Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biochemistry

Uso dell'elemento Alu contenente Minigenes per analizzare gli RNA circolari

doi: 10.3791/59760 Published: March 10, 2020

Summary

Cloniamo e analizziamo i geni dei reporter generando RNA circolari. Questi geni reporter sono più grandi dei costrutti per analizzare lo splicing lineare e contenere elementi Alu. Per studiare gli RNA circolari, i costrutti vengono trasfettati in cellule e l'RNA risultante viene analizzato utilizzando RT-PCR dopo la rimozione dell'RNA lineare.

Abstract

Oltre agli mRNA lineari, molti geni eucarioti generano RNA circolari. La maggior parte degli RNA circolari sono generati dall'unendo un sito di giunzione di 5' con un sito di giunzione a monte a monte di 3' all'interno di un pre-mRNA, un processo chiamato back-splicing. Questa circolarizzazione è probabilmente aiutata da strutture secondarie nel pre-mRNA che portano i siti di giunzione in stretta vicinanza. Nei geni umani, si pensa che gli elementi alu promuovano queste strutture secondarie dell'RNA, poiché gli elementi Alu sono abbondanti e presentano complementarità di base tra loro quando sono presenti in direzioni opposte nel pre-mRNA. Qui, descriviamo la generazione e l'analisi di grandi elementi Alu contenenti geni reporter che formano RNA circolari. Attraverso l'ottimizzazione dei protocolli di clonazione, è possibile generare geni reporter con una lunghezza di inserto fino a 20 kb. La loro analisi negli esperimenti di co-trasfezione consente l'identificazione di fattori normativi. Pertanto, questo metodo può identificare le sequenze di RNA e i componenti cellulari coinvolti nella formazione circolare dell'RNA.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

RNA circolari
Gli RNA circolari (circRNA) sono rna a singolo spiaggiamento chiusi covalentmente chiusi che sono espressi nella maggior parte degli organismi. Vengono generati unendo un sito di giunzione a un downstream 5' a un sito di giunzione a monte 3', un processo chiamato back-splicing (Figura 1A)1. Le sequenze nel pre-mRNA che presentano una base complementare fino a 30-40 nt portano i siti di giunzione posteriore in un corretto allineamento per la formazione di circRNA2. Nell'uomo, gli elementi Alu 1, che rappresentano circa l'11% del genoma3, formano ampie strutture di RNA a doppio filamento nel pre-mRNA a causa della loro auto-complementarità4,5 e quindi promuovono la formazione di circRNA1.

Attualmente, sono state descritte tre funzioni principali dei circRNA. Alcuni circRNA legano microRNA (miRNA) e attraverso il sequestro agiscono come spugne di miRNA6. I circRNA sono stati implicati nella regolazione trascrizionale e post trascrizionale, attraverso la concorrenza con la giunzione lineare7 o la modulazione dell'attività del fattore di trascrizione8. Infine, i circRNA contengono brevi cornici di lettura aperte e studi di prova di principio dimostrano che possono essere tradotti9,10. Tuttavia, la funzione della maggior parte dei circolrRNA rimane enigmatica. La maggior parte degli RNA circolari è stata rilevata utilizzando i metodi di sequenziamento di nuova generazione11. Analisi dettagliate di singoli geni utilizzando approcci RT-PCR mirati rivelano che un gran numero di RNA circolari rimane da scoprire12.

Uso dei geni dei reporter per analizzare l'elaborazione pre-mRNA
L'analisi dell'mRNA derivato dai costrutti di segnalazione del DNA trasinfezione in cellule è un metodo ben consolidato per studiare lo splicing pre-mRNA alternativo, che può essere applicato agli RNA circolari. In generale, l'eson alternativo, gli introni circostanti e gli estrusioni coniugali vengono amplificati e clonati in un vettore di espressione eucatra. Spesso, gli introni sono accorciati. I costrutti sono trasfettati in cellule eucariotiche e di solito analizzati da RT-PCR13,14. Questo approccio è stato ampiamente utilizzato per mappare i siti di giunzione regolamentare e i fattori di trans-azione negli esperimenti di co-trasfezione13,15,16,17,18. Inoltre, la generazione di minigeni proteici ha permesso lo screening di sostanze che cambiano lo splicing alternativo19,20.

Il metodo è stato applicato agli RNA circolari. Attualmente, almeno 12 backbone minigene sono stati descritti nella letteratura e sono riassunti nella tabella 1. Ad eccezione del sistema di espressione basato sul tRNA21,22, tutti dipendono dai promotori di polimerasi II. Qui, descriviamo un metodo per generare minigeni di reporter umani per determinare i fattori di cis e trans-azione coinvolti nella generazione di RNA circolari. Una panoramica del metodo che utilizza sequenze di un reporter genepubblicato 23 è illustrata nella Figura 1.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Progettazione dei costrutti

  1. Utilizzare il browser genoma UCSC24 per identificare gli elementi ripetitivi necessari per la formazione circolare di RNA e incorporarli nei costrutti. È importante sottolineare che i numeri di forza per l'amplificazione devono essere al di fuori degli elementi ripetitivi.
  2. Incollare la sequenza circolare dell'RNA (Supplemental Figure 1 è una sequenza di prova) in https://genome.ucsc.edu/cgi-bin/hgBlat?command=start e selezionare l'organismo giusto. Inviare la sequenza e passare alla visualizzazione browser, ridurre 1.5x o, a seconda dei casi (Figura 2A).
    NOTA: la sequenza di ricerca viene visualizzata nella riga superiore (Figura 2A, 1). A seconda dell'ordine degli esoni nell'RNA circolare, BLAT non collegherà tutti gli esoni. In questo esempio, exon 12 (Figura 2A, 4) non è connesso a 11 ( Figura2A, 2, 3), perché exon 12 è a monte di esone 11 nella sequenza circolare di RNA ( Figurasupplementare 1). Gli elementi ripetitivi si trovano nella traccia "ripeti masker", indicata da scatole, dove il colore nero-grigio indica la conservazione evolutiva (Figura 2A, 5).
  3. Passare il mouse sugli elementi ripetitivi per identificarne il sottotipo in una finestra mobile. Gli elementi Alu sono nella linea SINE (elemento nucleare breve intervallato). Utilizzare il pulsante 'default tracks' sotto la finestra per reimpostare il browser se si ottiene un'immagine diversa da quella della figura 2.
    NOTA: il mousingo degli esoni nel display genico genera una finestra con numeri esoni generati al computer. Questi numeri non corrispondono alla numerazione degli esoni stabilita nella letteratura e cambiano anche tra le isoformi.

2. Selezionare la sequenza da clonare in un vettore di espressione

  1. Scarica la sequenza di DNA mostrata nella finestra andando su Visualizza il DNA sulla linea superiore del browser del genoma UCSC. In Opzione di formattazione sequenza, selezionare Opzioni maiuscole/minuscole estese/colore.
  2. Selezionare il caso di default come Inferiore e selezionare Attiva/Disattiva caso per riferimento NCBI. Selezionare sottolineato, grassetto e corsivo per Controllo repeat . Fare clic su Invia. Ci saranno esoni come lettere maiuscole e introni come lettere minuscole. Controllare i bordi di eson/intron.
  3. In questo esempio è presente una sequenza 'ccctttacCTTTT', che indica che il browser mostra il complemento inverso. In questo caso, tornare indietro e selezionare la casella di complemento inverso fino a visualizzare i bordi di exon intron corretto (agEXONgt), in questo esempio AAAAAGgtaaaggg.
  4. Copiare il file con l'orientamento corretto (gli esoni interni sono circondati da ag... gt) in un documento di elaborazione testi ed evidenziare gli esoni (Figura supplementare 2).
    NOTA: In questo esempio, il frammento genomico che comprende esoni 9-12 è di circa 24 kb e quindi troppo grande per essere amplificato dal DNA genomico. Pertanto, ogni esonio circondato da circa 1 kb regione intronica è singolarmente amplificato e questi quattro frammenti sono assemblati in un vettore di clonazione.
  5. Selezionare i frammenti da amplificare (esone - 500 nt intron). Assicurarsi che l'intron non inizi o termini in una regione ripetitiva, poiché i primer di queste regioni non amplificano sequenze specifiche. Le aree selezionate sono illustrate nella Figura 2Be le relative sequenze sono illustrate nella figura supplementare 3.
    NOTA: In generale, più grandi sono i costrutti, più difficile sarà la clonazione. I frammenti possono essere assemblati sia passo saggio (cioè, esone 9 è combinato con il vettore e nel passo successivo exon 10 viene introdotto in questo costrutto tramite clonazione fino a quando tutti gli esoni sono a posto), o in alternativa, tutti i frammenti vengono assemblati contemporaneamente. Un approccio graduale funziona sempre ma richiede più tempo. Un assemblaggio simultaneo non sempre funziona e dipende da quanto bene i singoli frammenti possono essere amplificati dal DNA genomico e dalle dimensioni complessive del costrutto. Quindi di solito iniziamo con entrambi gli approcci contemporaneamente.

3. Progettare i primer per la clonazione

  1. Utilizzare uno strumento Web (https://nebuilder.neb.com/#!/) per progettare le prime rinportatrici per la clonazione. Ad esempio, immettere i frammenti 9, 10, 11 e 12 e la sequenza vettoriale (Figura supplementare 3) a questo strumento.
  2. Per la sequenza vettoriale, aggiungere il sito di inserimento come ultimo nucleotide e successivamente aggiungere i frammenti. Poiché la numerazione dei vettori non inizia con un determinato sito di inserimento, il sito di inserimento nel vettore si trova e la parte a valle viene inserita davanti alla sequenza a monte. In questo esempio gli inserti iniziano subito dopo il sito HindIII [AAGCTT] e terminano subito dopo il sito PmeI [GTTTAAAC] di pcDNA3.1. La sequenza da cccgctgatcag ... ccgtaaaaaggccgc è incollato davanti alla posizione 1 nella sequenza pcDNA3.1 (gttgctggtgtttttcc ...).
  3. Regolare i primer se i loro punti di fusione sono più di 4 gradi centigradi di distanza, in quanto non funzioneranno in amplificazione. L'assemblaggio dei frammenti e delle sequenze di primer progettate è illustrato nella figura supplementare 4. I Primer per la clonazione possono anche essere progettati manualmente25.

4. Rilevamento PCR e amplificatore

  1. Reazione PCR standard: fare un mix di reazione per un volume totale di 50 L per reazione. Di seguito è riportata la ricetta per una reazione utilizzando la polimerasi 1:
    10 L di 5 volte buffer di reazione
    1 - L di 10 mm dNTP
    2,5 ll di 10 M di Primer in avanti
    2,5 ll di 10 M Primer inverso
    0,5 litri di polimerasi 1
    32,5 l'l di Nuclease free H2O
    1. Se si desidera, aggiungere 10 L di 5 volte GC Enhancer se il prodotto ha un elevato contenuto di GC; fare un mix separato contenente GC Enhancer per testare la reazione PCR.
  2. Aliquota 49 -L della miscela in tubi PCR per campione di reazione.
  3. Aggiungere 1 l' di DNA alla PCR, la quantità varia da 10 pg a 1 ng.
  4. Abbassare i campioni per rimuovere i residui dai lati e metterli in una macchina PCR. Utilizzare la stessa macchina e gli stessi punti della macchina quando si ottimizzano le condizioni PCR.

5. Ottimizzazione per frammenti di DNA più lunghi per l'uso di diverse polimerasi

  1. Temperatura
    1. Ottimizzare la polimerasi 2 a lungo raggio.
      1. Utilizzare una temperatura di denaturazione più bassa (Polymerase 1: 98 gradi C, Polimerasi 2: 94 gradi centigradi).
      2. Utilizzare un tempo di denaturazione più lungo (Polymerase 1: 10 s, Polymerase 2: 30 s).
      3. Utilizzare un tempo di analising più lungo (Polymerase 1: 30 s, Polymerase 2: 60 s).
      4. Utilizzare un tempo di estensione più lungo (Polymerase 1: 30 s/kb, Polymerase 2: 50 s/kb).
      5. Utilizzare una temperatura di estensione inferiore (Polymerase 1: 72 s, polimerasi 2: 65 gradi centigradi).
      6. Utilizzare una temperatura di annealing di 5 gradi sotto il Tm dei primer.
    2. Ottimizzare le concentrazioni di primer (5 x da meno a 5 volte in più rispetto alla concentrazione originale del primer). Ottimizzare le concentrazioni di DNA da 10 pg a 50 pg, 100 pg, 1 ng, 5 ng, 10 ng.
    3. Come esempio di un programma PCR per amplificare una dimensione del prodotto di 15 kb utilizzando Polymerase 2, eseguire una denaturazione iniziale a 94 gradi centigradi per 30 s, la denaturazione del DNA a 94 s seguita dall'annealing a 58 gradi centigradi per 30 s, e l'estensione del DNA a 65 s per 12 min 30 s. Eseguire un'estensione finale a 65 gradi centigradi per 10 min con una presa finale di 4 gradi centigradi.
      NOTA: La temperatura di annessione (Ta) specifica per le primer determinata da calcoli di temperatura basati sul web specifici per ogni polimerasi. I tempi di estensione possono variare e devono essere ottimizzati se i frammenti sono maggiori di 10 kb.
  2. Tempi di estensione e concentrazioni di DNA
    1. Utilizzare tempi di estensione più lunghi per frammenti di DNA superiori a 6 kb: 1 min per 1 kb. I frammenti più lunghi dovrebbero usare meno DNA.
    2. Eseguire diluizioni di DNA per trovare la concentrazione ottimale del DNA per l'amplificazione, di solito da 1 pg a 1 ng per plasmidi o da 1 ng a 1 g per il DNA genomico.
      NOTA: Per la maggior parte della clonazione utilizzare la polimerasi 1, progettata fondendo il dominio di legame del DNA Sso7d in una polimerasi del DNA termostabile proprietario26. La polimerasi ha un basso tasso di errore e a causa del dominio Sso7d un'elevata processizia, necessaria per amplificare grandi frammenti genomici (10-15 kb). A causa di questa grande dimensione di frammento, l'assemblaggio enzimatico delle molecole di DNA27 viene utilizzato per l'inserimento nei vettori, in quanto questo metodo non richiede enzimi di restrizione. L'amplificazione di frammenti più lunghi di 15 kb diventa sempre più difficile con la polimerasi 1. Per l'amplificazione a frammento di grandi dimensioni utilizzare polimerasi 2 realizzata in piroccus-comela polimerasi di bozze fusa a Sso7d o il kit PCR a lungo raggio che dà, tuttavia, tassi di errore più elevati.

6. Purificazione dei prodotti PCR per la clonazione

  1. Eseguire metà dei prodotti PCR su gel di agarose dell'1% contenenti una macchia di acido nucleico intercalante (ad esempio, 1x GelGreen). Visualizza i gel macchiati su un transilluminatore lettore scuro. Questo DNA macchiato non è fedele alle dimensioni.
    NOTA: GelGreen intercala nel DNA, simile al bromuro di etidio, ma è eccitato dalla luce intorno a 500 nm (ciano), una lunghezza d'onda che non danneggia il DNA, che migliora notevolmente la clonazione.
  2. Parallelamente, eseguire metà dei prodotti PCR su un gel 1% che viene colorato post-esecuzione con bromuro di etidio (Figura 3A,B).
  3. Bande di accise della giusta dimensione dal gel colorato (passaggio 6.1) e isolano il DNA utilizzando un kit di pulizia gel e PCR. Nella deviazione dal suo protocollo standard, eluire il DNA solo in 20 - L di acqua doppia distillata, come di solito le concentrazioni di DNA sono basse.
  4. Prima della clonazione, controllare il DNA isolato su un gel di agarose per la concentrazione e l'integrità (Figura 3B). Puntare a un inserto molare 2:1 a un rapporto vettoriale. Quando si utilizzano più inserti, il rapporto è 2:2:2:1.

7. Assemblaggio del DNA e rilevamento dei cloni

NOTA: La clonazione viene eseguita utilizzando un kit di assemblaggio del DNA enzimatico, con piccole modifiche. L'assemblaggio viene eseguito per 60 min a 50 gradi centigradi e generalmente la gamma inferiore del DNA viene utilizzata per l'assemblaggio (20-100 fmol/20 - reazione l). L'intero mix di reazione viene aggiunto alle cellule chimiche competenti e le intere cellule placcate su una piastra di agar di 6 cm.

  1. Unire il vettore e l'inserto in un rapporto di 1:2 molare (20-500 fmol ciascuno) in 10 - L di acqua.
  2. Aggiungete 10 l di DNA Assembly Master Mix.
  3. Incubare i campioni per 60 minuti a 50 gradi centigradi.
  4. Successivamente, trasformare le celle competenti con la reazione di assemblaggio totale. Qui, utilizzare e. coli ceppo 1 cellule per i costrutti più brevi o E. coli ceppo 2 cellule per costrutti più lunghi o instabili. Le celle devono essere in un volume di 50.L.
  5. Scongelare le cellule sul ghiaccio e aggiungere 2 o più l del prodotto assemblato refrigerato alle celle competenti. Mescolare delicatamente il tubo 4-5 volte. Non vortice.
  6. Lasciare riposare il composto sul ghiaccio per 30 min.
  7. Scossa termica a 42 gradi centigradi per 30 s. Non mescolare.
  8. Trasferire il tubo di nuovo sul ghiaccio per 2 min.
  9. Aggiungere al tubo 950 l di supporto SOC a temperatura ambiente.
  10. Incubare il tubo di reazione a 37 gradi centigradi per 60 min. Agitare vigorosamente (300 giri/m).
  11. Piastre di selezione calde con l'antibiotico appropriato durante l'incubazione a 37 gradi centigradi.
  12. Pellet le cellule attraverso la centrifugazione (10.000 x g, 30 s) e piastre fuori 1/4 e 3/4 di cellule su due piastre di selezione e incubare a 37 gradi durante la notte.

8. Convalida dei cloni

  1. Utilizzare la colonia PCR, impiegando primer PCR che coprono i siti diassemblaggio( Figura 1C) per il rilevamento.
  2. Prendi uno stuzzicadenti sterile e tocca una singola colonia batterica.
  3. Toccare il fondo di un tubo PCR con lo stuzzicadenti che ha la colonia e poi strisciare lo stuzzicadenti su una piastra antibiotica agar, incubare la piastra striata a 37 gradi centigradi o temperatura ambiente per i costrutti sensibili durante la notte.
  4. Sovrapporre il tubo PCR toccato con la colonia con un mix PCR contenente i primer di rilevamento. Questi sono progettati utilizzando primer 3 (http://bioinfo.ut.ee/primer3-0.4.0/). Il programma ha la possibilità di forzare la progettazione di primer attraverso una sequenza definita utilizzando i segni "[ccc]" per selezionare i primer attraverso la giunzione di assieme. Il DNA dei ceppi positivi viene isolato e verificato mediante sequenziamento.

9. Analisi dell'RNA circolare che esprime i geni dei reporter

  1. Per l'analisi, i geni dei reporter transfecti nelle cellule eucariotiche. Qui, utilizzare le cellule HEK293 (ATTC #CRL-1573) in quanto danno alta efficienza di trasfezione. Per risparmiare sui costi, utilizzare soluzioni PEI (polyethyleneimine).
  2. Per la soluzione PEI, sciogliere l'idrocloruro lineare in polietileneimine (PEI) a 1 mg/mL in acqua a basso pH, pH 2. Porta il pH a 7 con NaOH. Filtro sterile con filtri da 0,22 m e conservato a 4 gradi centigradi.
  3. Dividi le cellule in sei pozzi (circa 150.000 cellule per pozzo) e lasciale crescere durante la notte nel 10% di FBS nei supporti DMEM.
  4. Aliquota 1 g del gene reporter in un tubo sterile e aggiungere 200 -L di sterile filtrato 150 mM NaCl. Mescolare con il DNA vortice.
  5. Aggiungere la soluzione PEI a questo mix e vortice, centrifugare brevemente per raccogliere campioni sul fondo del tubo. Utilizzare un rapporto di 1 g di DNA per 3 L di PEI.
  6. Incubare a temperatura ambiente per 10 min e quindi aggiungere direttamente alle cellule HEK 293.
  7. Incubare le cellule HEK293 a 37 gradi centigradi, il 5% di CO2,durante la notte.
  8. Isolare l'RNA per RT-PCR tramite un kit di isolamento dell'RNA.

10. Trattamento RNase R per rimuovere gli RNA lineari

  1. Utilizzare 10 g di RNA totale in un tubo privo di RNase.
  2. Aggiungeteall'RNA10 L di 10x buffer RNase R (0,2 M Tris-HCl (pH 8,0), 1 M KCl, 1 mM MgCl 2).
  3. Aggiungere RNase R all'RNA (1 ol - 20U).
  4. Aggiungete 1 l' di glycol blu all'RNA e portate il volume fino a 100 l un po' di acqua sterile.
  5. Incubare campioni a 37 gradi centigradi per 30 min.
  6. Aggiungere 100 l di fenolo/cloroformio e vortice per 1 min.
  7. Centrifuga a 21.000 x g per 1 min a fasi separate.
  8. Prendere il supernatante (fase acquosa) e aggiungere 1 volume (circa 80 -L di cloroformio).
  9. Vortice per 1 min, e quindi centrifugare per 1 min a fasi separate.
  10. Prendi supernatante, aggiungi 1:10 vol KAc e 2,5 vol etanolo, e precipita a -20 gradi centigradi per 1-4 h. Centrifughe a 4 gradi centigradi per 30 min a piena velocità (21.000 x g). Ci sarà un piccolo pellet blu nella parte inferiore.
  11. Rimuovere il supernatante e lavare con l'80% di etanolo. Lasciare asciugare l'aria per 5 min a temperatura ambiente e sciogliere in 10 acqua l.

11. Analisi RT-PCR

  1. Utilizzare 1 g di RNA per reazione RT.
  2. Fare mix di reazione per un volume totale finale di 20 -L per reazione. Per una sola reazione, utilizzare 1 L di 10 mM dNTP, 1 -L di 0,1 M Dithiothreitol (DTT), 4 L di 5 volte Buffer First-Strand e 0,5 L di Trascrizione Inversa.
  3. Aliquota 6,5 l di miscela di reazione in nuovi tubi PCR.
  4. Mescolare fino a 5 primer in un unico mix. Tuttavia, alcuni primer possono vari accoppiamenti con altri primer nel PCR (Figura 5). Le sequenze di Primer sono nella tabella 2. Usiamo abitualmente primer esone-giunzione specifici per geni, ma è anche possibile l'innesco con hexamer casuali.
  5. Aggiungere l'insulto di 10 M al tubo di reazione RT desiderato.
  6. Aggiungere 1 g di RNA al tubo di reazione PCR.
  7. Aggiungere RNase-free H2O fino a un volume totale di 20 .L.
  8. Girare i tubi verso il basso per rimuovere i residui sul lato dei tubi e posizionare in termociclore.
  9. Eseguire la reazione RT in termociclore a 50 gradi centigradi per 50 minuti.
  10. Conservare RT cDNA a -20 gradi centigradi o procedere alla reazione PCR.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

I geni dei reporter consentono la determinazione di fattori regolatori che influenzano la formazione circolare dell'RNA. Tuttavia, questi geni reporter sono grandi e contengono elementi ripetitivi che spesso rendono instabili i costrutti del DNA. A causa delle loro grandi dimensioni, è spesso necessario eliminare parti degli introni, che si ottiene amplificando i pezzi genomici contenenti gli esoni e le parti intronica laterali più piccole. Questi pezzi di DNA sono assemblati enzimaticamente, permettendo la costruzione senza enzimi di restrizione.

L'esempio di un RNA circolare generato dalla proteina tau (MAPT) associata ai microtubuli mostra un'applicazione dell'approccio minigene per analizzare gli RNA circolari. Il minigene tau 9-12 utilizzato in questo esempio è stato co-transfettato con diversi fattori di giunzione e l'effetto di questi fattori di giunzione è stato rilevato da RT-PCR (Figura 6). Diversi fattori di trans-azione influenzano sia l'RNA circolare che la formazione lineare pre-mRNA. L'esperimento mostra anche che tutti gli elementi di sequenza necessari per la formazione circolare dell'RNA sono localizzati nel frammento clonato.

Figure 1
Figura 1: Panoramica della tecnica. (A) Viene mostrato un gene ipotetico. Gli introni sono linee, gli esoni sono scatole, gli elementi Alu sono scatole a strisce più piccole. Il backsplicing dall'esone C ad A crea un RNA circolare. La struttura di questo RNA circolare è mostrata nel pannello (E). (B) Per creare un gene reporter, gli esoni e gli introni circostanti (almeno 500 nt per ciascun lato) sono amplificati. I costrutti devono contenere elementi ripetitivi, che di solito sono elementi Alu negli esseri umani. Un eson a monte di exon A è stato incluso per fornire un elemento Alu aggiuntivo. I frammenti genomici si sovrapporranno al loro fianco a 25 nt. (C) I frammenti vengono clonati in un vettore di espressione, guidato da un promotore CMV. La ricombinazione riuscita viene rilevata dai primer di rilevamento e convalidata mediante sequenziamento. (D) Le cellule vengono trascinate con questo costrutto. (E) L'RNA circolare è isolato e (F) amplificato utilizzando primer circolari specifici dell'RNA, preferibili primer di giunzione exon. Durante l'amplificazione PCR, l'RNA lineare può anche essere amplificato (G). (G) Orientamento dei primer utilizzati per rilevare RNA circolari. Il primer in avanti ha senso (cioè ha la stessa sequenza dell'RNA) e il primer inverso è in orientamento antisenso (cioè, è il complemento inverso dell'RNA). Si noti che diverso da RT-PCR per mRNA lineari, il primer inverso è a monte del primer in avanti. Fare clic qui per visualizzare una versione più grande di questa figura.

Figure 2
Figura 2: Selezione della sequenza per la costruzione di minigeni. (A) La visualizzazione del browser dopo la sequenza illustrata nella figura supplementare 1 viene eseguita nel database genomico umano utilizzando BLAT. I numeri di esone di letteratura36 sono indicati nel display genico, sono diversi dai numeri forniti dal browser.
1. Le sequenze allineate sono mostrate sotto "YourSeq"
2-4. Si noti che a causa della circolarità dell'RNA, BLAT non collega tutti gli esoni con linee come fa nell'RNA lineare. Gli esoni 10 e 11 (corrispondenti a 2 e 3) sono collegati, ma l'esone 12 (corrispondente a 4) non è collegato all'esone 11.
5. Gli elementi Alu sono mostrati nella traccia degli elementi ripetitivi.
(B) Allineamento in sequenza tra il costrutto pianificato e il DNA genomico.
6. Il costrutto pianificato è stato eseguito sul database utilizzando BLAT.
7. Notare l'inclusione di diversi elementi Alu nel costrutto. Fare clic qui per visualizzare una versione più grande di questa figura.

Figure 3
Figura 3: Esempio degli amplificatori prima della clonazione. (A) Prodotti PCR ottimizzati separati su un gel di agarose dell'1% contenente 1x GelGreen. Le singole bande rappresentano i prodotti PCR che verranno utilizzati nell'assemblaggio del DNA enzimatico. (B) Le bande di (A) sono state tagliate fuori dal gel e purificate. I prodotti PCR purificati sono stati separati su un gel di agarose dell'1%, che è stato successivamente macchiato con bromuro di etidio. Fare clic qui per visualizzare una versione più grande di questa figura.

Figure 4
Figura 4: Analisi delle restrizioni dei geni dei reporter. Il minigene tau 9-12 usato come esempio è stato tagliato con enzimi di restrizione indicati per escludere importanti ricombinazioni. Corsia 1: taglio con NcoI dimensioni previste 735 bp, 3345 bp, 6266 bp, corsia 2 taglio con XbaI dimensione prevista 10346 bp, corsia 3 tagliata con HindIII dimensioni previste 3951 bp, 6395 bp, corsia 4 taglio con SmaI dimensioni previsto 1168 bp, 1688 bp, 2708 bp.

Figure 5
Figura 5: Effetto del multiplexing del primer e del trattamento RNase R sul rilevamento circolare dell'RNA. (A) cDNA da campioni A e B derivati da tessuti cerebrali umani è stato amplificato con primer circolari di RNA circTau exon12_10 Reverse e circTau exon10_11 Forward. La trascrizione inversa per il cDNA è stata eseguita con i primer per l'RNA tau lineare e circolare. La banda prevista corrispondente all'RNA circolare tau è mostrata da un triangolo. Le altre bande forti sono artefatti che non corrispondevano al genoma umano. (B) L'esperimento è stato ripetuto con condizioni PCR identiche, ma la trascrizione inversa è stata eseguita solo con il circTau exon12_10 primer inverso. Solo la banda prevista fu amplificata e convalidata attraverso il sequenziamento. (C) L'RNA è stato trattato con RNase R che rimuove l'RNA lineare. L'RNA circolare è rilevabile dopo il trattamento (a sinistra), mentre l'RNA lineare non dà più un segnale rilevabile (a destra) Fare clic qui per visualizzare una versione più grande di questa cifra.

Figure 6
Figura 6: Esempio di analisi di un gene di un reporter di circRNA. È stato trassito 1 g del gene tau 9-1237- 37 dei reporter con 1 -g di fattori di giunzione indicati. L'RNA è stato isolato 24 h dopo la trasfezione e analizzato da RT-PCR. (A) Amplificazione del tau mRNA lineare. A causa dello splicing alternativo di esone 10 due bande sono osservati. Il loro rapporto cambia a causa della sovraespressione dei fattori di giunzione38,39. (B) Amplificazione della circolare 12-10 tau RNA23. Si noti la dipendenza dell'espressione tau circRNA sull'espressione di alcuni fattori di giunzione, in particolare il cdc2 come la chinasi clk2 e la proteina SR 9G8. (C) L'RNA circolare di HIPK3 è stato utilizzato come controllo positivo che indica la stessa carica. Fare clic qui per visualizzare una versione più grande di questa figura.

Tabella 1: Elenco degli attuali minigeni che esprimono RNA circolari. Fare clic qui per scaricare questo file.

Primer circolari di controllo HIPK3
Inverso HIPK3
HIPK3 Avanti
TGCTTGGCTCTCTACTTTG
TCGGCCAGTCATGTADCAAA
Primer lineari
Tau Exon 12 Retromarcia
Tau Exon 9 Avanti
CCCAATCTCTTCGACTGGACTC
TGTCAAGTCCAAGATCGGCT
Primer circolari
circTau exon12_10 Invertire
rcTau exon10_11 Avanti
CAGCTTTTTATTAATTATCTCTCTCTCTCT
GAGGCGGCAGTGCAA

Tabella 2: Elenco dei Primer.

Supplemental Figure 1
Figura supplementare 1: sequenza di test dell'RNA circolare Tau. Sequenza di prova corrispondente a un RNA circolare dal locus MAPT. Diversi esoni sono indicati da sottolineatura, maiuscoletto e grandi tappi. Fare clic qui per visualizzare una versione più grande di questa figura.

Supplemental Figure 2
Figura supplementare 2: Sequenza genomica contenente il minigene pianificato. Gli esoni sono evidenziati a colori e gli elementi ripetitivi sono sottolineati, corsivo e grassetto. L'ombreggiatura grigia indica le regioni di fiancheggiamento di bassa complessità che possono essere utilizzate per generare primer. Fare clic qui per scaricare questo file.

Supplemental Figure 3
Figura supplementare 3: Sequenze del gene del reporter pianificato. Vengono mostrati la sequenza vettoriale e i frammenti genomici pianificati. Fare clic qui per scaricare questo file.

Supplemental Figure 4
Figura supplementare 4: Primers design per l'assemblaggio. La sequenza da Supplemental Figure 3 è stata inserita nello strumento di costruzione. Fare clic qui per visualizzare una versione più grande di questa figura.

Supplemental Figure 5
Figura supplementare 5: Sequenza del gene del reporter tau 9->12 usato come esempio. Fare clic qui per scaricare questo file.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

In generale, gli RNA circolari sono bassi abbondanti1, il che complica lo studio della loro funzione e formazione. Simile agli RNA lineari13, l'uso di minigeni reporter permette l'identificazione di cis e fattori trans-agire che regolano la formazione di RNA circolari. Pertanto, questo approccio genera ipotesi che possono essere ulteriormente testate utilizzando i geni endogeni.

Il passo più critico è la progettazione del gene reporter. L'assemblaggio enzimatico di frammenti di DNA ("Gibson cloning"27) facilita questa progettazione, in quanto consente la costruzione di grandi geni reporter indipendenti dai siti di restrizione.

I siti di retrogiunzione sono riuniti attraverso ripetizioni invertite di fianco, che dovrebbero essere prese in considerazione nella costruzione del gene reporter. Le ripetizioni sono annotate nel browser del genoma 'ripeti traccia' e selezionandole mostra il loro orientamento. Tenete a mente che le proteine possono anche forzare i siti di back-splicing in una struttura secondaria necessaria per l'espressione circolaredell'RNA 28 e per un'analisi imparziale 1-2 kb di regioni introniche di fianco dovrebbero essere studiati.

Per garantire la stabilità dei costrutti, una considerazione importante è il tipo di ceppi batterici e le loro condizioni di crescita. Per brevi, vengono utilizzati i costrutti semplici batteri di clonazione standard, che sono quasi identici a DH5-alfa (huA2 -(argF-lac)U169 phoA glnV4 - 80 - 80 (lac)M15 gyrA96 recA1 relA1 endA1 thi-1 hsdR17). Per frammenti più lunghi, contenenti più di 6 elementi Alu, Vengono utilizzate celle competenti "stabili" che mancano di una ricombinana (recA) e endonuclease (endA1) (F' proA , B , lacIq , M15 zzf::Tn10 (TetR)- (ara-leu) 7697 araD 139 fhuA lacX74 galK16 galE15 e14- - 80dlac - M15 recA1 relA1 endA1 nupG rpsL (StrR)rph spoT1 (mrr-hsdRMS-mcrBC). Se i problemi compaiono con la ricombinazione, indicati da bassi conteggi di trasformazione, placcare i batteri trasformati su due piastre e lasciarli crescere a 30 oC e 37 oC, rispettivamente. A causa della presenza di numerosi elementi ripetitivi nei minigeni, hanno bisogno di essere completamente sequenziati utilizzando il sequenziamento di prossima generazione, che è disponibile in commercio per circa 150 dollari per plasmide a tariffe 2019. La sequenza dell'esempio è illustrata nella figura supplementare 5. Inoltre, viene eseguita regolarmente l'analisi del polimorfismo della lunghezza del frammento di restrizione per una nuova preparazione più ampia dei costrutti. Ad esempio, l'utilizzo di siti che tagliano 1-4 volte determina un caratteristico modello di banda che esclude le ricombinazioni (Figura 4). Dovrebbero essere selezionati enzimi che danno un caratteristico modello a banda di frammenti che possono essere separati su un gel di agarose.

Gli RNA circolari vengono analizzati con RT-PCR utilizzando le prime di giunzione esonerazione che si sovrappongono all'evento di backsplicing (Figura 1F). A causa della natura circolare dell'RNA, il primer inverso (cioè antisenso) è a monte del primer in avanti (cioè il senso) (Figura 1G). I Primer che rilevano l'ANtosistema proteina che interagisce con la chinasi 3 (HIPK3) sono usati come controllo positivo. I primer inversi specifici di HIPK3 e minigene sono trascritti in modo inverso nello stesso tubo, che consente il loro confronto. Le reazioni PCR vengono eseguite con primer che amplificano i mRNA lineari per confrontare i modelli di elaborazione dei pre-mRNA circolari e lineari. Spesso abbiamo osservato bande aberranti quando i primer per RNA lineari e circolari erano mescolati (Figura 5), e quindi manteniamo separata la trascrizione inversa di questi campioni.

L'analisi RT-PCR degli RNA circolari è impegnativa e deve essere attentamente controllata. Mentre sensibile e conveniente, può produrre artefatti unici per RNA circolari29. La trascrizione inversa può muoversi più volte intorno al cerchio dell'RNA, che genera concatemer. La maggior parte dei geni circolari dei reporter dell'RNA generano RNA sia circolare che lineare, che può incrociarsi, portando a più artefatti PCR21,30,31. È quindi imperativo sequenziare i prodotti PCR e convalidare i risultati utilizzando diverse tecniche utilizzando le protezioni Northern Blots32 o RNase23.

Le bande inspiegabili possono anche provenire dall'amplificazione aberranti dell'RNA lineare. L'RNA lineare può essere rimosso utilizzando l'esuucleaR RNase R, che arricchisce gli RNA circolari33 (Figura 5C). Il trattamento RNase R aiuta nell'ottimizzazione iniziale dei primer di rilevamento e spesso può essere omesso una volta ottimizzati i primer.

Il back-splicing alternativo può anche contribuire a bande inspiegabili in quanto possono essere formati più RNA circolari da un locus genomico34. Questo back-splicing alternativo è spesso il risultato di strutture pre-mRNA concorrenti formate da più di due elementi di ripetizione invertiti. Inoltre, i siti criptici di back-splice possono verificarsi32,35. A seconda dell'obiettivo sperimentale, gli elementi Alu possono essere ripetuti o aggiunti ai costrutti. Le regioni complementari che fiancheggiano siti di back-splicing possono essere brevi fino a 30-40 nt35 e la sostituzione di elementi Alu con regioni complementari più brevi può aumentare la formazione circolare dell'RNA2, che può essere testata per migliorare la formazione circolare dell'RNA. Una volta identificate le sequenze pre-mRNA che causano lo splicing all'indietro, è quindi possibile accorciare i costrutti circolari di espressione dell'RNA, che in alcuni casi possono migliorare l'efficienza della trasfezione.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Niente da rivelare.

Acknowledgments

Questo lavoro è stato sostenuto dal Dipartimento della Difesa DoD grant A-180075. Stefan Stamm ringrazia Jacqueline Noonan Endowment. Anna Pawluchin è stata supportata dal DAAD, programma di scambio accademico tedesco, Justin R. Welden ha ricevuto il premio Max Steckler Award dell'Università del Kentucky.

Materials

Name Company Catalog Number Comments
(PEI) Hydrochloride Polysciences 24765-1
Builder tool NEB https://nebuilder.neb.com/#!/
Dark Reader Transilluminator. Clare Chemical Research
Enzymatic DNA assembly kit NEB E2621S
Gel and PCR cleanup kit Promega A9282
Glyco Blue Thermo Fisher AM9516
pcDNA3.1 cloning site Polycloning site https://assets.thermofisher.com/TFS-Assets/LSG/manuals/pcdna3_1_man.pdf
Polymerase 1 NEB M0491L Q5 DNA polymerase
Polymerase 2 Biorad 1725310 Long range polymerase (NEB), iproof (BioRad)
Polymerase 2 Qiagen 206402 Qiagen long range polymerase kit
Reverse Transcriptase Thermo Fisher 18080044
RNA isolation kit Life Technologies 12183025 Ambion by Life Technologies
RNAse R Lucigen RNR07250 Epicenter/Lucigen
Stable competent cells NEB C3040H NEB stable cells
Standard cloning bacteria NEB C2988J NEB5-alpha competent
Web tool to design primers NEB https://nebuilder.neb.com/#!/
Web-based temperature calculations NEB https://tmcalculator.neb.com/#!/main

DOWNLOAD MATERIALS LIST

References

  1. Jeck, W. R., et al. Circular RNAs are abundant, conserved, and associated with ALU repeats. RNA. 19, (2), 141-157 (2013).
  2. Zhang, X. O., et al. Complementary sequence-mediated exon circularization. Cell. 159, (1), 134-147 (2014).
  3. Deininger, P. Alu elements: know the SINEs. Genome Biology. 12, (12), 236 (2011).
  4. Bazak, L., Levanon, E. Y., Eisenberg, E. Genome-wide analysis of Alu editability. Nucleic Acids Research. 42, (11), 6876-6884 (2014).
  5. Levanon, E. Y., et al. Systematic identification of abundant A-to-I editing sites in the human transcriptome. Nature Biotechnology. 22, (8), 1001-1005 (2004).
  6. Hansen, T. B., et al. Natural RNA circles function as efficient microRNA sponges. Nature. 495, (7441), 384-388 (2013).
  7. Kelly, S., Greenman, C., Cook, P. R., Papantonis, A. Exon Skipping Is Correlated with Exon Circularization. Journal of Molecular Biology. 427, (15), 2414-2417 (2015).
  8. Li, Z., et al. Exon-intron circular RNAs regulate transcription in the nucleus. Nature Structural & Molecular Biology. 22, (3), 256-264 (2015).
  9. Yang, Y., et al. Extensive translation of circular RNAs driven by N(6)-methyladenosine. Cell Research. 27, (6), 626-641 (2017).
  10. Abe, N., et al. Rolling Circle Translation of Circular RNA in Living Human Cells. Scientific Reports. 5, 16435 (2015).
  11. Salzman, J., Chen, R. E., Olsen, M. N., Wang, P. L., Brown, P. O. Cell-type specific features of circular RNA expression. PLOS Genetics. 9, (9), 1003777 (2013).
  12. Ottesen, E. W., Luo, D., Seo, J., Singh, N. N., Singh, R. N. Human Survival Motor Neuron genes generate a vast repertoire of circular RNAs. Nucleic Acids Research. 47, (6), 2884-2905 (2019).
  13. Stoss, O., Stoilov, P., Hartmann, A. M., Nayler, O., Stamm, S. The in vivo minigene approach to analyze tissue-specific splicing. Brain Research Protocols. 4, 383-394 (1999).
  14. Mardon, H. J., Sebastio, G., Baralle, F. E. A role for exon sequences in alternative splicing of the human fibronectin gene. Nucleic Acids Research. 15, 7725-7733 (1987).
  15. Gaildrat, P., et al. Use of splicing reporter minigene assay to evaluate the effect on splicing of unclassified genetic variants. Methods in Molecular Biology. 653, 249-257 (2010).
  16. Cooper, T. A. Use of minigene systems to dissect alternative splicing elements. Methods. 37, (4), 331-340 (2005).
  17. Baralle, D., Baralle, M. Splicing in action: assessing disease causing sequence changes. Journal of Medical Genetics. 42, (10), 737-748 (2005).
  18. Percifield, R., Murphy, D., Stoilov, P. Medium throughput analysis of alternative splicing by fluorescently labeled RT-PCR. Methods in Molecular Biology. 1126, 299-313 (2014).
  19. Stoilov, P., Lin, C. H., Damoiseaux, R., Nikolic, J., Black, D. L. A high-throughput screening strategy identifies cardiotonic steroids as alternative splicing modulators. Proceedings of the National Academy of Sciences of the United States of America. 105, (32), 11218-11223 (2008).
  20. Shen, M., et al. Pyrvinium pamoate changes alternative splicing of the serotonin receptor 2C by influencing its RNA structure. Nucleic Acids Research. 41, (6), 3819-3832 (2013).
  21. Noto, J. J., Schmidt, C. A., Matera, A. G. Engineering and expressing circular RNAs via tRNA splicing. RNA Biology. 1-7 (2017).
  22. Schmidt, C. A., Noto, J. J., Filonov, G. S., Matera, A. G. A Method for Expressing and Imaging Abundant, Stable, Circular RNAs In Vivo Using tRNA Splicing. Methods in Enzymology. 572, 215-236 (2016).
  23. Welden, J. R., van Doorn, J., Nelson, P. T., Stamm, S. The human MAPT locus generates circular RNAs. Biochimica et Biophysica Acta - Molecular Basis of Disease. 2753-2760 (2018).
  24. Casper, J., et al. The UCSC Genome Browser database: 2018 update. Nucleic Acids Research. 46, 762-769 (2018).
  25. Grozdanov, P. N., MacDonald, C. C. Generation of plasmid vectors expressing FLAG-tagged proteins under the regulation of human elongation factor-1alpha promoter using Gibson assembly. Journal of Visualized Experiments. (96), (2015).
  26. Wang, Y., et al. A novel strategy to engineer DNA polymerases for enhanced processivity and improved performance in vitro. Nucleic Acids Research. 32, (3), 1197-1207 (2004).
  27. Gibson, D. G., et al. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nature Methods. 6, (5), 343-345 (2009).
  28. Conn, S. J., et al. The RNA binding protein quaking regulates formation of circRNAs. Cell. 160, (6), 1125-1134 (2015).
  29. Jeck, W. R., Sharpless, N. E. Detecting and characterizing circular RNAs. Nature Biotechnology. 32, (5), 453-461 (2014).
  30. Pamudurti, N. R., et al. Translation of CircRNAs. Molecular Cell. 66, (1), 9-21 (2017).
  31. Kramer, M. C., et al. Combinatorial control of Drosophila circular RNA expression by intronic repeats, hnRNPs, and SR proteins. Genes & Development. 29, (20), 2168-2182 (2015).
  32. Starke, S., et al. Exon circularization requires canonical splice signals. Cell Reports. 10, (1), 103-111 (2015).
  33. Suzuki, H., Tsukahara, T. A view of pre-mRNA splicing from RNase R resistant RNAs. International Journal of Molecular Sciences. 15, (6), 9331-9342 (2014).
  34. Zhang, X. O., et al. Diverse alternative back-splicing and alternative splicing landscape of circular RNAs. Genome Research. 26, (9), 1277-1287 (2016).
  35. Liang, D., Wilusz, J. E. Short intronic repeat sequences facilitate circular RNA production. Genes & Development. 28, (20), 2233-2247 (2014).
  36. Wang, Y., Mandelkow, E. Tau in physiology and pathology. Nature Reviews Neuroscience. 17, (1), 5-21 (2016).
  37. Fejes-Toth, K., et al. Post-transcriptional processing generates a diversity of 5'-modified long and short RNAs. Nature. 457, (7232), 1028-1032 (2009).
  38. Gao, Q. S., et al. Complex regulation of tau exon 10, whose missplicing causes frontotemporal dementia. Journal of Neurochemistry. 74, (2), 490-500 (2000).
  39. Hartmann, A. M., et al. Regulation of alternative splicing of human tau exon 10 by phosphorylation of splicing factors. Molecular and Cellular Neuroscience. 18, (1), 80-90 (2001).
  40. Wang, Y., Wang, Z. Efficient backsplicing produces translatable circular mRNAs. RNA. 21, (2), 172-179 (2015).
  41. Yang, Y., Wang, Z. Constructing GFP-Based Reporter to Study Back Splicing and Translation of Circular RNA. Methods in Molecular Biology. 1724, 107-118 (2018).
  42. Zheng, Q., et al. Circular RNA profiling reveals an abundant circHIPK3 that regulates cell growth by sponging multiple miRNAs. Nature Communications. 7, 11215 (2016).
  43. Jia, W., Xu, B., Wu, J. Circular RNA expression profiles of mouse ovaries during postnatal development and the function of circular RNA epidermal growth factor receptor in granulosa cells. Metabolism. 85, 192-204 (2018).
  44. Liang, D., et al. The Output of Protein-Coding Genes Shifts to Circular RNAs When the Pre-mRNA Processing Machinery Is Limiting. Molecular Cell. 68, (5), 940-954 (2017).
  45. Legnini, I., et al. Circ-ZNF609 Is a Circular RNA that Can Be Translated and Functions in Myogenesis. Molecular Cell. 66, (1), 22-37 (2017).
  46. Li, X., et al. Coordinated circRNA Biogenesis and Function with NF90/NF110 in Viral Infection. Molecular Cell. 67, (2), 214-227 (2017).
  47. Zhang, Y., et al. The Biogenesis of Nascent Circular RNAs. Cell Reports. 15, (3), 611-624 (2016).
Uso dell'elemento <em>Alu</em> contenente Minigenes per analizzare gli RNA circolari
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Welden, J. R., Pawluchin, A., van Doorn, J., Stamm, S. Use of Alu Element Containing Minigenes to Analyze Circular RNAs. J. Vis. Exp. (157), e59760, doi:10.3791/59760 (2020).More

Welden, J. R., Pawluchin, A., van Doorn, J., Stamm, S. Use of Alu Element Containing Minigenes to Analyze Circular RNAs. J. Vis. Exp. (157), e59760, doi:10.3791/59760 (2020).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter