Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biochemistry

Verwendung von Alu-Element enthaltenden Minigenes zur Analyse von kreisförmigen RNAs

doi: 10.3791/59760 Published: March 10, 2020

Summary

Wir klonen und analysieren Reportergene, die kreisförmige RNAs erzeugen. Diese Reportergene sind größer als Konstrukte, um lineare Spleißungen zu analysieren und Alu-Elemente zu enthalten. Zur Untersuchung der kreisförmigen RNAs werden die Konstrukte in Zellen transfiziert und die resultierende RNA wird mit RT-PCR nach Entfernung linearer RNA analysiert.

Abstract

Neben linearen mRNAs erzeugen viele eukaryotische Gene kreisförmige RNAs. Die meisten kreisförmigen RNAs werden generiert, indem eine 5' Spleißstelle mit einer vorgelagerten 3' Spleißstelle innerhalb einer Pre-mRNA, einem Prozess, der als Back-Spleicing bezeichnet wird, angeschlossen wird. Diese Zirkularisierung wird wahrscheinlich durch sekundäre Strukturen in der Pre-mRNA unterstützt, die die Spleißstellen in die Nähe bringen. In menschlichen Genen werden Alu-Elemente gedacht, um diese sekundären RNA-Strukturen zu fördern, da Alu-Elemente reichlich vorhanden sind und Basiskomplementaritäten miteinander aufweisen, wenn sie in entgegengesetzten Richtungen in der Pre-mRNA vorhanden sind. Hier beschreiben wir die Erzeugung und Analyse großer Alu-Elemente, die Reportergene enthalten, die kreisförmige RNAs bilden. Durch die Optimierung von Klonprotokollen können Reportergene mit bis zu 20 kb Insert-Länge erzeugt werden. Ihre Analyse in Co-Transfektionsexperimenten ermöglicht die Identifizierung regulatorischer Faktoren. So kann diese Methode RNA-Sequenzen und zelluläre Komponenten identifizieren, die an der kreisförmigen RNA-Bildung beteiligt sind.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Zirkuläre RNAs
Circular RNAs (circRNAs) sind kovalent geschlossene einsträngige RNAs, die in den meisten Organismen exprimiert werden. Sie werden erzeugt, indem sie eine nachgelagerte 5' Spleißstelle zu einem vorgelagerten 3' Spleißstandort verbinden, ein Prozess, der als Back-Spleicing bezeichnet wird (Abbildung 1A)1. Sequenzen in der Pre-mRNA, die eine Basis komplementär wie 30-40 nt aufweisen, bringen Back-Splice-Sites in die richtige Ausrichtung für die zirkRNA-Bildung2. Beim Menschen bilden Alu-Elemente 1, die etwa 11% des Genoms3darstellen, aufgrund ihrer Selbstkomplementärität4,5 umfangreiche doppelsträngige RNA-Strukturen in pre-mRNA und fördern damit die Bildung von CircRNAs1.

Derzeit wurden drei Hauptfunktionen von circRNAs beschrieben. Einige circRNAs binden microRNAs (miRNAs) und wirken durch Sequestrierung wie miRNA Schwämme6. CircRNAs wurden in die transkriptionelle und posttranskriptionelle Regulierung, durch Wettbewerb mit linearer Spleißung7 oder Modulation der Transkriptionsfaktoraktivität8verwickelt. Schließlich enthalten circRNAs kurze offene Leserahmen und Grundsatzstudien zeigen, dass sie9,10übersetzt werden können. Die Funktion der meisten circRNAs bleibt jedoch rätselhaft. Die meisten zirkulären RNAs wurden mit den Sequenzierungsmethoden der nächsten Generation11erkannt. Detaillierte Analysen einzelner Gene mit gezielten RT-PCR-Ansätzen zeigen, dass eine große Anzahl von kreisförmigen RNAs noch entdeckt werden muss12.

Einsatz von Reportergenen zur Analyse der Pre-mRNA-Verarbeitung
Die Analyse von mRNA, die von DNA-Reporterkonstrukten abgeleitet wurde, die in Zellen transfiziert werden, ist eine etablierte Methode zur Untersuchung alternativer Pre-mRNA-Spleißungen, die auf kreisförmige RNAs angewendet werden können. Im Allgemeinen werden das alternative Exon, seine umgebenden Introns und konstitutive Exons verstärkt und zu einem eukaryotischen Expressionsvektor geklont. Häufig werden die Introns verkürzt. Die Konstrukte werden in eukaryotische Zellen transfiziert und in der Regel von RT-PCR13,14analysiert. Dieser Ansatz wurde ausgiebig verwendet, um regulatorische Spleißstellen und transacting Faktoren in Co-Transfektionsexperimenten13,15,16,17,18zu kartieren. Darüber hinaus ermöglichte die Erzeugung von proteinexstigen Minigenen das Screening von Substanzen, die alternative Spleißen ändern19,20.

Die Methode wurde auf zirkuläre RNAs angewendet. Derzeit sind mindestens 12 Minigen-Rückgrate in der Literatur beschrieben und in Tabelle 1zusammengefasst. Mit Ausnahme des tRNA-basierten Expressionssystems21,22sind sie alle von Polymerase-II-Promotoren abhängig. Hier beschreiben wir eine Methode zur Generierung menschlicher Reporter-Minigene, um cis und trans-acting Faktoren zu bestimmen, die an der Erzeugung von kreisförmigen RNAs beteiligt sind. Eine Übersicht über die Methode anhand von Sequenzen eines veröffentlichten Reportergens23 ist in Abbildung 1dargestellt.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Konstruktion der Konstrukte

  1. Verwenden Sie den UCSC-Genombrowser24, um sich wiederholende Elemente zu identifizieren, die für die kreisförmige RNA-Bildung erforderlich sind, und integrieren Sie sie in die Konstrukte. Wichtig ist, dass Primer für die Verstärkung außerhalb der sich wiederholenden Elemente liegen müssen.
  2. Fügen Sie die kreisförmige RNA-Sequenz(Supplemental Abbildung 1 ist eine Testsequenz) in https://genome.ucsc.edu/cgi-bin/hgBlat?command=start ein und wählen Sie den richtigen Organismus aus. Senden Sie die Sequenz und gehen Sie zur Browseransicht, zoomen Sie 1,5x oder ggf. (Abbildung 2A).
    HINWEIS: Die Suchsequenz wird in der oberen Zeile(Abbildung 2A, 1) angezeigt. Abhängig von der Reihenfolge der Exons in der kreisförmigen RNA verbindet BLAT nicht alle Exons. In diesem Beispiel ist exon 12 (Abbildung 2A, 4) nicht mit 11 verbunden ( Abbildung2A, 2, 3), da exon 12 vor Exon 11 in der kreisförmigen RNA-Sequenz (Supplementale Abbildung 1) liegt. Die sich wiederholenden Elemente befinden sich in der Spur "Wiederholungsmasker", die durch Kästchen gekennzeichnet ist, wobei die farbeschwarze bis graue Farbe die evolutionäre Konservierung anzeigt (Abbildung 2A, 5).
  3. Bewegen Sie die Maus über die sich wiederholenden Elemente, um ihren Subtyp in einem unverankerten Fenster zu identifizieren. Alu-Elemente befinden sich in der SINE-Linie (kurz durchsetztes Kernelement). Verwenden Sie die Schaltfläche "Standardspuren" unter dem Fenster, um den Browser zurückzusetzen, wenn ein anderes Bild als Abbildung 2 erhalten ist.
    HINWEIS: Das Mousing über die Exons in der Genanzeige erzeugt ein Fenster mit Exon-Nummern, die computergeneriert sind. Diese Zahlen entsprechen nicht der in der Literatur festgelegten Exonnummerierung und wechseln auch zwischen Isoformen.

2. Wählen Sie die Sequenz aus, die in einem Ausdrucksvektor geklont werden soll.

  1. Laden Sie die im Fenster gezeigte DNA-Sequenz herunter, indem Sie in der oberen Zeile des UCSC-Genombrowsers die Ansichts-DNA aufrufen. Wählen Sie in der Option Sequencing Formatting OptionErweiterte Fall-/Farboptionenaus.
  2. Wählen Sie die Standardgroß-Kleinschreibung als Niedriger aus, und wählen Sie die Umschaltanfrage für NCBI refseqaus. Wählen Sie Unterstreichung und Fett und Kursiv für Repeat Maskeraus. Klicken Sie auf Senden. Es wird Exons als Großbuchstaben und Introns als kleine Buchstaben geben. Überprüfen Sie die Exon-/Intron-Grenzen.
  3. In diesem Beispiel gibt es eine 'ccctttacCTTTTT' Sequenz, die angibt, dass der Browser die umgekehrte Ergänzung anzeigt. Wenn dies der Fall ist, gehen Sie zurück und wählen Sie das umgekehrte Komplementfeld aus, bis Sie die richtigen Exon-Intron-Grenzen (agEXONgt) sehen, in diesem Beispiel AAAAAGgtaaaggg.
  4. Kopieren Sie die Datei mit der richtigen Ausrichtung (interne Exons sind von intronic ag umgeben... gt) in ein Textverarbeitungsdokument einfließen und die Exons hervorheben (Ergänzende Abbildung 2).
    HINWEIS: In diesem Beispiel ist das genomische Fragment, das die Exons 9-12 umfasst, etwa 24 kb groß und damit zu groß, um aus der genomischen DNA verstärkt zu werden. Daher wird jedes Exon, das von ca. 1 kb intronic-Region umgeben ist, individuell verstärkt und diese vier Fragmente werden in einem Klonvektor zusammengesetzt.
  5. Wählen Sie die zu verstärkenden Fragmente aus (exon 500 nt intron). Stellen Sie sicher, dass das Intron nicht in einem sich wiederholenden Bereich beginnt oder endet, da Primer in diesen Regionen bestimmte Sequenzen nicht verstärken. Die ausgewählten Regionen sind in Abbildung 2Bdargestellt, ihre Sequenzen in der ergänzenden Abbildung 3.
    ANMERKUNG: Im Allgemeinen gilt: Je größer die Konstrukte, desto schwieriger wird das Klonen. Die Fragmente können entweder schrittweise zusammengesetzt werden (d.h. exon 9 wird mit dem Vektor kombiniert und im nächsten Schritt wird exon 10 durch Klonen in dieses Konstrukt eingeführt, bis alle Exons an Ort und Stelle sind), oder alternativ werden alle Fragmente gleichzeitig zusammengesetzt. Ein schrittweiser Ansatz funktioniert immer, erfordert aber mehr Zeit. Eine gleichzeitige Baugruppe funktioniert nicht immer und hängt davon ab, wie gut die einzelnen Fragmente aus der genomischen DNA verstärkt werden können und wie groß das Konstrukt ist. Wir beginnen daher in der Regel mit beiden Ansätzen gleichzeitig.

3. Design-Primer zum Klonen

  1. Verwenden Sie ein Web-Tool (https://nebuilder.neb.com/#!/), um die Primer für das Klonen zu entwerfen. Geben Sie beispielsweise die Fragmente 9, 10, 11 und 12 und die Vektorsequenz (Ergänzende Abbildung 3) in dieses Werkzeug ein.
  2. Fügen Sie für die Vektorsequenz die Einfügestelle als letztes Nukleotid hinzu, und fügen Sie anschließend die Fragmente hinzu. Da die Vektornummerierung nicht mit einer bestimmten Einfügestelle beginnt, befindet sich die Einfügestelle im Vektor und das nachgeschaltete Teil wird vor der Upstream-Sequenz eingelagert. In diesem Beispiel beginnen die Einfügungen direkt nach der HindIII [AAGCTT]-Site und enden direkt nach der PmeI [GTTTAAAC]-Site von pcDNA3.1. Die Sequenz von cccgctgatcag ... ccgtaaaaaggccgc wird vor Position 1 in der pcDNA3.1-Sequenz (gttgctggcgtttttcc ...) eingefügt.
  3. Passen Sie Primer an, wenn ihre Schmelzpunkte mehr als 4 °C voneinander entfernt sind, da sie bei der Verstärkung nicht funktionieren. Die Montage der entworfenen Fragmente und Primersequenzen ist in der ergänzenden Abbildung 4dargestellt. Primer zum Klonen können auch manuell25entworfen werden.

4. PCR- und Amplicon-Erkennung

  1. Standard-PCR-Reaktion: Machen Sie einen Reaktionsmix für ein Gesamtvolumen von 50 l pro Reaktion. Unten ist das Rezept für eine Reaktion mit Polymerase 1:
    10 l 5x Reaktionspuffer
    1 L mit 10 mM dNTPs
    2,5 l von 10 m Vorwärts-Primer
    2,5 l von 10 m Reverse Primer
    0,5 l Polymerase 1
    32,5 l Nukleasefrei H2O
    1. Optional fügen Sie 10 l 5x GC Enhancer hinzu, wenn das Produkt einen hohen GC-Gehalt aufweist; eine separate Mischung mit GC Enhancer herstellen, um die PCR-Reaktion zu testen.
  2. Aliquot 49 l der Mischung in PCR-Röhren pro Reaktionsprobe.
  3. Fügen Sie der PCR 1 l DNA hinzu, die Menge reicht von 10 pg bis 1 ng.
  4. Drehen Sie die Proben herunter, um Rückstände von den Seiten zu entfernen und legen Sie sie in eine PCR-Maschine. Verwenden Sie bei der Optimierung der PCR-Bedingungen die gleiche Maschine sowie die gleichen Stellen in der Maschine.

5. Optimierung für längere DNA-Fragmente für die Verwendung verschiedener Polymerasen

  1. Temperatur
    1. Optimieren Sie die Langstrecken-Polymerase 2.
      1. Verwenden Sie eine niedrigere Denaturierungstemperatur (Polymerase 1: 98 °C, Polymerase 2: 94 °C).
      2. Verwenden Sie eine längere Denaturierungszeit (Polymerase 1: 10 s, Polymerase 2: 30 s).
      3. Verwenden Sie eine längere Glühzeit (Polymerase 1: 30 s, Polymerase 2: 60 s).
      4. Verwenden Sie eine längere Verlängerungszeit (Polymerase 1: 30 s/kb, Polymerase 2: 50 s/kb).
      5. Verwenden Sie eine niedrigere Durchwahltemperatur (Polymerase 1: 72 °C, Polymerase 2: 65 °C).
      6. Verwenden Sie eine Glühtemperatur 5 °C unter dem Tm der Primer.
    2. Optimieren Sie die Primerkonzentrationen (5x weniger bis 5x mehr als die ursprüngliche Primerkonzentration). Optimieren Sie DNA-Konzentrationen von 10 pg bis 50 pg, 100 pg, 1 ng, 5 ng, 10 ng.
    3. Als Beispiel für ein PCR-Programm zur Verstärkung einer Produktgröße von 15 kb mit Polymerase 2 eine anfängliche Denaturierung bei 94 °C für 30 s, DNA-Denaturierung bei 94 °C für 30 s, gefolgt von Glühen bei 58 °C für 30 s und DNA-Verlängerung bei 65 °C für 12 min 30 s. Führen Sie eine Endverlängerung bei 65 °C für 10 min mit einem letzten 4 °C Halten durch.
      HINWEIS: Die glühende Temperatur (Ta) spezifisch für die Primer, die durch webbasierte Temperaturberechnungen bestimmt werden, die für jede Polymerase spezifisch sind. Erweiterungszeiten können variieren und müssen optimiert werden, wenn Fragmente größer als 10 KB sind.
  2. Verlängerungszeiten und DNA-Konzentrationen
    1. Verwenden Sie längere Verlängerungszeiten für DNA-Fragmente über 6 kb: 1 min pro 1 kb. Längere Fragmente sollten weniger DNA verwenden.
    2. Führen Sie Verdünnungen der DNA durch, um die optimale DNA-Konzentration für die Amplifikation zu finden, in der Regel 1 pg bis 1 ng für Plasmide oder 1 ng bis 1 g für genomische DNA.
      HINWEIS: Für die meisten Klonen verwenden Polymerase 1, entwickelt durch Verschmelzung der Sso7d DNA-Bindungsdomäne zu einer proprietären thermostabilen DNA-Polymerase26. Die Polymerase hat eine niedrige Fehlerrate und aufgrund der Sso7d-Domäne eine hohe Prozessivität, die benötigt wird, um große (10-15 kb) genomische Fragmente zu verstärken. Aufgrund dieser großen Fragmentgröße wird die enzymatische Montage von DNA-Molekülen27 zum Einführen in Vektoren verwendet, da diese Methode keine Restriktionsenzyme erfordert. Die Verstärkung von Fragmenten mit mehr als 15 kb wird mit polymerase 1 immer schwieriger. Für große Fragmentverstärkung verwenden Polymerase 2 aus Pyrococcus-wie Korrektur-Polymerase verschmolzen zu Sso7d oder die Langstrecken-PCR-Kit, die jedoch höhere Fehlerraten gibt.

6. Reinigung von PCR-Produkten zum Klonen

  1. Führen Sie die Hälfte der PCR-Produkte auf 1% Agarose-Gelen, die einen interkalierenden Nukleinsäurefleck enthalten (z. B. 1x GelGreen). Visualisieren Sie die gefärbten Gele auf einem dunklen Lesetransilluminator. Diese gebeizte DNA läuft nicht größengetreu.
    HINWEIS: GelGreen intercalates in DNA, ähnlich wie Ethidiumbromid, aber es wird durch Licht um 500 nm (Cyan) angeregt, eine Wellenlänge, die dna nicht schädigt, was das Klonen stark verbessert.
  2. Parallel dazu die Hälfte der PCR-Produkte auf einem 1%-Gel ausführen, das nach dem Lauf mit Ethidiumbromid gebeizt wird (Abbildung 3A,B).
  3. Verbrauchen Sie Bänder der richtigen Größe aus dem gebeizten Gel (Schritt 6.1) und isolieren SIE DNA mit einem Gel und PCR Cleanup Kit. Abweichend von seinem Standardprotokoll wird die DNA in nur 20 l doppelt destilliertem Wasser, da die DNA-Konzentrationen in der Regel niedrig sind, elute.
  4. Überprüfen Sie vor dem Klonen die isolierte DNA eines Agarose-Gels auf Konzentration und Integrität (Abbildung 3B). Ziel für eine 2:1 Molaren-Einsatz-Vektor-Verhältnis. Bei Verwendung mehrerer Einsätze beträgt das Verhältnis 2:2:2:1.

7. DNA-Montage und Klon-Erkennung

HINWEIS: Das Klonen erfolgt mit einem enzymatischen DNA-Montagekit mit geringfügigen Modifikationen. Die Montage erfolgt für 60 min bei 50 °C und in der Regel wird der untere DNA-Bereich für die Montage verwendet (20-100 fmol/20 l Reaktion). Der gesamte Reaktionsmix wird chemisch kompetenten Zellen zugesetzt und die ganzen Zellen auf einer 6 cm Agarplatte plattiert.

  1. Kombinieren Sie den Vektor und fügen Sie in einem 1:2-Molarenverhältnis (je 20-500 Fmol) in 10 l Wasser ein.
  2. Fügen Sie 10 L DNA Assembly Master Mix hinzu.
  3. Proben 60 Minuten bei 50 °C inkubieren.
  4. Als nächstes transformieren Sie kompetente Zellen mit der Gesamtmontagereaktion. Verwenden Sie hier E. coli-Stamm 1-Zellen für kürzere Konstrukte oder E. coli-Stamm 2-Zellen für längere oder instabile Konstrukte. Die Zellen sollten in einem Volumen von 50 l sein.
  5. Die Zellen auf Demeis auftauen und den kompetenten Zellen 2 L des gekühlten, zusammengesetzten Produkts hinzufügen. Mischen Sie durch sanftes Streichen der Röhre 4-5 mal. Wirbel nicht.
  6. Lassen Sie die Mischung 30 min auf dem Eis sitzen.
  7. Hitzeschock bei 42 °C für 30 s. Nicht mischen.
  8. Übertragen Sie die Röhre für 2 min zurück auf das Eis.
  9. Fügen Sie dem Rohr 950 L RAUMtemperatur-SOC-Medien hinzu.
  10. Inkubieren Sie das Reaktionsrohr bei 37 °C für 60 min. Kräftig schütteln (300 U/min).
  11. Warme Selektionsplatten mit dem entsprechenden Antibiotikum während der Inkubation bei 37 °C.
  12. Pellet die Zellen durch Zentrifugation (10.000 x g, 30 s) und Platte aus 1/4 und 3/4 der Zellen auf zwei Selektionsplatten und inkubieren bei 37 °C über Nacht.

8. Validierung von Klonen

  1. Verwenden Sie Kolonie-PCR, wobei PCR-Primer verwendet werden, die die Montagestandorte überspannen (Abbildung 1C) für die Erkennung.
  2. Nehmen Sie einen sterilen Zahnstocher und berühren Sie eine einzelne Bakterienkolonie.
  3. Berühren Sie den Boden eines PCR-Rohrs mit dem Zahnstocher, der die Kolonie hat, und streifen Sie dann den Zahnstocher auf einer Antibiotikum-Agarplatte, bebrüten Sie die gestreifte Platte bei 37 °C oder Raumtemperatur für empfindliche Konstrukte über Nacht.
  4. Überlagerung der PCR-Röhre, die mit der Kolonie berührt wurde, mit einem PCR-Mix, der die Erkennungsprimer enthält. Diese werden mit Primer 3 (http://bioinfo.ut.ee/primer3-0.4.0/) entwickelt. Das Programm hat die Möglichkeit, das Primerdesign über eine definierte Sequenz zu erzwingen, indem die "[ccc]"-Zeichen verwendet werden, um Primer über den Baugruppenknoten auszuwählen. DNA von positiven Stämmen wird isoliert und durch Sequenzierung verifiziert.

9. Analyse von kreisförmigen RNA-exemittiven Reportergenen

  1. Zur Analyse, transfekieren Reporter Gene in eukaryotische Zellen. Verwenden Sie hier HEK293-Zellen (ATTC #CRL-1573), da sie eine hohe Transfektionseffizienz bieten. Um Kosten zu sparen, verwenden Sie PEI-Lösungen (Polyethylenimin).
  2. Für die PEI-Lösung lineares Polyethyleneiminhydrochlorid (PEI) bei 1 mg/ml in Wasser bei niedrigem pH-Wert, pH2 auflösen. Den pH-Wert mit NaOH auf 7 hochbringen. Sterilfilter mit 0,22 m Filtern und bei 4 °C lagern.
  3. Teilen Sie Zellen in sechs Brunnen (ca. 150.000 Zellen pro Brunnen) auf und lassen Sie sie über Nacht in 10% FBS in DMEM-Medien wachsen.
  4. Aliquot 1 g des Reporter-Gens in einer sterilen Röhre und fügen Sie 200 l steril gefiltert150 mM NaCl hinzu. Mischen Sie mit der DNA durch Wirbeln.
  5. Fügen Sie PEI-Lösung zu dieser Mischung und Wirbel, kurz Zentrifuge, um Proben am Boden des Rohres zu sammeln. Verwenden Sie ein Verhältnis von 1 g DNA pro 3 l PEI.
  6. Bei Raumtemperatur 10 min inkubieren und dann direkt zu HEK 293 Zellen hinzufügen.
  7. HEK293-Zellen bei 37 °C, 5%CO2über Nacht inkubieren.
  8. Isolieren Sie RNA für RT-PCR über ein RNA-Isolationskit.

10. RNase R Behandlung zur Entfernung linearer RNAs

  1. Verwenden Sie 10 g Gesamt-RNA in einer RNase-freien Röhre.
  2. 10 l 10x RNase R Puffer (0,2 M Tris-HCl (pH 8,0), 1 M KCl, 1 mM MgCl2) zur RNA geben.
  3. RNase R der RNA hinzufügen (1 l = 20U).
  4. Fügen Sie der RNA 1 l Glykolblau hinzu und bringen Sie das Volumen mit sterilem Wasser auf bis zu 100 l.
  5. Proben bei 37 °C für 30 min inkubieren.
  6. 1 min Phenol/Chloroform und Wirbel hinzufügen.
  7. Zentrifuge bei 21.000 x g für 1 min zu trennenden Phasen.
  8. Nehmen Sie den Überstand (wässrige Phase) und fügen Sie 1 Volumen (ca. 80 l Chloroform) hinzu.
  9. Wirbel für 1 min, und dann Zentrifuge für 1 min zu trennen Phasen.
  10. Überstand nehmen, 1:10 vol KAc und 2,5 Vol Ethanol hinzufügen und bei -20 °C für 1-4 h niederschlagen. Zentrifuge bei 4 °C für 30 min bei voller Geschwindigkeit (21.000 x g). Es wird ein kleines blaues Pellet an der Unterseite sein.
  11. Entfernen Sie den Überstand und waschen Sie ihn mit 80% Ethanol. Lassen Sie die Luft für 5 min bei Raumtemperatur trocknen und lösen Sie sie in 10 l Wasser auf.

11. RT-PCR-Analyse

  1. Verwenden Sie pro RT-Reaktion 1 g RNA.
  2. Machen Sie eine Reaktionsmischung für ein Endvolumen von 20 l pro Reaktion. Für eine Reaktion verwenden Sie 1 l mit 10 mM dNTPs, 1 l 0,1 M Dithiothreitol (DTT), 4 l 5x First-Strand Buffer und 0,5 l Reverse Transcriptase.
  3. Aliquot 6,5 L Reaktionsmischung in neue PCR-Röhren.
  4. Mischen Sie bis zu 5 Primer in einem Mix. Einige Primer können jedoch mit anderen Primern in der PCR(Abbildung 5) nicht miteinander verzahnt werden. Primersequenzen befinden sich in Tabelle 2. Wir verwenden routinemäßig genspezifische Exon-Junction-Primer, aber auch das Priming mit zufälligen Hexamern ist möglich.
  5. Fügen Sie dem gewünschten RT-Reaktionsrohr 1 l von 10 M Reverse Primer hinzu.
  6. Fügen Sie dem PCR-Reaktionsröhrchen 1 g RNA hinzu.
  7. Fügen Sie RNase-freieH2O bis zu einem Gesamtvolumen von 20 l hinzu.
  8. Spin Rohre nach unten, um Rückstände auf der Seite der Rohre zu entfernen und in Thermocycler zu platzieren.
  9. Führen Sie die RT-Reaktion im Thermocycler bei 50 °C 50 Minuten lang aus.
  10. Bewahren Sie RT cDNA bei -20 °C auf oder fahren Sie mit der PCR-Reaktion fort.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Reportergene ermöglichen die Bestimmung regulatorischer Faktoren, die die zirkuläre RNA-Bildung beeinflussen. Diese Reportergene sind jedoch groß und enthalten sich wiederholende Elemente, die DNA-Konstrukte oft instabil machen. Aufgrund ihrer großen Größe ist es oft notwendig, Teile der Introns zu löschen, was durch die Verstärkung genomischer Teile mit den Exons und kleineren flankierenden intronischen Teilen erreicht wird. Diese DNA-Stücke werden enzymatisch zusammengesetzt, so dass Enzyme ohne Einschränkung aufgebaut werden können.

Das Beispiel einer kreisförmigen RNA, die aus dem mikrotubuleassoziierten Protein tau (MAPT) erzeugt wird, zeigt eine Anwendung des Minigenansatzes zur Analyse kreisförmiger RNAs. Das in diesem Beispiel verwendete Tau-Minigen 9-12 wurde mit verschiedenen Spleißfaktoren kotransfiziert, und die Wirkung dieser Spleißfaktoren wurde von RT-PCR erkannt (Abbildung 6). Verschiedene transwirkende Faktoren beeinflussen sowohl die kreisförmige RNA als auch die lineare Pre-mRNA-Bildung. Das Experiment zeigt auch, dass alle Sequenzelemente, die für die kreisförmige RNA-Bildung notwendig sind, im geklonten Fragment lokalisiert sind.

Figure 1
Abbildung 1: Übersicht über die Technik. (A) Ein hypothetisches Gen wird gezeigt. Introns sind Linien, Exons sind Boxen, Alu-Elemente sind kleinere gestreifte Boxen. Das Backsplicing von Exon C nach A erzeugt eine kreisförmige RNA. Die Struktur dieser kreisförmigen RNA ist im Panel (E )dargestellt. (B) Um ein Reportergen zu erzeugen, werden Exons und umgebende Introns (mindestens 500 nt auf jeder Seite) verstärkt. Die Konstrukte sollten sich wiederholende Elemente enthalten, die in der Regel Alu-Elemente beim Menschen sind. Ein Exon vor dem Exon A wurde aufgenommen, um ein zusätzliches Alu-Element bereitzustellen. Die genomischen Fragmente überlappen sich mit ihren flankierenden 25 nt. (C) Fragmente werden in einen Ausdrucksvektor geklont, der von einem CMV-Promotor gesteuert wird. Die erfolgreiche Rekombination wird durch Erkennungsprimer erkannt und durch Sequenzierung validiert. (D) Zellen werden mit diesem Konstrukt transfiziert. (E) Zirkuläre RNA wird isoliert und (F) mit kreisförmigen RNA-spezifischen Primern, bevorzugten Exon-Junction-Primern, verstärkt. Während der PCR-Verstärkung kann auch lineare RNA verstärkt werden (G). (G) Ausrichtung der Primer, die zum Erkennen von kreisförmigen RNAs verwendet werden. Die Vorwärtsgrundierung ist in Sinnesorientierung (d.h. hat die gleiche Sequenz wie die RNA) und die umgekehrte Grundierung befindet sich in Antisense-Orientierung (d.h. ist die umgekehrte Ergänzung der RNA). Beachten Sie, dass sich die Reverse Primer, die sich von RT-PCR für lineare mRNAs unterscheidet, vor dem Vorwärtsprimer befindet. Bitte klicken Sie hier, um eine größere Version dieser Abbildung anzuzeigen.

Figure 2
Abbildung 2: Auswahl der Sequenz für die Minigenkonstruktion. (A) Browseranzeige, nachdem die in Der Ergänzungsabbildung 1 gezeigte Sequenz mit BLAT gegen die menschliche Genomdatenbank ausgeführt wird. Literatur-Exon-Zahlen36 sind in der Genanzeige angegeben, sie unterscheiden sich von den Zahlen, die vom Browser angegeben werden.
1. Die ausgerichteten Sequenzen werden unter 'YourSeq'
2-4. Beachten Sie, dass BLAT aufgrund der Zirkularität der RNA nicht alle Exons mit Linien verbindet, wie es in linearer RNA der Fall ist. Die Exons 10 und 11 (entsprechend 2 und 3) sind angeschlossen, aber exon 12 (entsprechend 4) ist nicht mit exon 11 verbunden.
5. Alu-Elemente werden in der sich wiederholenden Elementspur dargestellt.
(B) Sequenzausrichtung zwischen dem geplanten Konstrukt und der genomischen DNA.
6. Das geplante Konstrukt wurde mit BLAT für die Datenbank ausgeführt.
7. Beachten Sie die Einbeziehung mehrerer Alu-Elemente in das Konstrukt. Bitte klicken Sie hier, um eine größere Version dieser Abbildung anzuzeigen.

Figure 3
Abbildung 3: Beispiel für die Amplicons vor dem Klonen. (A) Optimierte PCR-Produkte getrennt auf einem 1% Agarose-Gel mit 1x GelGreen. Die einzelnen Bänder stellen die PCR-Produkte dar, die in der enzymatischen DNA-Montage verwendet werden. (B) Die Bänder aus (A) wurden aus dem Gel herausgeschnitten und gereinigt. Die gereinigten PCR-Produkte wurden auf einem 1% Agarose-Gel abgetrennt, das anschließend mit Ethidiumbromid gefärbt wurde. Bitte klicken Sie hier, um eine größere Version dieser Abbildung anzuzeigen.

Figure 4
Abbildung 4: Restriktionsanalyse von Reportergenen. Das als Beispiel verwendete Tau 9-12 Minigen wurde mit Restriktionsenzymen geschnitten, die auf größere Rekombinationen hinweisen. Spur 1: Schnitt mit NcoI erwarteten Größen 735 bp, 3345 bp, 6266 bp, Spur 2 schnitt mit XbaI erwartet Größe 10346 bp, Spur 3 geschnitten mit HindIII erwarteten Größen 3951 bp, 6395 bp, Spur 4 schnitt mit SmaI erwartet Größen 1168 bp, 1688 bp, 2708 bp, 4782 bp. Bitte klicken Sie hier, um eine größere Version dieser Abbildung zu sehen.

Figure 5
Abbildung 5: Wirkung der Primermultiplexing und RNase R Behandlung auf die kreisförmige RNA-Erkennung. (A) cDNA aus den Proben A und B aus menschlichen Hirngeweben wurde mit kreisförmigen RNA-Primern exon12_10 Reverse und circTau exon10_11 Forward verstärkt. Die umgekehrte Transkription für die cDNA wurde mit den Primern für lineare und kreisförmige Tau-RNA durchgeführt. Das erwartete Band, das tau-zirkulärer RNA entspricht, wird durch ein Dreieck dargestellt. Die anderen starken Bänder sind Artefakte, die nicht mit dem menschlichen Genom übereinstimmten. (B) Das Experiment wurde mit identischen PCR-Bedingungen wiederholt, aber die umgekehrte Transkription wurde nur mit dem circTau exon12_10 Reverse Primer durchgeführt. Nur das erwartete Band wurde durch Sequenzierung verstärkt und validiert. (C) Die RNA wurde mit RNase R behandelt, die lineare RNA entfernt. Die kreisförmige RNA ist nach der Behandlung nachweisbar (links), während lineare RNA kein nachweisbares Signal mehr gibt (rechts) Bitte klicken Sie hier, um eine größere Version dieser Abbildung anzuzeigen.

Figure 6
Abbildung 6: Beispiel für eine Analyse eines circRNA-Reportergens. 1 g des Tau-9-12-37-Reporter-Gens wurde mit 1 g Spleißfaktoren transfiziert. RNA wurde 24 h nach der Transfektion isoliert und mit RT-PCR analysiert. (A) Verstärkung der linearen Tau mRNA. Durch das alternative Spleißen von Exon 10 werden zwei Bänder beobachtet. Ihr Verhältnis ändert sich aufgrund der Überexpression von Spleißfaktoren38,39. (B) Verstärkung der kreisförmigen 12-10 tau RNA23. Beachten Sie die Abhängigkeit der Tau-CircRNA-Expression von der Expression einiger Spleißfaktoren, insbesondere der cdc2 wie Kinase clk2 und des SR-Proteins 9G8. (C) Die kreisförmige RNA von HIPK3 wurde als Positivkontrolle verwendet, die eine gleichmäßige Belastung anzeigt. Bitte klicken Sie hier, um eine größere Version dieser Abbildung anzuzeigen.

Tabelle 1: Liste der aktuellen Minigene, die kreisförmige RNAs exemiten. Bitte klicken Sie hier, um diese Datei herunterzuladen.

Kreisförmige HIPK3-Steuergrundierer
HIPK3 Rückwärts
HIPK3 Vorwärts
TGCTTGGCTCTCTTTTTTTTC
TCGGCCAGTCATGTATCAAA
Lineare Primer
Tau Exon 12 Rückwärts
Tau Exon 9 Vorwärts
CCCAATCTTCGACTGGACTC
TGTCAAGTCCAAGATCGGCT
Kreis-Primer
circTau exon12_10 Umgekehrt
circTau exon10_11 Vorwärts
CAGCTTCTTATTAATTATCTGCCTTTT
GAGGCGGCAGTGTGCAA

Tabelle 2: Liste der Primer.

Supplemental Figure 1
Ergänzende Abbildung 1: Tau-Zirkel-RNA-Testsequenz. Testsequenz entsprechend einer kreisförmigen RNA aus der MAPT-Lokus. Verschiedene Exons werden durch Unterstreichung, kleine Kappen und große Kappen angezeigt. Bitte klicken Sie hier, um eine größere Version dieser Abbildung anzuzeigen.

Supplemental Figure 2
Ergänzende Abbildung 2: Genomische Sequenz mit dem geplanten Minigen. Exons werden farblich hervorgehoben und sich wiederholende Elemente werden hervorgehoben, kursiv und fett. Graue Schattierung zeigt flankierende Bereiche mit geringer Komplexität an, die zum Generieren von Primern verwendet werden können. Bitte klicken Sie hier, um diese Datei herunterzuladen.

Supplemental Figure 3
Ergänzende Abbildung 3: Sequenzen des geplanten Reportergens. Die Vektorsequenz und die geplanten Genomfragmente werden angezeigt. Bitte klicken Sie hier, um diese Datei herunterzuladen.

Supplemental Figure 4
Ergänzende Abbildung 4: Primer-Design für die Montage. Die Sequenz aus Der ergänzenden Abbildung 3 wurde in das Builder-Tool eingegeben. Bitte klicken Sie hier, um eine größere Version dieser Abbildung anzuzeigen.

Supplemental Figure 5
Ergänzende Abbildung 5: Sequenz des tau 9->12 Reportergens, das als Beispiel verwendet wird. Bitte klicken Sie hier, um diese Datei herunterzuladen.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Im Allgemeinen sind kreisförmige RNAs niedrig reichlich1, was die Untersuchung ihrer Funktion und Bildung erschwert. Ähnlich wie bei linearen RNAs13ermöglicht die Verwendung von Reporter-Minigenes die Identifizierung von cis und trans-wirkenden Faktoren, die die Bildung von kreisförmigen RNAs regulieren. So erzeugt dieser Ansatz Hypothesen, die mit den endogene Genen weiter getestet werden können.

Der wichtigste Schritt ist das Design des Reporter-Gens. Die enzymatische Montage von DNA-Fragmenten ("Gibson klonen"27) erleichtert dieses Design, da es den Bau großer Reportergene unabhängig von Restriktionsstellen ermöglicht.

Die Back-Spleißstellen werden durch flankierende invertierte Wiederholungen zusammengeführt, die bei der Reportergenkonstruktion berücksichtigt werden sollten. Die Wiederholungen werden im Genombrowser 'Repeat Track' mit Anmerkungen angezeigt und die Auswahl zeigt ihre Ausrichtung an. Denken Sie daran, dass Proteine auch die Rückspleißstellen in eine sekundäre Struktur zwingen können, die für die kreisförmige RNA-Expression28 benötigt wird, und für eine unvoreingenommene Analyse sollten 1-2 kb flankierende intronische Regionen untersucht werden.

Um die Stabilität der Konstrukte zu gewährleisten, ist die Art der Bakterienstämme und ihre Wachstumsbedingungen eine wichtige Überlegung. Für kürzere, einfache Konstrukte werden Standard-Klonbakterien verwendet, die fast identisch mit DH5-alpha sind (huA2 (argF-lacZ)U169 phoA glnV44 x 80 (lacZ)M15 gyrA96 recA1 relA1 endA1 thi-1 hsdR17). Für längere Fragmente, die mehr als 6 Alu-Elemente enthalten, Es werden "stabile" kompetente Zellen verwendet, denen eine Rekombiinase (RecA) und Endonuklease (endA1) fehlt (F' proA+B+ lacIq (lacZ)M15 zzf::Tn10 (TetR) (ara-leu) 7697 araD1 39 fhuA 'lacX74 galK16 galE15 e14- '80dlacZ'M15 recA1 relA1 endA1 nupG rpsL (StrR) rph spoT1 (mrr-hsdRMS-mcrBC). Wenn Probleme mit der Rekombination auftreten, die durch niedrige Transformationszahlen angezeigt wird, die transformierten Bakterien auf zwei Platten veranlegen und sie bei 30 oC bzw. 37 oC wachsen lassen. Aufgrund des Vorhandenseins zahlreicher sich wiederholender Elemente in den Minigenen müssen sie vollständig mit Dersequenzierung der nächsten Generation sequenziert werden, die bei 2019-Raten für rund 150 US-Dollar pro Plasmid kommerziell erhältlich ist. Die Reihenfolge des Beispiels ist in der ergänzenden Abbildung 5dargestellt. Darüber hinaus wird routinemäßig eine Polymorphismusanalyse für die Restriktionsfragmentlänge für eine neue größere Vorbereitung der Konstrukte durchgeführt. Wenn Sie beispielsweise Sites verwenden, die das 1-4-fache schneiden, führt dies zu einem charakteristischen Bandmuster, das Rekombinationen ausschließt (Abbildung 4). Es sollten Enzyme ausgewählt werden, die ein charakteristisches Bandmuster von Fragmenten ergeben, die auf einem Agarose-Gel getrennt werden können.

Kreisförmige RNAs werden mit RT-PCR mit exon Junction Primern analysiert, die sich mit dem Backsplicing-Ereignis überlappen (Abbildung 1F). Aufgrund der kreisförmigen Natur der RNA ist der umgekehrte (d.h. Antisense) Primer vor dem Vorwärts-Primer (d.h. Sinn) Grundierung (Abbildung 1G). Primer, die die reichlich exprimierte homeodomain-interagierende Proteinkinase 3 (HIPK3) kreisförmige RNA1 erkennen, werden als positive Kontrolle verwendet. HIPK3- und Minigen-spezifische Reverse-Primer werden in derselben Röhre reverse transkribiert, was ihren Vergleich ermöglicht. PCR-Reaktionen werden mit Primern durchgeführt, die die linearen mRNAs verstärken, um Verarbeitungsmuster von kreisförmigen und linearen Pre-mRNAs zu vergleichen. Wir beobachteten häufig abnorme Bänder, wenn Primer für lineare und kreisförmige RNAs gemischt wurden (Abbildung 5), und halten somit die umgekehrte Transkription dieser Proben getrennt.

Die RT-PCR-Analyse von kreisförmigen RNAs ist anspruchsvoll und muss sorgfältig kontrolliert werden. Obwohl es sensibel und bequem ist, kann es Artefakte erzeugen, die für kreisförmige RNAs29einzigartig sind. Die umgekehrte Transkriptase kann sich mehrmals um den RNA-Kreis bewegen, der Konkatemere erzeugt. Die meisten kreisförmigen RNA-Reportergene erzeugen sowohl kreisförmige als auch lineare RNA, die kreuz-hybridisieren kann, was zu mehr PCR-Artefakten21,30,31führt. Es ist daher zwingend erforderlich, die PCR-Produkte zu sequenzieren und Befunde mit verschiedenen Techniken mit Northern Blots32 oder RNase-Schutz23zu validieren.

Unerklärliche Bänder können auch durch aberrante Amplifikation linearer RNA entstehen. Lineare RNA kann mit der Exonuklease RNase R entfernt werden, die kreisförmige RNAs33 anreichert (Abbildung 5C). Die RNase R-Behandlung hilft bei der anfänglichen Optimierung von Erkennungsprimern und kann oft weggelassen werden, sobald Primer optimiert sind.

Alternatives Back-Spleißen kann auch zu unerklärlichen Bändern beitragen, da mehrere kreisförmige RNAs aus einem genomischen Lokus34gebildet werden können. Diese alternative Back-Spleißung ist oft das Ergebnis konkurrierender Pre-mRNA-Strukturen, die durch mehr als zwei invertierte Wiederholungselemente gebildet werden. Darüber hinaus können kryptische Back-Splice-Sites auftreten32,35. Je nach Versuchsziel können Alu-Elemente wiederholt oder zu den Konstrukten hinzugefügt werden. Die komplementären Bereiche, die rückenspleißende Stellen flankieren, können so kurz wie 30-40 nt35 sein und der Austausch von Alu-Elementen mit kürzeren komplementären Regionen kann die kreisförmige RNA-Bildung2erhöhen, die getestet werden kann, um die kreisförmige RNA-Bildung zu verbessern. Sobald die Pre-mRNA-Sequenzen identifiziert wurden, die Rückspleißen verursachen, ist es somit möglich, kreisförmige RNA-Expressionskonstrukte zu verkürzen, die in einigen Fällen die Transfektionseffizienz verbessern können.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Nichts zu verraten.

Acknowledgments

Diese Arbeit wurde vom DoD-Zuschuss des Verteidigungsministeriums AZ180075 unterstützt. Stefan Stamm dankt Jacqueline Noonan Endowment. Unterstützt wurde Anna Pawluchin vom DAAD, dem deutschen akademischen Austauschprogramm, Justin R. Welden erhielt den Max Steckler Award der University of Kentucky.

Materials

Name Company Catalog Number Comments
(PEI) Hydrochloride Polysciences 24765-1
Builder tool NEB https://nebuilder.neb.com/#!/
Dark Reader Transilluminator. Clare Chemical Research
Enzymatic DNA assembly kit NEB E2621S
Gel and PCR cleanup kit Promega A9282
Glyco Blue Thermo Fisher AM9516
pcDNA3.1 cloning site Polycloning site https://assets.thermofisher.com/TFS-Assets/LSG/manuals/pcdna3_1_man.pdf
Polymerase 1 NEB M0491L Q5 DNA polymerase
Polymerase 2 Biorad 1725310 Long range polymerase (NEB), iproof (BioRad)
Polymerase 2 Qiagen 206402 Qiagen long range polymerase kit
Reverse Transcriptase Thermo Fisher 18080044
RNA isolation kit Life Technologies 12183025 Ambion by Life Technologies
RNAse R Lucigen RNR07250 Epicenter/Lucigen
Stable competent cells NEB C3040H NEB stable cells
Standard cloning bacteria NEB C2988J NEB5-alpha competent
Web tool to design primers NEB https://nebuilder.neb.com/#!/
Web-based temperature calculations NEB https://tmcalculator.neb.com/#!/main

DOWNLOAD MATERIALS LIST

References

  1. Jeck, W. R., et al. Circular RNAs are abundant, conserved, and associated with ALU repeats. RNA. 19, (2), 141-157 (2013).
  2. Zhang, X. O., et al. Complementary sequence-mediated exon circularization. Cell. 159, (1), 134-147 (2014).
  3. Deininger, P. Alu elements: know the SINEs. Genome Biology. 12, (12), 236 (2011).
  4. Bazak, L., Levanon, E. Y., Eisenberg, E. Genome-wide analysis of Alu editability. Nucleic Acids Research. 42, (11), 6876-6884 (2014).
  5. Levanon, E. Y., et al. Systematic identification of abundant A-to-I editing sites in the human transcriptome. Nature Biotechnology. 22, (8), 1001-1005 (2004).
  6. Hansen, T. B., et al. Natural RNA circles function as efficient microRNA sponges. Nature. 495, (7441), 384-388 (2013).
  7. Kelly, S., Greenman, C., Cook, P. R., Papantonis, A. Exon Skipping Is Correlated with Exon Circularization. Journal of Molecular Biology. 427, (15), 2414-2417 (2015).
  8. Li, Z., et al. Exon-intron circular RNAs regulate transcription in the nucleus. Nature Structural & Molecular Biology. 22, (3), 256-264 (2015).
  9. Yang, Y., et al. Extensive translation of circular RNAs driven by N(6)-methyladenosine. Cell Research. 27, (6), 626-641 (2017).
  10. Abe, N., et al. Rolling Circle Translation of Circular RNA in Living Human Cells. Scientific Reports. 5, 16435 (2015).
  11. Salzman, J., Chen, R. E., Olsen, M. N., Wang, P. L., Brown, P. O. Cell-type specific features of circular RNA expression. PLOS Genetics. 9, (9), 1003777 (2013).
  12. Ottesen, E. W., Luo, D., Seo, J., Singh, N. N., Singh, R. N. Human Survival Motor Neuron genes generate a vast repertoire of circular RNAs. Nucleic Acids Research. 47, (6), 2884-2905 (2019).
  13. Stoss, O., Stoilov, P., Hartmann, A. M., Nayler, O., Stamm, S. The in vivo minigene approach to analyze tissue-specific splicing. Brain Research Protocols. 4, 383-394 (1999).
  14. Mardon, H. J., Sebastio, G., Baralle, F. E. A role for exon sequences in alternative splicing of the human fibronectin gene. Nucleic Acids Research. 15, 7725-7733 (1987).
  15. Gaildrat, P., et al. Use of splicing reporter minigene assay to evaluate the effect on splicing of unclassified genetic variants. Methods in Molecular Biology. 653, 249-257 (2010).
  16. Cooper, T. A. Use of minigene systems to dissect alternative splicing elements. Methods. 37, (4), 331-340 (2005).
  17. Baralle, D., Baralle, M. Splicing in action: assessing disease causing sequence changes. Journal of Medical Genetics. 42, (10), 737-748 (2005).
  18. Percifield, R., Murphy, D., Stoilov, P. Medium throughput analysis of alternative splicing by fluorescently labeled RT-PCR. Methods in Molecular Biology. 1126, 299-313 (2014).
  19. Stoilov, P., Lin, C. H., Damoiseaux, R., Nikolic, J., Black, D. L. A high-throughput screening strategy identifies cardiotonic steroids as alternative splicing modulators. Proceedings of the National Academy of Sciences of the United States of America. 105, (32), 11218-11223 (2008).
  20. Shen, M., et al. Pyrvinium pamoate changes alternative splicing of the serotonin receptor 2C by influencing its RNA structure. Nucleic Acids Research. 41, (6), 3819-3832 (2013).
  21. Noto, J. J., Schmidt, C. A., Matera, A. G. Engineering and expressing circular RNAs via tRNA splicing. RNA Biology. 1-7 (2017).
  22. Schmidt, C. A., Noto, J. J., Filonov, G. S., Matera, A. G. A Method for Expressing and Imaging Abundant, Stable, Circular RNAs In Vivo Using tRNA Splicing. Methods in Enzymology. 572, 215-236 (2016).
  23. Welden, J. R., van Doorn, J., Nelson, P. T., Stamm, S. The human MAPT locus generates circular RNAs. Biochimica et Biophysica Acta - Molecular Basis of Disease. 2753-2760 (2018).
  24. Casper, J., et al. The UCSC Genome Browser database: 2018 update. Nucleic Acids Research. 46, 762-769 (2018).
  25. Grozdanov, P. N., MacDonald, C. C. Generation of plasmid vectors expressing FLAG-tagged proteins under the regulation of human elongation factor-1alpha promoter using Gibson assembly. Journal of Visualized Experiments. (96), (2015).
  26. Wang, Y., et al. A novel strategy to engineer DNA polymerases for enhanced processivity and improved performance in vitro. Nucleic Acids Research. 32, (3), 1197-1207 (2004).
  27. Gibson, D. G., et al. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nature Methods. 6, (5), 343-345 (2009).
  28. Conn, S. J., et al. The RNA binding protein quaking regulates formation of circRNAs. Cell. 160, (6), 1125-1134 (2015).
  29. Jeck, W. R., Sharpless, N. E. Detecting and characterizing circular RNAs. Nature Biotechnology. 32, (5), 453-461 (2014).
  30. Pamudurti, N. R., et al. Translation of CircRNAs. Molecular Cell. 66, (1), 9-21 (2017).
  31. Kramer, M. C., et al. Combinatorial control of Drosophila circular RNA expression by intronic repeats, hnRNPs, and SR proteins. Genes & Development. 29, (20), 2168-2182 (2015).
  32. Starke, S., et al. Exon circularization requires canonical splice signals. Cell Reports. 10, (1), 103-111 (2015).
  33. Suzuki, H., Tsukahara, T. A view of pre-mRNA splicing from RNase R resistant RNAs. International Journal of Molecular Sciences. 15, (6), 9331-9342 (2014).
  34. Zhang, X. O., et al. Diverse alternative back-splicing and alternative splicing landscape of circular RNAs. Genome Research. 26, (9), 1277-1287 (2016).
  35. Liang, D., Wilusz, J. E. Short intronic repeat sequences facilitate circular RNA production. Genes & Development. 28, (20), 2233-2247 (2014).
  36. Wang, Y., Mandelkow, E. Tau in physiology and pathology. Nature Reviews Neuroscience. 17, (1), 5-21 (2016).
  37. Fejes-Toth, K., et al. Post-transcriptional processing generates a diversity of 5'-modified long and short RNAs. Nature. 457, (7232), 1028-1032 (2009).
  38. Gao, Q. S., et al. Complex regulation of tau exon 10, whose missplicing causes frontotemporal dementia. Journal of Neurochemistry. 74, (2), 490-500 (2000).
  39. Hartmann, A. M., et al. Regulation of alternative splicing of human tau exon 10 by phosphorylation of splicing factors. Molecular and Cellular Neuroscience. 18, (1), 80-90 (2001).
  40. Wang, Y., Wang, Z. Efficient backsplicing produces translatable circular mRNAs. RNA. 21, (2), 172-179 (2015).
  41. Yang, Y., Wang, Z. Constructing GFP-Based Reporter to Study Back Splicing and Translation of Circular RNA. Methods in Molecular Biology. 1724, 107-118 (2018).
  42. Zheng, Q., et al. Circular RNA profiling reveals an abundant circHIPK3 that regulates cell growth by sponging multiple miRNAs. Nature Communications. 7, 11215 (2016).
  43. Jia, W., Xu, B., Wu, J. Circular RNA expression profiles of mouse ovaries during postnatal development and the function of circular RNA epidermal growth factor receptor in granulosa cells. Metabolism. 85, 192-204 (2018).
  44. Liang, D., et al. The Output of Protein-Coding Genes Shifts to Circular RNAs When the Pre-mRNA Processing Machinery Is Limiting. Molecular Cell. 68, (5), 940-954 (2017).
  45. Legnini, I., et al. Circ-ZNF609 Is a Circular RNA that Can Be Translated and Functions in Myogenesis. Molecular Cell. 66, (1), 22-37 (2017).
  46. Li, X., et al. Coordinated circRNA Biogenesis and Function with NF90/NF110 in Viral Infection. Molecular Cell. 67, (2), 214-227 (2017).
  47. Zhang, Y., et al. The Biogenesis of Nascent Circular RNAs. Cell Reports. 15, (3), 611-624 (2016).
Verwendung von <em>Alu-Element</em> enthaltenden Minigenes zur Analyse von kreisförmigen RNAs
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Welden, J. R., Pawluchin, A., van Doorn, J., Stamm, S. Use of Alu Element Containing Minigenes to Analyze Circular RNAs. J. Vis. Exp. (157), e59760, doi:10.3791/59760 (2020).More

Welden, J. R., Pawluchin, A., van Doorn, J., Stamm, S. Use of Alu Element Containing Minigenes to Analyze Circular RNAs. J. Vis. Exp. (157), e59760, doi:10.3791/59760 (2020).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter