 rpm 'de sallayarak. 1 dakika buz üzerinde serin ve 4 °C ' de 1 dakika için 1.000 x g Santrifüjü.

7. SDS-sayfa ve membran transferi

  1. Jeller yükleyin.
    1. RRı jel için (4-12% BIS-Tris protein jeli, 10-Iyi, 1,5 mm) bir mıknatıs üzerinde yer tüpleri ve boncuklar ayrı protein atlatmak. İyi başına 30 μL örnek yükleyin. Örnekleri önceden lekelenmiş protein boyutu Marker ile aralıklı.
    2. RWB jel için (4-12% BIS-Tris protein jeli, 10-iyi, 1,5 mm) bir mıknatıs üzerinde yer tüpleri ve boncuklar ayrı protein atlatmak. İyi başına 15 μL örnek yükleyin. Kalan numuneleri-20 °C ' de yedekleme olarak kaydedin.
  2. Ekleme 500 μL antioksidan için 500 mL 1x SDS çalışan tampon. 200 V 'de çalıştırmak 1x SDS çalışan tampon 50 dakika veya kadar boya ön alt altındadır.
    Not: Antioksidan içerir N, N-dimetilformamid, sodyum bisulfit, hangi metionin ve triptofan gibi hassas amino asitlerin reoksidasyonunu önlemek için azaltılmış proteinler ile göç.
  3. % 10 metanol (Vol/Vol) ile 1xtransfer tampon içinde 70 dk için 10 V 'de nitroselüloz membranda jel protein-RNA kompleksleri transfer. RRı membranı soğuk PBS 'de durulayın, plastik sargı ile sarın ve-80 °C ' de saklayın.
  4. RWB membranı 1 saat boyunca oda sıcaklığında TBST 'de% 5 sütte engelleyin. TBST 'de membran durulayın. Bir gecede 4 °C ' de TBST 'de primer antikor ile inküye yapın. 5 dakika boyunca TBST ile iki kez yıkayın. sekonder antikor ile (1:5000 HRP keçi Anti-tavşan IgG) TBST 'de 1 h için oda sıcaklığına kadar yıkanır. TBST ile üç kez 5 dakika, 10 dk ve 15 dakika boyunca yıkayın.
  5. Elektrochemiluminescence (ECL) tampon A ve tampon B 'ye eşit hacimleri karıştırın, membran ekleyin ve 1 dakika boyunca inküye yapın, membran plastik wrap ile kapak ve 2-3 dakika için oda sıcaklığında bir X-ray film maruz. O zaman filmi geliştirin.
    Not: Aşırı pozlama ile film açıkça membran kenarlarının şeklini gösterecektir, hangi film RWB membran yeniden hizalanabilir hangi tarafından. Daha sonra, RWB ve RRı membranlarını, orada bulunan işaretçilerin pozisyonlarına göre hizalayın. Yukarıdan yukarıya doğru sırayla katmanlı film, RWB membran ve sıralı RRı membran vardır.

8. RNA yalıtımı

  1. 75 kDa (yaklaşık 220 NT RNA) için protein bandından bölgeyi kes, RWB membranı ve filmi kılavuzlar olarak kullanarak.
    Not: Protein korumalı RNA molekülü en fazla 225 üs uzunluğuna sahip olabilir, taban başına yaklaşık 340 da ile, tüm protein-RNA kompleksleri almak için RBP bandının üzerinde 75 kDa hakkında bölgeyi kesmek makul.
  2. Çeşitli küçük dilimleri içine membran eksiz parça kesme ve taze 1,5 mL santrifüj tüp içine yerleştirin. 200 μL proteinaz K (PK) tamponu (100 mM Tris-HCl pH 7,5; 50 mM NaCl; 10 mM EDTA) ile 40 μL PK membran parçalarına ekleyin. 37 °C ' de 20 dakika boyunca karıştırın, 1.200 rpm 'de sallayarak inküye yapın.
  3. 200 Ekle μL PK üre tampon (100 mm Tris-HCl pH 7,4; 50 mm NaCl; 10 mm EDTA; 7 M üre) her örnek için. 37 °C ' de 20 dakika boyunca inkübe, 1.200 rpm 'de sallayarak.
  4. 400 μL asit fenol/kloroform/isoamill alkol (25:24:1) ekleyin, iyi karıştırın ve 37 °C ' de 5 dakika boyunca inküyeyin, 1.200 rpm 'de sallayarak.
  5. 2 mL faz kilidi jel (PLG) ağır tüpü santrifüjde yerleştirin ve 25 s için 15.000 x g 'de döndürün.
  6. Membran dilimleri dışında tüm içerikleri PLG ağır tüpüne aktarın. 37 °C ' de 5 dk için inküye, 1.200 rpm 'de sallayarak.
  7. Oda sıcaklığında spin ve 15.000 x g için 15 dk. sulu tabakası yeni bir 15 ml konik tüp içine transfer.
  8. RNA ayıklamak için RNA arıtma ve konsantrasyon sütunlarını kullanın.
    1. Her örneğe (adım 8,7) ve karışımına 2 hacim (800 μL) RNA bağlayıcı tampon ekleyin. 100% etanol ve mix eşittir hacmi (1200 μL) ekleyin.
    2. Transfer 750 μL (adım 8.8.1) Numunenin, bir toplama tüpünün RNA arıtma ve konsantrasyon sütunlarına aktarılması ve 30 s için 15.000 x g 'de santrifüjten atılmasına neden olur.
    3. Tüm örnekler sütundan geçirilinceye kadar adım 8.8.2 yineleyin. Sütun için 400 μL RNA hazırlık tamponunu ekleyin ve 30 s için 15.000 x g 'de Santrifüjü atın. akış yoluyla atın, 700 ΜL RNA yıkama tamponunu uygulayın ve sütunu 30 s için 15.000 x g 'de santrifüje çıkarın. akış yoluyla atın.
    4. Sütun için 400 μL RNA yıkama tamponu ekleyin ve 2 dakika boyunca 15.000 x g 'de santrifüjün, sütunu dikkatle yeni bir 1,5 ml tüpüne aktarın. Sütun matrisine 10 μL çekirdeksiz su ekleyin, 2 dakika oturun ve 15.000 x g 'de 30 s. Store Eclip örnekleri-80 °c ' ye (adım 11,1) kadar santrifüj yapın.

9. giriş RNA 3 ' uçları dephosphorylation

  1. 15 μL olan Master Mix ekleyin (2,5 μL 10X olan tampon [100 mm Tris-HCL, pH 8,0; 50 mm MgCl2; 1 M KCl; 0,2% Triton X-100; 1 mg/ml BSA]; 9,5 çekirdek kirsiz su; 0,5 μL RNase inhibitörü; 2,5 μL alkali fosfataz) 10 μL Giriş örnekleri (adım 8.8.4). 37 °C ' de 15 dk, 1.200 rpm 'de sallayarak inkübe.
  2. 75 μL PNK Master Mix ekleyin (20 μL 5x PNK PH 6,5 tampon [350 mM Tris-HCl, pH 6,5; 50 mM MgCl2]; 44 μL çekirdeksiz su; 1 μL RNase inhibitörü; 2 μL DNase; 7 ΜL PNK enzim; 1 μl, 0,1 M dithiothreitol) örneklere. 37 °C ' de 20 dakika boyunca inkübe, 1.200 rpm 'de sallayarak.
  3. Giriş RNA 'sı Temizleme
    1. Resuspend thenucleic asitler ekstraksiyon manyetik boncuklarboncuklu şişe (Vortex 30 ' dan fazla s için). Her numune için yeni tüplere 20 μL nükleik asitler ekstraksiyon manyetik boncuk ekleyin. Bir manyetik stand ile boncuklar toplayın ve supernatant atın.
    2. 1 mL RNA arıtma lizis tamponu (RLT tampon) ile bir kez yıkayın boncuk. 30 s için bir mıknatıs üzerinde tüp yerleştirin ve supernatant atın.
      Not: Nükperik asitler ekstraksiyon manyetik boncuklar sonraki ayrımı bu adımı izledi.
    3. Resuspend 300 μL RLT tampon ile boncuk ve örnek ekleyin. 10 μL 5 M NaCl ve 615 μL 100% etil alkol (EtOH) ekleyin ve pipetleme ile karıştırın. Oda sıcaklığında Döndür 15 dakika. Magnetically boncuklar ayırmak ve supernatant kaldırmak.
    4. Resuspend boncuk 1 mL 75% EtOH ve yeni bir tüp transfer. 30 s sonra, bir manyetik stand ile boncuk toplamak ve supernatant atın. % 75 EtOH ile iki kez yıkayın, boncukları manyetik olarak ayırın ve ince pipet uçları ile kalan sıvıyı atın. 5 dakika boyunca kuru hava (aşırı kurutmadan kaçının).
    5. 10 μL çekirdeksiz su ile boncukların resuspend ve 5 dk. magnetically ayrı boncuklar için inkübasyon ve yeni bir tüp için 5 μL süpernatant hareket (3 ' adaptör ligasyon aşağıda). Kalan RNA, yedekleme olarak-80 °C ' de depolanabilir.

10. RNA adaptörünün girişli RNA 3 ' uçları

  1. 1,5 μL DMSO ve 0,5 μL RiL19 adaptörü (Tablo 1) Için 5 μL giriş RNA (adım 9.3.5) ekleyin, 65 °c ' de 2 dakika boyunca inkübasyon yapın ve 1 dakikadan fazla buz üzerine yerleştirin. her örneğe 13,5 μl 3 ' ligasyon ana karışımı ekleyin , pipetleme ile karıştırın ve 25 °C ' de 75 dk, her 15 dakikada bir karıştırmak için Flicking ile kuluçk.
    Not: Ligasyon Master Mix 2 μL 10X ligasyon tampon içerir [500 mM Tris-HCl, pH 7,5; 100 mM MgCl2; 10 mm dithiothreitol]; 1,5 μL çekirdeksiz su; 0,2 μL RNase inhibitörü; 0,2 μL 0,1 M ATP; 0,3 μL DMSO; 8 μL 50% PEG8000; 1,3 μL RNA ligaz [30 U/μL].
  2. Bağlandı giriş RNA 'sı temizlenmesi
    1. Mıknatıslı ayrı 20 μL nükleik asitler her numune için manyetik boncuk ekstraksiyon, ve supernatant çıkarın. 1 mL RLT tampon ile boncuklar bir kez yıkayın.
    2. 61,6 μL RLT tampon ve transfer Süspansiyon her örneğe resuspend boncuk. Ekle 61,6 μL 100% EtOH. Her 5 dakikada 15 dakika karıştırmak için pipet kullanın. manyetik ayrı boncuklar, ve supernatant çıkarın.
    3. 9.3.4 adım yineleyin.
    4. 10 μL çekirdeksiz su ile resuspend boncuklar ve 5 dk için oturup izin. manyetik boncuk ayırmak ve yeni bir tüp süpernatant 10 μL aktarmak.
      Not: Bu olası bir durdurma noktasıdır (giriş örnekleri, ertesi güne kadar-80 °C ' de depolanabilir).

11. ters transcription, DNA adaptörü ligasyon cDNA 3 ' biter

  1. 0,5 μL RT astar (Tablo 1) Ile 10 μL giriş RNA 'ya (adım 10.2.4) ve 10 ΜL PıP RNA 'ya (adım 8.8.4) sırasıyla, 65 °c ' de önceden ıSıTıLAN PCR blokta 2 dakika boyunca inkük, 1 dakikadan fazla buz üzerinde yer ekleyin.
  2. 10 μL RT ana karışımı ekleyin (2 μL RT tampon [500 mM Tris-HCl, pH 8,3; 750 mM KCl; 30 mM MgCl2]; 4 μL çekirdeksiz su; 0,3 μL RNase inhibitörü; 2 μl, 0,1 m dithiothreitol; 0,2 μl, 0,1 m datp; 0,2 μL, 0,1 m dctp; 0,2 μL 0,1 M dGTP; 0,2 μL 0,1 M dTTP; 0,9 μL ters transcriptase) her örnek için, mix, 55 °C ' de 45 dakika boyunca önceden ısıtılmış bir PCR blokta inkük.
  3. 3,5 μL PCR Ürün temizleme reaktif ile 20 μL RT reaksiyon ürününü karıştırın. 37 °C ' de 15 dakika boyunca inkübe.
  4. 1 μL 0,5 M EDTA ekleyin, pipetleme ile karıştırın. 3 μL 1 M NaOH ekleyin, pipetleme ile karıştırın ve 70 °c ' de 12 dakika boyunca, bir PCR bloğunda RNA şablonunu hidrolize etmek için inküye yapın.
  5. Tamponu nötralize etmek için 3 μL 1 M HCl, pipet karışımı ekleyin.
  6. CDNA Temizleme
    1. Magnetically ayrı 10 μL nükleik asit ekstraksiyon manyetik boncuk her örnek için, supernatant çıkarın. 500 μL RLT tampon ile bir kez yıkayın.
    2. 93 μL RLT tampon ve transfer süspansiyonu örneğe resuspend boncuk. Ekle 111,6 μL in 100% EtOH, 5 dakika boyunca kuluçk, ve pipet karışımı her 2 dk. bir manyetik stand ile boncuklar toplayın ve supernatant atın. 1 mL 80% EtOH ile resuspend boncuk ve yeni bir tüp taşıyın.
    3. 30 s sonra, bir manyetik stand ile boncuk toplamak ve supernatant atın. % 80 EtOH ile iki kez yıkayın. Manyetik olarak ayrı ve ince ucu ile kalan sıvı atın. 5 dakika boyunca kuru hava (aşırı kurutmadan kaçının). 5 μL 5 mM Tris-HCl 'de resuspend boncuklar ve 5 dakika boyunca inküye.
  7. 0,8 μL DNA adaptörü (Tablo 1) ve 1 ΜL DMSO 'ya boncuklar ekleyin, 75 °c ' de 2 dak. 1 dakikadan fazla buz üzerine yerleştirin.
  8. Hazırlamak 12,8 μL ligasyon Master Mix (2 μL 10X ligasyon tampon [500 mM Tris-HCl; 100 mM MgCl2; 10 mm dithiothreitol]; 1,1 μL çekirdeksiz su; 0,2 μl 0,1 M ATP; 9 μl of 50% PEG8000; 0,5 ΜL RNA ligaz [30 U/μL]) , karıştırmak için Flick, bir santrifüjte kısaca spin ve her örneğe eklemek, yavaşça pipet ucu ile örnek karıştırın.
  9. Her örneğe başka bir 1 μL RNA ligaz [30 U/μL] ekleyin ve karıştırın. 1.200 rpm 'de sallayarak, 25 °C ' de 30 s için inkübe. Gece 25 °C ' de inkübe. Saat başına bir kez, hafifçe 5 ila 6 kez karıştırın Flick.
  10. Birleştirilmiş cDNA Temizleme
    1. Magnetically ayrı 5 μL nükleik asitler ekstraksiyon manyetik boncuk her örnek için, ve kaldırmak supernatant.
    2. 500 μL RLT tampon ile bir kez yıkayın.
    3. Resuspend boncuk ve transfer Süspansiyon her örneğe 60 μL RLT tampon içinde boncuk. Ekle 60 μL in 100% EtOH, her 2 dakikada 5 dk ve pipet karışımı için inkük. manyetik olarak ayrı, supernatant atın.
    4. 9.3.4 adım yineleyin.
    5. 27 μL 10 mM Tris-HCl ile resuspend boncuk, 5 dk. Magnetically ayrı ve yeni bir tüp için 25 μL örnek taşıyın. Yeni bir tüpte 9 μL çekirdeksiz su ile 1 μL bağlanılan cDNA 'yı seyreltin. Kalan numuneleri-20 °C ' de adım 13,1 kadar saklayın.

12. gerçek zamanlı nicel PCR (qPCR) ile cDNA miktarının belirlenmesi

  1. 9 μL qPCR Master Mix (5 μL 2x Master Mix; 3,6 μL çekirdeksiz su; 0,4 μL astar karışımı [10 μM PCR-F-D50X ve 10 μM PCR-R-D70X]) bir 96-iyi qPCR plakasına ekleyin. 1 μL 1:10 seyreltilmiş (H2O) cDNA (adım 11.10.5), mühür ve mix ekleyin.
  2. QPCR programını bir termocycler içinde çalıştırın: 50 °C ' de 2 dak; 95 °C ' de 2 dak; 95 °C ' de 3 s, 40 döngüleri için 68 °C ' de 30 s. 15 s at 95 °C, ardından 68 °C ' de 60 s ve ardından 1 döngü için 95 °C ' de 15 s. Not CT (döngü eşik) değeri.

13. cDNA 'nın PCR amplifikasyonu

  1. 35 μL PCR Master Mix (25 μL 2x PCR Master Mix; 5 μL çekirdeksiz su; 5 μL astar Mix [20 μM PCR-F-D50X ve 20 μM PCR-R-D70X]) içine 8-kuyu şeritler. CLıP grubu için 12,5 μL CLıP örnek + 2,5 μL H2O ekleyin; girişler grubu için 10 μL giriş + 5 μL H2O ekleyin. iyi karıştırın ve santrifüjte kısaca döndürün.
  2. PCR programını çalıştırın: 98 °C ' de 30 s; 15 s at 98 °C, ardından 68 °C ' de 30 s, sonra da 72 °C ' de 40 s ile 6 döngü; 98 °C ' de 15 s ve ardından 60 s ile 72 °C ' de N döngüleri = (qPCR CT değerleri-3)-6; 72 °C ' de 60 s; 4 °C tutun.
    Not: İlk çift klipler için 1 ila 2 ekstra PCR döngüsü gerçekleştirmek daha iyidir.

14. jel arıtma

  1. % 3 yüksek çözünürlüklü agaroz jel üzerine numune yükleyin. Örnekleri arasında 1 boş iyi bırakarak, ve jel her iki tarafında bir merdiven kullanın. 1x Tris-Borate-EDTA (TBE) tamponunun 75 dakika için 100 V 'de çalıştırın.
  2. Mavi ışık aydınlatması altında, her örnek için taze jilet kullanarak jel dilimleri 175-350 BP kesilmiş. Onları 15 mL konik tüplere yerleştirin.
    1. Jel dilim tartmak ve jel ekstraksiyon kiti kullanarak jel elute.
    2. Jel eritmek için jel dezenfekte tampon 6x hacmi ekleyin (100 mg jel = 600 μL jel çözünme tampon). Jel oda sıcaklığında çözülür. (Jel dilim tamamen çözünmüş kadar her 15 dakika karıştırmak için sallayın). Ekle 1 jel hacmi 100% izopropanol ve karışımı iyi.
    3. Transfer 750 μL numunenin (adım 14.2.2) bir koleksiyon tüpünün sütununa aktarılmasını ve 17.900 x g 'de Santrifüjü 1 dakika boyunca atın.
    4. Tüm örnekler sütundan geçinceye kadar adım 14.2.3 yineleyin, 500 μL jel çözme tamponunu kullanarak bir kez yıkayın.
    5. Ekleme 750 μL yıkama tamponu (jel ekstraksiyon kiti) sütuna ve Santrifüjden 17.900 x g için 1 dk. akış yoluyla atmak, 2 dakika için 17.900 x g spin. sütunu yeni bir 1,5 ml tüpüne yerleştirin.
    6. Sütunun plastik mor kenarından kalan tüm yıkama tamponunu çıkarın. 2 dakika boyunca kuru hava. membran merkezine 12,5 μL çekirdeksiz su ekleyin. Sütun oda sıcaklığında 2 dakika stand ve 1 dk için 17.900 x g spin (geliştirilmiş bir verim için, elüsyon adımı tekrarlayın) edelim.

15. PCR ürününün TOPO klon

  1. TOPO klonlama reaksiyonu karışımı hazırlayın (1 μL PCR ürün adım 14.2.6; 1 μL klonlama karışımı; 3 μL steril su). 20-37 °C ' de 5 dakika hafifçe karıştırın ve Inküye yapın. Buz üzerinde serin.
  2. Buz üzerinde kimyasal olarak yetkili E. coli bakterileri çözüyor. 5 μL TOPO klonlama ürünü 100 μL yetkili bakteri29ekleyin. Yavaşça karıştırın. 30 dakika boyunca buzun üzerinde inküyün.
  3. 42 °C ' de 60 s için ısı-şok. Sonra buz üzerinde 2 dakika serin. 900 μL lysogeny suyu (LB) orta Ekle, 37 °C ' de 1 saat boyunca inkük, 225 devirde sallayarak. Spin at 1.000 x g 1 dakika ve sonra kaldırmak 900 μL supernatant. Çözümün geri kalanını yeniden resuspend.
  4. Dönüştürülmüş bakterileri, ampisilin (100 μg/mL) içeren% 1,5 LB agar plakasına yerleştirin ve bir gecede 37 °C ' de inküye yapın.
  5. Her yapı için en az 20 1,5 mL Santrifüjü tüpleri hazırlayın. 100 μg/mL ampisilin içeren LB orta 500 μL ile bir set doldurun. Bir bakteriyel koloninin rasgele çizilmesini ve 500 μL LB orta ile karışımı (pipetleme ile) sterilize etmek için steril bir pipet ucu kullanın. 37 °C ' de 5 saat, 225 RPM 'de sallama.
  6. M13 ters astar kullanarak Ekle parçası sıra: CAGGAAACAGCTATGAC tarafından Sanger sıralama30.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Eclip prosedürü ve sonuçları Şekil 1, Şekil 2, Şekil 3, Şekil 4' te gösterilmiştir. Fareler karbondioksit ile ötenize edildi ve cerrahi makas kullanılarak alt karın içinde küçük bir kesi yapılmıştır (Şekil 2a,B). Fare testleri kaldırıldı, detunicated ve sonra UV-crosslinked taşlama sonra (Şekil 2C-ı). Testis dokularında bilinen iki RNA bağlayıcı helikazlar kullanarak temsili Eclip sonuçları Şekil 3 ve 4' te tasvir edilir. Biz MOV10 Eclip yetişkin Wild-tip fareler gelen testis, ortak konsantrasyon ile 40 U/ml RNase ı çapraz bağlı lysate tedavi gerçekleştirdi. Şekil 3A üst paneli 114 kDa hakkında ölçekli hedef protein başarıyla zenginleştirilmiştir gösterir. İmmunoprecip, MOV10L1 proteinleri Batı leke iki konsantrasyonu ile yapıldı (5 veya 40 U/ml) Eclip işlemi sırasında RNase ı (Şekil 3A). Şekil 3B MOV10 ve MOV10L1 UV-crosslinked, olmayan-crosslinked ve eşleştirilmiş boyutu eşleşen giriş (Smınput) örnek 1:10 seyreltilmiş cDNA (zaten DNA adaptörü ile bağlanmış) kullanarak qPCR gösterir. Non-crosslinked örnekleri RNA kurtarma azalmış gösterir. Çapraz bağlantılı olmayan grubun CT değerlerinin genellikle UV-crosslinked grubundan 5 kat daha fazla olduğunu gözlemledik. Şekil 4A , agaroz jel elektroforezi (Cut 175-350 BP) ile PCR amplifikasyonu ve boyut seçimini görüntüler. Primer-dimer ürün yaklaşık 140 BP 'de görünür. Figure 4B iki temsilci subclone sıraları UCSC genom tarayıcı görünümünü gösterir. MOV10-bağlı eCLIP etiketleri 3 ' gen FTOUTR içinde yer alan bulundu; Yaklaşık 3 ' UTR oranı% 75 için hesaplar (Şekil 4c), HEK293 hücrelerde10 ve testis içinde MOV10 hedeflerinin çoğunluğu ile tutarlı (veriler gösterilmez). Buna karşılık, MOV10L1-Bound eCLIP etiketleri MOV10L1 hedefleri piRNA öncüleri gösteren bir piRNA kümesi içinde bulunduğu bulunmuştur. PiRNA öncüleri yaklaşık oranı% 42 için hesaplar (Şekil 4E), önceki geleneksel klips deney20bir eğilim yansıtır. MOV10L1 eCLIP ile 40 U/mL RNase ı sindirim daha az 20 BP ile nispeten daha fazla dizi verir (Şekil 4d).

Figure 1
Şekil 1 : Eclip 'In şematik gösterimi. UV-crosslinked fare seminifer tübüllerin (adım 1) Eclip lizis tampon ve sonicated (adım 2) lysed vardır. Lysate, protein-RNA kompleksler Anti-RBP antikor (adım 3-4) kullanılarak immunoprecip, sonra RNA parçası için RNase ı ile tedavi edilir. RNA parçacıklarının dephosphorilasyonu ve 3 ' RNA adaptörünün ligasyonu gerçekleştirilir (adım 5-6). Protein-RNA kompleksleri SDS-PAGE jeli üzerinde çalıştırılır ve nitroselüloz membranlara aktarılır (adım 7). RNA, proteinaz K ve Urea ile proteini sindirerek membrandan kurtarılır ve bu da Crosslink bölgesinde kalan kısa bir polipeptit bırakır. Giriş numunelerinin RNA parçalarının dephosphorilasyonu ve 3 ' RNA adaptörünün ligasyonu gerçekleştirilir (adım 8). RNA ve 3 ′ ü DNA adaptörü (adım 9-10) ligasyon RT gerçekleştirin. Ön Kütüphane kalite kontrolü için cDNA Kütüphanesi, jel ekstraksiyon ve künt-End PCR klonlama PCR amplifikasyon gerçekleştirin (adım 11). Son olarak, yüksek verimlilik sıralaması gerçekleştirin (adım 12). Bu figürün daha büyük bir versiyonunu görmek Için lütfen tıklayınız.

Figure 2
Şekil 2 : Testis doku hasat ve UV Crosslinking. (A) fare karın pozlama. (B) Karın duvarındaki 0,5 cm kesi peritonumu açığa çıkarır. (C) Yağ pedleri dışarı çekerek bir çift testis alınır. (D) testis dokusu kaldırılır ve buz soğuk PBS içeren küçük bir çanak yerleştirilir. (E) yavaşça tunika albuginea çıkarın. (F) bir doku değirmeni Dons doku triturate Loose havaneli basın. (G) 10 cm plaka içinde dağıtılmış seminifer tübüller. (H) 400 MJ/cm2 enerji ile UV çapraz. (I) çapraz bağlı numuneler 1,5 ml Santrifüjü tüplerinde toplanır. Bu figürün daha büyük bir versiyonunu görmek Için lütfen tıklayınız.

Figure 3
Şekil 3 : MOV10 ve MOV10L1 eCLIP temsili sonuçları. (A) MOV10 ve MOV10L1 immunoprecipitates Batı leke doğrulama. (B) qPCR üzerinde 1:10 seyreltilmiş Eclip KÜTÜPHANELERI MOV10 ve MOV10L1, UV, non-UV ve eşleştirilmiş SMInput örnekleri için çoğaltır. Bu figürün daha büyük bir versiyonunu görmek Için lütfen tıklayınız.

Figure 4
Şekil 4 : Eclip Kütüphanesi hazırlanması ve kalite değerlendirmesi. (A) PCR amplifikasyon jel görüntüleri gösterilir. Asterisk astar dimer gösterir. Kırmızı noktalı çizgi, cDNA 'nın PCR ürünü için 175 ile 350 BP arasında bir yere kadar olan bölgeleri gösterir. (B) iki temsilci subklon sıraları31UCSC genom tarayıcı görünümü. (C) MOV10 küçük ölçekli subclone sıralama analizi. (D) MOV10L1-Bound Etiketler Iki farklı RNase konsantrasyonları ile işlenirken farklı uzunlukta dağılım desenleri görüntüler. (E) MOV10L1 küçük ölçekli subclone sıralama analizi. Bu figürün daha büyük bir versiyonunu görmek Için lütfen tıklayınız.

Sıra adı Sıra bilgileri Açıklama
RNA adaptörleri
RNA X1A /5Phos/AUAUAGGNNNNNAGAUCGGAAGAGCGUCGUGUAG/3SpC3/ 200 μM cinsinden stok; 20 μM çalışma
RNA X1B /5Phos/AAUAGCANNNNNAGAUCGGAAGAGCGUCGUGUAG/3SpC3/ 200 μM cinsinden stok; 20 μM çalışma
RiL19 /5phos/AGAUCGGAAGAGCGUCGUG/3SpC3/ 200 μM cinsinden stok; 40 μM ' de çalışıyor
DNA adaptörü
Rand103tr3 /5Phos/NNNNNNNNNNAGATCGGAAGAGCACACGTCTG/3SpC3/ 200 μM cinsinden stok; 80 μM ' de çalışıyor
RT astar
AR17 Akgül, GÜRCISTAN 200 μM cinsinden stok; 20 μM çalışma
PCR astar

PCR-F-D 501
BIR de bu kadar çok zaman var........... 100 μM cinsinden stok; 20 μM çalışma
PCR-R-D 701 ADAGCAGAAGACGGCATACGAGATCGAGTAATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC 100 μM cinsinden stok; 20 μM çalışma
(Bkz. D502-508, D702-712 için ılılina müşteri hizmeti mektubu)

Tablo 1: adaptör ve astar dizileri. Bağdaştırıcı iki özdeş sıralı okur iki benzersiz RNA parçaları veya aynı RNA parçası PCR kopyaları gösterir olup olmadığını belirlemek için bir satır içi rasgele (ya N5 veya N10) içerir. "5 phos" bir oligo DNA/RNA ligaz için bir substrat olarak kullanılırsa gerekli 5 ' fosforilasyon, anlamına gelir. "3SpC3" 3 ' C3 spacer için, hangi adaptörler arasında ligasyon önleyebilir anlamına gelir.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Hem biyolojik hem de patolojik bağlamlar altında rbps evrensel rolünü anlamak artan, klip yöntemleri yaygın rbps moleküler fonksiyonunu ortaya çıkarmak için kullanılmıştır20,32,33, 34,35. Burada açıklanan protokol, fare testis için eCLIP yönteminin uyarlanmış bir uygulamasını temsil eder.

Testis içinde Eclip gerçekleştirme bir meydan okuma, aynı zamanda etkili Crosslinking için önemli olan taze testis hücrelerin, canlılığı ve bütünlüğünü sürdürüyor. Gevşek havaneli kullanarak hafif mekanik kuvvet ile testis Shearing hücre lizis32,36önleyebilirsiniz. RNA 'nın uygun sindirimi, başarılı eCLIP desteği için de önemlidir. RNA parçaları sindirim sonra daha yakınsak olabilir, ama uzunluğu daha az 20 BP kütüphanenin ön işleme yoluyla kaldırılabilir okur. Bir RBP adayı için ideal bir RNase dozu benimsemek için, biz 0 dan 40 U (lysate mililitre başına) arasında değişen konsantrasyonları ile RNase tedavisi ile hazırlıklı olabilir eCLIP kütüphanelerinin subclone sıralamanın sonuçlarına dayalı bir ön test öneririz. Küçük ölçekli subclone sıralama analizi, eCLIP yöntemimizde kitaplık kalitesinin güvenilir bir şekilde incelenmesi için önerilen bir adımdır. İlk olarak, 20 BP 'den kısa kesici uçlar yüzdesi çok yüksek olmamalıdır, ya da, eCLIP kütüphanesinin sonraki ön işleme, pahalı bir okuma kaybına neden olacaktır. İkincisi, her iki adaptörün doğru ligasyon verimliliği kontrol edilmelidir. Alt standart örnekleri başarılı derin sıralama sağlamak için derin sıralama olmadan ortadan kaldırılabilir, sonuçları genellikle daha uzun analiz etmek için almak.

Fare testis eCLIP fizibilite hala immünoprecipitation adım için antikor özgüllüğü ile sınırlıdır rağmen, eCLIP çeşitli yönleri geleneksel KLIP yöntemleri üzerinde avantajlıdır. İlk olarak, radyoaktif olmayan bir yöntemdir. ECLIP tarafından, RBPs RNA hedefleri doğrudan radyoaktif malzemeler kullanarak emek yoğun teknikleri başvurmak zorunda kalmadan in vivo yakalanır. İkincisi, yöntem daha az zaman yoğun. Tüm prosedür eCLIP Kütüphanesi hazırlama ile sadece 4 gün sürer. Üçüncü, sıra çeşitliliği. 25-35 döngüleri geleneksel birleştirilmiş amplifikasyon döngüsü ile karşılaştırıldığında, Eclip özellıkle PCR döngüleri sayısını ayarlamak Için qPCR CT değerleri anlamına gelir. Son olarak, daha güçlü sinyal-gürültü oranı sağlar. Boyut ile eşleşen giriş, otantik hedefler için uygun bir arka plan olarak hizmet vermektedir.

Özetle, bizim eCLIP sonuçlar MOV10 ve MOV10L1 mRNA 3 ' UTR ve piRNA öncüleri, sırasıyla bir bağlayıcı tercihi var sonuçları pekiştirmek. Burada tarif ettiğimiz protokol, eCLIP yönteminin üreme alanındaki ilk istihdamını, RNA-RBP etkileşimi bilgisinin yetersiz olduğu bir alanı, genetik çalışmaların biyolojik rolleri hakkında bol miktarda bilgi sağlamış olmasına rağmen, RBPs. bu eCLIP protokolünün görselleştirme daha geniş alanlarda yaygın uygulamaları rehberlik yardımcı olabilir.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Yazarların ifşa etmesi gereken hiçbir şey yok.

Acknowledgments

Biz orijinal protokol ile yararlı rehberlik için Eric L Van Nostrand ve gene W Yeo teşekkür ederiz. K.Z. Ulusal anahtar R & D programı Çin (2016YFA0500902, 2018YFC1003500) ve Ulusal Doğal Bilim Vakfı Çin (31771653) tarafından desteklenmektedir. Ly Ulusal Doğal Bilim Vakfı Çin (81471502, 31871503) ve yenilikçi ve girişimcilik programı Jiangsu Eyaleti tarafından desteklenmektedir.

Materials

Name Company Catalog Number Comments
Antibodies
Anti-mouse MOV10  antibody Proteintech, China 10370-1-AP
Anti-mouse MOV10L1 antibody Zheng et al.20109 polyclonal antisera UP2175 provided by P. Jeremy Wang lab, University of Pennsylvania
HRP Goat Anti-Rabbit IgG  ABclonal AS014
Rabbit IgG Beyotime, China A7016
Equipment
Centrifuge Eppendorf, Hamburg, Germany 5242R
Digital sonifier BRANSON,USA BBV12081048A 450 Watts; 50/60 Hz
DynaMag-2 Magnet Invitrogen,USA 12321D
Mini Blot Module Invitrogen,USA B1000
Mini Gel Tank Invitrogen,USA A25977
Shaking incubator Eppendorf, Hamburg, Germany Thermomixer comfort 
Tissue Grinder, Dounce PYREX, USA 1234F35 only  the "loose" pestle is used in this protocol
TProfessional standard 96 Gradient Biometra, Germany serial no.: 2604323
Tube Revolver  Crystal, USA serial no.: 3406051
UV-light cross-linker UVP, USA CL-1000
Materials
TC-treated Culture Dish Corning, USA 430167 100 mm 
Tubes Corning, USA 430791 15 mL
Microtubes tubes AXYGEN , USA MCT-150-C 1.5 mL 
Reagents 
Acid phenol/chloroform/isoamyl alcohol  Solarbio, China P1011 25:24:01
AffinityScript Enzyme Agilent, USA 600107
Antioxidant Invitrogen,USA NP0005
DH5α competent bacteria Thermo Scientific, USA 18265017 these economical cells yield >1 x 106 transformants/µg control DNA per 50 µL reaction.
DMSO Sigma-Aldrich, USA D8418
DNA Ladder Invitrogen, USA 10416014
dNTP Sigma-Aldrich, USA DNTP100-1KT
Dynabeads Protein A  Invitrogen, USA 10002D
ECL reagent Vazyme, China E411-04
EDTA Invitrogen, USA AM9260G
EDTA free protease inhibitor cocktail Roche, USA 04693132001 add fresh
Exo-SAP-IT Affymetrix, USA 78201 PCR Product Cleanup Reagent 
FastAP enzyme Thermo Scientific, USA EF0652
LDS Sample Buffer Thermo Scientific, USA NP0007
MetaPhor Agarose  lonza, Switzerland 50180
MgCl2 Invitrogen, USA AM9530G
MiniElute gel Extraction QIAGEN, Germany 28604 column store at 4 ?; buffer QG=gel dissolving buffer; buffer PE= wash buffer(for step 14)
MyONE Silane beads Thermo Scientific, USA 37002D nucleic acids extraction magnetic beads
NaCl Invitrogen,USA AM9759
 
NP-40 Amresco, USA M158-500ML
NuPAGE Bis-Tris Protein Gels Invitrogen, USA NP0336BOX 4%–12%,1.5 mm, 15-well
NuPAGE MOPS SDS Buffer Kit  Invitrogen, USA NP0050
PBS Gibco, USA 10010023
Phase-Locked Gel (PLG) heavy tube   TIANGEN, China WM5-2302831
PowerUp SYBR Green Master Mix Applied Biosystems, USA A25742
Proteinase K NEB, New England  P8107S
Q5 PCR master mix  NEB, New England  M0492L
RLT buffer QIAGEN, Germany 79216 RNA purification lysis buffer 
RNA Clean & Concentrator-5 columns  ZYMO RESEARCH, USA R1016 RNA purification and concentration columns
RNase I  Invitrogen, USA AM2295
RNase Inhibitor Promega, USA N251B
RQ1 DNase Promega,USA M610A
Sample Reducing Agent Invitrogen,USA NP0009
SDS Solution Invitrogen, USA 15553027 10%
Sodium deoxycholate Sigma-Aldrich, USA 30970 protect from light
T4 PNK enzyme NEB, New England  M0201L
T4 RNA ligase 1 high conc NEB, New England  M0437M
TA/Blunt-Zero Cloning Mix Vazyme, China C601-01
TBE Invitrogen,USA AM9863
Tris-HCI Buffer Invitrogen, USA 15567027
Triton X-100 Sangon Biotech, China A600198 
Tween-20 Sangon Biotech, China A600560
Urea Sigma-Aldrich, USA U5378
X-ray Films Caresteam, Canada 6535876

DOWNLOAD MATERIALS LIST

References

  1. Turner, J. M., Mahadevaiah, S. K., Ellis, P. J., Mitchell, M. J., Burgoyne, P. S. Pachytene asynapsis drives meiotic sex chromosome inactivation and leads to substantial postmeiotic repression in spermatids. Developmental Cell. 10, (4), 521-529 (2006).
  2. Turner, J. M. A. Meiotic sex chromosome inactivation. Development. 134, (10), 1823-1831 (2007).
  3. Kimmins, S., Sassone-Corsi, P. Chromatin remodelling and epigenetic features of germ cells. Nature. 434, (7033), 583-589 (2005).
  4. Ule, J., et al. CLIP identifies Nova-regulated RNA networks in the brain. Science. 302, (5648), 1212-1215 (2003).
  5. Ule, J., Jensen, K., Mele, A., Darnell, R. B. CLIP: a method for identifying protein-RNA interaction sites in living cells. Methods. 37, (4), 376-386 (2005).
  6. Trifillis, P., Day, N., Kiledjian, M. Finding the right RNA: identification of cellular mRNA substrates for RNA-binding proteins. RNA. 5, (8), 1071-1082 (1999).
  7. Tenenbaum, S. A., Carson, C. C., Lager, P. J., Keene, J. D. Identifying mRNA subsets in messenger ribonucleoprotein complexes by using cDNA arrays. Proceedings of National Acadamy of Sciences U S A. 97, (26), 14085-14090 (2000).
  8. Chi, S. W., Zang, J. B., Mele, A., Darnell, R. B. Argonaute HITS-CLIP decodes microRNA-mRNA interaction maps. Nature. 460, (7254), 479-486 (2009).
  9. Zheng, K., et al. Mouse MOV10L1 associates with Piwi proteins and is an essential component of the Piwi-interacting RNA (piRNA) pathway. Proceedings of National Acadamy of Sciences U S A. 107, (26), 11841-11846 (2010).
  10. Gregersen, L. H., et al. MOV10 Is a 5' to 3' RNA helicase contributing to UPF1 mRNA target degradation by translocation along 3' UTRs. Molecular Cell. 54, (4), 573-585 (2014).
  11. Banerjee, S., Neveu, P., Kosik, K. S. A coordinated local translational control point at the synapse involving relief from silencing and MOV10 degradation. Neuron. 64, (6), 871-884 (2009).
  12. Choi, J., Hwang, S. Y., Ahn, K. Interplay between RNASEH2 and MOV10 controls LINE-1 retrotransposition. Nucleic Acids Research. 46, (4), 1912-1926 (2018).
  13. Goodier, J. L., Cheung, L. E., Kazazian, H. H. Jr MOV10 RNA helicase is a potent inhibitor of retrotransposition in cells. PLoS Genetics. 8, (10), e1002941 (2012).
  14. Haussecker, D., et al. Capped small RNAs and MOV10 in human hepatitis delta virus replication. Nature Structural & Molecular Biology. 15, (7), 714-721 (2008).
  15. Kenny, P. J., et al. MOV10 and FMRP regulate AGO2 association with microRNA recognition elements. Cell Reports. 9, (5), 1729-1741 (2014).
  16. Messaoudi-Aubert, S. E., et al. Role for the MOV10 RNA helicase in Polycomb-mediated repression of the INK4a tumor suppressor. Nature Structural & Molecular Biology. 17, (7), 862-868 (2010).
  17. Sievers, C., Schlumpf, T., Sawarkar, R., Comoglio, F., Paro, R. Mixture models and wavelet transforms reveal high confidence RNA-protein interaction sites in MOV10 PAR-CLIP data. Nucleic Acids Research. 40, (20), e160 (2012).
  18. Skariah, G., et al. Mov10 suppresses retroelements and regulates neuronal development and function in the developing brain. BMC Biology. 15, (1), 54 (2017).
  19. Zheng, K., Wang, P. J. Blockade of pachytene piRNA biogenesis reveals a novel requirement for maintaining post-meiotic germline genome integrity. PLoS Genetics. 8, (11), e1003038 (2012).
  20. Vourekas, A., et al. The RNA helicase MOV10L1 binds piRNA precursors to initiate piRNA processing. Genes & Development. 29, (6), 617-629 (2015).
  21. Hocq, R., Paternina, J., Alasseur, Q., Genovesio, A., Le Hir, H. Monitored eCLIP: high accuracy mapping of RNA-protein interactions. Nucleic Acids Research. 46, (21), 11553-11565 (2018).
  22. Huppertz, I., et al. iCLIP: protein-RNA interactions at nucleotide resolution. Methods. 65, (3), 274-287 (2014).
  23. Hafner, M., et al. Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 141, (1), 129-141 (2010).
  24. Hafner, M., et al. PAR-CliP--a method to identify transcriptome-wide the binding sites of RNA binding proteins. Journal of Visualized Experiments. (41), (2010).
  25. Konig, J., et al. iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nature Structural & Molecular Biology. 17, (7), 909-915 (2010).
  26. Konig, J., et al. iCLIP--transcriptome-wide mapping of protein-RNA interactions with individual nucleotide resolution. Journal of Visualized Experiments. (50), (2011).
  27. Maticzka, D., Ilik, I. A., Aktas, T., Backofen, R., Akhtar, A. uvCLAP is a fast and non-radioactive method to identify in vivo targets of RNA-binding proteins. Nature Communications. 9, (1), 1142 (2018).
  28. Van Nostrand, E. L., et al. Robust transcriptome-wide discovery of RNA-binding protein binding sites with enhanced CLIP (eCLIP). Nature Methods. 13, (6), 508-514 (2016).
  29. Radulovich, N., Leung, L., Tsao, M. S. Modified gateway system for double shRNA expression and Cre/lox based gene expression. BMC Biotechnology. 11, 24 (2011).
  30. Breunig, C. T., et al. A Customizable Protocol for String Assembly gRNA Cloning (STAgR). Journal of Visualized Experiments. (142), (2018).
  31. Kuhn, R. M., Haussler, D., Kent, W. J. The UCSC genome browser and associated tools. Briefings in Bioinformatics. 14, (2), 144-161 (2013).
  32. Vourekas, A., et al. Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis. Nature Structural & Molecular Biology. 19, (8), 773-781 (2012).
  33. Preitner, N., et al. APC is an RNA-binding protein, and its interactome provides a link to neural development and microtubule assembly. Cell. 158, (2), 368-382 (2014).
  34. Meyer, C., et al. The TIA1 RNA-Binding Protein Family Regulates EIF2AK2-Mediated Stress Response and Cell Cycle Progression. Molecular Cell. 69, (4), 622-635 (2018).
  35. Gerstberger, S., Hafner, M., Tuschl, T. A census of human RNA-binding proteins. Nature Reviews Genetics. 15, (12), 829-845 (2014).
  36. Vourekas, A., Mourelatos, Z. HITS-CLIP (CLIP-Seq) for mouse Piwi proteins. Methods in Molecular Biology. 1093, 73-95 (2014).
Gelişmiş Crosslinking Immünoprecipitation (eCLIP) fare testis protein bağlı RNA verimli tanımlaması için yöntem
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Xu, Q., Wang, C., Ling, L., Yue, Q., Liu, M., Zhang, S., Fu, K., Ye, L., Zheng, K. Enhanced Crosslinking Immunoprecipitation (eCLIP) Method for Efficient Identification of Protein-bound RNA in Mouse Testis. J. Vis. Exp. (147), e59681, doi:10.3791/59681 (2019).More

Xu, Q., Wang, C., Ling, L., Yue, Q., Liu, M., Zhang, S., Fu, K., Ye, L., Zheng, K. Enhanced Crosslinking Immunoprecipitation (eCLIP) Method for Efficient Identification of Protein-bound RNA in Mouse Testis. J. Vis. Exp. (147), e59681, doi:10.3791/59681 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter