Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biochemistry

Использование элемента Alu, содержащего минигены, для анализа циркулярных РНК

doi: 10.3791/59760 Published: March 10, 2020

Summary

Мы клонируем и анализируем гены репортеров, генерирующие круговые РНК. Эти гены репортеров больше, чем конструкции для анализа линейного сращивания и содержат элементы Alu. Для исследования циркулярных РНК конструкции трансфицируются в клетки и в результате РНК анализируется с помощью РТ-ПЦР после удаления линейной РНК.

Abstract

В дополнение к линейным мРНК, многие эукариотические гены генерируют круглые РНК. Большинство круглых РНК генерируются путем присоединения 5' сращивания сайта с вверх по течению 3 ' сращивания сайта в рамках предварительной мРНК, процесс, называемый обратно-сплайсинг. Эта круговая речь, вероятно, способствует вторичных структур в предварительном MRNA, которые приносят сращивания сайтов в непосредственной близости. В человеческих генах, Элементы Alu, как полагают, способствуют эти вторичные структуры РНК, как Алу элементы в изобилии и экспонат базы взаимодополняемости друг с другом, когда присутствуют в противоположных направлениях в предварительном mRNA. Здесь мы описываем генерацию и анализ большого элемента Алу, содержащего репортёрские гены, образующие круглые РНК. Благодаря оптимизации протоколов клонирования могут образоваться гены репортеров длиной до 20 кб. Их анализ в экспериментах по сотрансфокации позволяет выявить регуляторные факторы. Таким образом, этот метод может определить последовательности РНК и клеточных компонентов, участвующих в круговой рнкобразования.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Круговые РНК
Круговые РНК (циркрнки) являются ковалентно закрытыми одноцепочечными РНК, которые выражаются в большинстве организмов. Они генерируются путем присоединения вниз по течению 5 ' сращивания сайт вверх по течению 3 ' сращивания сайта, процесс называется обратно-сращивания (Рисунок 1А)1. Последовательности в pre-mRNA, которые демонстрируют базу, дополняемую как короткие, как 30-40 nt принести обратно-сращивания сайтов в надлежащее выравнивание для формирования циркрнки2. У людей, Alu элементы1, представляющие около 11% генома3, образуют обширные двойные структуры РНК в предварительном mRNA из-за их самокомплементи4,5 и тем самым способствовать образованиюциркрнки 1.

В настоящее время описаны три основные функции циркрнки. Некоторые циркрнки связывают микроРНК (миРНК) и через секвестр действуют как губки miRNA6. CircRNAs были вовлечены в транскрипционной и после транскрипции регулирования, через конкуренцию с линейным сращивания7 или модуляции транскрипции фактор деятельности8. Наконец, циркорные системы содержат короткие открытые рамки для чтения, и доказательства принципиальных исследований показывают, что их можно перевести9,10. Тем не менее, функция большинства циркрнок остается загадочной. Большинство круглых РНК были обнаружены с использованием методов секвенирования следующего поколения11. Детальный анализ отдельных генов с использованием целевых подходов RT-PCR показывает, что большое количество круговых РНК еще предстоит обнаружить12.

Использование генов репортеров для анализа обработки предварительной мРНК
Анализ мРНК, полученных из ДНК-репортер агонстративных транссексуалов в клетки является устоявшимся методом для изучения альтернативных пре-мРНК сращивания, которые могут быть применены к круговой РНК. В общем, альтернативный экзон, окружающие его интроны и составные экзоны усиливаются и клонируются в вектор эукариотического выражения. Часто интроны сокращаются. Конструкции трансфицируются в эукариотические клетки и обычно анализируются RT-PCR13,14. Этот подход широко используется для картирования нормативных сращивания сайтов и транс-действующих факторов в экспериментах по со-трансфекции13,15,16,17,18. Кроме того, генерация белково-выражающих минигенов допускается скрининг веществ, которые меняют альтернативное сращивание19,20.

Метод применяется к циркулярным РНК. В настоящее время, по крайней мере 12 минигенных позвоночников были описаны в литературе и кратко изложены в таблице 1. За исключением системы экспрессии на основе tRNA21,22, все они зависят от промоутеров полимераза II. Здесь мы описываем метод генерации минигенов репортера для определения циси и транс-действующих факторов, участвующих в генерации круговых РНК. Обзор метода с использованием последовательностей опубликованного гена репортера23 показан на рисунке 1.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Проектирование конструкций

  1. Используйте браузер генома UCSC24 для выявления повторяющихся элементов, необходимых для формирования круговой РНК, и их включения в конструкции. Важно отметить, что грунтовки для усиления должны быть вне повторяющихся элементов.
  2. Вставьте круговую последовательность РНК(Дополнительная рисунок 1 является испытательной последовательностью) в https://genome.ucsc.edu/cgi-bin/hgBlat?command=start и выберите правильный организм. Отправить последовательность и перейти к браузеру зрения, увеличить 1.5x или по мере необходимости(Рисунок 2A).
    ПРИМЕЧАНИЕ: Последовательность поиска отображается в верхней строке(рисунок 2А, 1). В зависимости от порядка экзонов в круговой РНК, BLAT не будет соединять все экзоны. В этом примере экзон 12(Рисунок 2А, 4) не подключен к 11(рисунок 2А, 2, 3),потому что экзон 12 находится вверх по течению экзона 11 в круговой последовательности РНК(Дополнительная рисунок 1). Повторяющиеся элементы находятся в треке "повторить маску", обозначенном коробками, где от черного до серого цвета указывает на эволюционное сохранение(рисунок 2А, 5).
  3. Мышь над повторяющимися элементами, чтобы определить их подтип в плавающем окне. Элементы Alu находятся в линии SINE (короткий перемежается ядерный элемент). Используйте кнопку "По умолчанию треков" под окном, чтобы сбросить браузер, если получена другая картинка, чем рисунок 2.
    ПРИМЕЧАНИЕ: Mousing над экзонами в генном дисплее генерирует окно с экзонномерами, которые генерируются компьютером. Эти числа не соответствуют экзону нумерованию, установленному в литературе, а также изоформироваться между изоформами.

2. Выберите последовательность для клонирования в векторе выражения

  1. Скачать последовательность ДНК показано в окне, перейдя к Просмотр у ДНК на верхней строке браузера генома UCSC. В варианте форматирования последовательностивыберите расширенные параметры корпуса/цвета.
  2. Выберите случай по умолчанию в качестве Нижнего и выберите чехол переключения для NCBI refseq. Выберите подчеркнуть, и смелый, и курсивом для Повторите Маскер. Нажмите Отправить. Там будут экзоны, как заглавные буквы и интроны, как маленькие буквы. Проверьте границы экзона/интрона.
  3. В этом примере есть последовательность 'cccttacCTTTTT', указывающая на то, что браузер показывает обратную комплект. Если это так, вернитесь назад и выберите обратную коробку дополнения, пока не увидеть правильные границы интронов экзона (agEXONgt), в этом примере AAAAAGgtaaggg.
  4. Копировать файл с правильной ориентацией (внутренние экзоны окружены интроником ag... gt) в документ обработки текста и выделить экзоны(Дополнительный рисунок 2).
    ПРИМЕЧАНИЕ: В этом примере геномный фрагмент, охватывающий экзоны 9-12, составляет около 24 кб и, таким образом, слишком велик, чтобы быть усиленным из геномной ДНК. Таким образом, каждый экзон, окруженный около 1 кБ интронной области индивидуально усиливается, и эти четыре фрагмента собраны в вектор клонирования.
  5. Выберите фрагменты для усиления (экзон - 500 nt intron). Убедитесь, что интрон не начинается или не заканчивается в повторяющейся области, так как грунтовки в этих регионах не будут усиливать определенные последовательности. Выбранные области отображаются на рисунке 2B,а их последовательности показаны на дополнительном рисунке 3.
    ПРИМЕЧАНИЕ: В общем, чем больше конструкций, тем сложнее будет клонирование. Фрагменты могут быть собраны либо шаг мудрым (т.е. экзон 9 сочетается с вектором и в следующем шаге exon 10 вводится в эту конструкцию путем клонирования до тех пор, пока все экзоны находятся на месте), или же все фрагменты собираются одновременно. Пошаговый подход всегда работает, но требует больше времени. Одновременная сборка не всегда работает и зависит от того, насколько хорошо отдельные фрагменты могут быть усилены из геномной ДНК и от общего размера конструкции. Поэтому мы обычно начинаем с обоих подходов одновременно.

3. Дизайн грунтовки для клонирования

  1. Используйте веб-инструмент(https://nebuilder.neb.com/#!/)для разработки праймеров для клонирования. Например, введите фрагменты 9, 10, 11 и 12 и векторную последовательность(дополнительная рисунок 3)к этому инструменту.
  2. Для векторной последовательности добавьте место вставки в качестве последнего нуклеотида и затем добавьте фрагменты. Поскольку векторная нумеровка не начинается с заданного участка вставки, находится место вставки в вектор, а нижепом часть ставится перед восходящей последовательностью. В этом примере вставки начинаются сразу после сайта HindIII «AAGCTT» и заканчиваются сразу после pmeI (GTTTAAAC) сайта pcDNA3.1. Последовательность из cccgctgatcag ... ccgtaaaaaaagggccна вставлены перед положением 1 в последовательности pcDNA3.1 (gttgctggcgttttcc ...).
  3. Отрегулируйте грунтовки, если их точки плавления находятся более чем на 4 градуса Цельсия друг от друга, так как они не будут работать в усилении. Сборка фрагментов и грунтовки последовательностей, направленных показаны на дополнительном рисунке 4. Праймеры для клонирования также могут быть разработаны вручную25.

4. Обнаружение ПЦР и ампииконов

  1. Стандартная реакция ПЦР: Сделайте реакционную смесь общим объемом 50 л за реакцию. Ниже приведен рецепт одной реакции с использованием полимеразы 1:
    10 злиц 5x Реакционный буфер
    1 кл/л 10 мМ dNTPs
    2,5 л из 10 мкм форвард айтор
    2,5 л из 10 ММ Обратный праймер
    0,5 л полимеразы 1
    32,5 л Нуклеанеи бесплатно H2O
    1. Дополнительно добавьте 10 зл 5x GC Enhancer, если продукт имеет высокое содержание GC; сделать отдельную смесь, содержащую GC Enhancer для проверки реакции ПЦР.
  2. Aliquot 49 л смеси в ПЦР трубки на образец реакции.
  3. Добавьте в ПЦР 1 кЛ ДНК, количество которого колеблется от 10 пг до 1 нг.
  4. Спин вниз образцы, чтобы удалить остатки от сторон и поместить их в машину ПЦР. Используйте ту же машину, а также те же пятна в машине при оптимизации условий ПЦР.

5. Оптимизация для более длинных фрагментов ДНК для использования различных полимеразы

  1. Температура
    1. Оптимизация дальней полимеразеи 2.
      1. Используйте более низкую температуру денатурации (Полимераза 1: 98 градусов по Цельсию, Полимераза 2: 94 градусов по Цельсию).
      2. Используйте более длительное время денатурации (Полимераза 1: 10 с, Полимераза 2: 30 с).
      3. Используйте более длительное время аннулирования (Полимераза 1: 30 с, Полимераза 2: 60 с).
      4. Используйте более длительное время продления (Полимераза 1: 30 с/кб, Полимераза 2: 50 с/кб).
      5. Используйте более низкую температуру расширения (Полимераза 1: 72 градуса по Цельсию, Полимераза 2: 65 градусов по Цельсию).
      6. Используйте анналинг температуры 5 градусов ниже ТМ грунтовки.
    2. Оптимизируйте концентрации грунтовки (в 5 раз меньше, чем первоначальная концентрация грунтовки). Оптимизируйте концентрации ДНК от 10 п.п. до 50 пг, 100 п.п., 1 нг, 5 нг, 10 нг.
    3. В качестве примера программы ПЦР для усиления размера продукта 15 кб с использованием Полимераза 2, выполнить начальную денатурацию на 94 градусов по Цельсию в течение 30 с, ДНК денатурации на 94 градусов по Цельсию в течение 30 с, а затем annealing на 58 градусов по Цельсию на 30 с, и расширение ДНК на 65 градусов по Цельсию для 12 мин 30 s. Выполните окончательное расширение при 65 градусах по Цельсию в течение 10 минут с окончательным удержанием 4 градусов по Цельсию.
      ПРИМЕЧАНИЕ: Температура annealing (Ta) специфична для грунтовок, определяемых веб-расчетами температуры, которые специфичны для каждой полимеразы. Время расширения может меняться и нуждаться в оптимизации, если фрагменты больше 10 кб.
  2. Время расширения и концентрации ДНК
    1. Используйте более длительное время расширения для фрагментов ДНК более 6 кб: 1 мин на 1 кб. Более длинные фрагменты должны использовать меньше ДНК.
    2. Выполните разбавления ДНК, чтобы найти оптимальную концентрацию ДНК для усиления, как правило, 1 пг до 1 нг для плазмиды или 1 нг до 1 мкг для геномной ДНК.
      ПРИМЕЧАНИЕ: Для большинства клонирования использовать полимеразы 1, инженерии путем сплавляя Sso7d ДНК связывания домена запатентованную термостабильную ПОЛимеразу ДНК26. Полимераза имеет низкую частоту ошибок и из-за домен Sso7d высокой процессии, необходимой для усиления больших (10-15 кб) геномных фрагментов. Из-за этого большого размера фрагмента для вставки в векторы используется ферментная сборка молекул27 ДНК, так как этот метод не требует ограничения ферментов. Усиление фрагментов длиной более 15 кб становится все труднее с полимеразой 1. Для большого увеличения фрагмента использовать полимеразы 2 из пирококка,как корректуры полимеразы слиты с Sso7d или дальнего комплекта ПЦР, что дает, однако, более высокие показатели ошибок.

6. Очистка продуктов ПЦР для клонирования

  1. Запустите половину продуктов ПЦР на 1% гелей агарозы, содержащих интеркалирующее пятно нуклеиновой кислоты (например, 1x GelGreen). Визуализируйте окрашенные гели на темном трансиллинодоре читателя. Эта запятнанная дна не бежит по верному размеру.
    ПРИМЕЧАНИЕ: GelGreen переплетается в ДНК, похож на бромистый этидий, но он возбуждается светом около 500 нм (циань), длина волны, которая не повреждает ДНК, что значительно улучшает клонирование.
  2. Параллельно, запустить половину продуктов ПЦР на 1% гель, который окрашен после запуска с бромистом этидия(Рисунок 3A,B).
  3. Акцизные полосы нужного размера от окрашенных гель (шаг 6.1) и изолировать ДНК с помощью геля и комплекта очистки ПЦР. В отклонении от своего стандартного протокола, увядительный ДНК только в 20 л двойной дистиллированной воды, как правило, концентрации ДНК являются низкими.
  4. Перед клонированием проверьте изолированную ДНК на геле агарозы на концентрацию и целостность(рисунок 3В). Цель для 2:1 молярной вставки в векторное соотношение. При использовании нескольких вставок соотношение 2:2:2:1.

7. Сборка ДНК и обнаружение клонов

ПРИМЕЧАНИЕ: Клонирование осуществляется с использованием ферментативного комплекта для сборки ДНК, с незначительными изменениями. Сборка выполняется в течение 60 мин при 50 градусах Цельсия и, как правило, нижний диапазон ДНК используется для сборки (20-100 фмоль/20 л реакции). Вся смесь реакции добавляется в химические компетентные клетки и целые клетки выкрываются на 6-сантиметровой агаровой пластине.

  1. Смешайте вектор и вставьте в соотношении моляров 1:2 (по 20-500 моль каждый) в 10 л воды.
  2. Добавьте 10 зл ДНК сборки Мастер Mix.
  3. Инкубировать образцы в течение 60 минут при 50 градусах Цельсия.
  4. Затем преобразуйте компетентные ячейки с общей реакцией сборки. Здесь используйте штамм E. coli 1 клетки для более коротких конструкций или штамма e. coli 2 клеток для более длинных или нестабильных конструкций. Клетки должны быть в объеме 50 л.
  5. Оттепель клетки на льду и добавить 2 зл и L охлажденных собранных продуктов в компетентные клетки. Смешайте, аккуратно щелкая трубку 4-5 раз. Не вихрь.
  6. Пусть смесь сидеть на льду в течение 30 минут.
  7. Тепловой шок при температуре 42 градуса по Цельсию в течение 30 с. Не смешивайте.
  8. Перенесите трубку обратно на лед на 2 мин.
  9. Добавьте в трубку 950 л комнатной температуры SOC Media.
  10. Инкубировать реакционную трубку при 37 градусах по Цельсию в течение 60 мин. Встряхните энергично (300 об/мин).
  11. Теплые подборные тарелки с соответствующим антибиотиком во время инкубации при 37 градусах Цельсия.
  12. Пеллетклетки через центрифугацию (10 000 х г,30 с) и вылезать 1/4 и 3/4 клеток на двух селекционных пластинах и инкубировать при 37 градусах Цельсия за одну ночь.

8. Проверка клонов

  1. Используйте колонии PCR, используя ПЦР праймеры, охватывающие сборочныеплощадки (рисунок 1C) для обнаружения.
  2. Возьмите стерильную зубочистку и коснитесь одной бактериальной колонии.
  3. Коснитесь нижней части трубки ПЦР с зубочисткой, которая имеет колонию, а затем полоса зубочистки на антибиотик агар пластины, инкубировать полосатые пластины при температуре 37 градусов цельсия или комнатной температуры для чувствительных конструкций на ночь.
  4. Наложение трубки ПЦР коснулся с колонией с PCR смесь, содержащая обнаружения грунтовки. Они разработаны с использованием грунтовки 3(http://bioinfo.ut.ee/primer3-0.4.0/). Программа имеет возможность заставить грунтовку дизайн через определенную последовательность, используя знаки "Ccc", чтобы выбрать грунтовки через сборочный узел. ДНК от положительных штаммов изолирована и проверена путем секвенирования.

9. Анализ круговой РНК, выражающей гены репортера

  1. Для анализа, трансфект-репортер генов в эукариотических клеток. Здесь используйте клетки HEK293 (ATTC #CRL-1573), поскольку они дают высокую эффективность трансфекции. Для экономии затрат используйте решения PEI (полиэтиленеимин).
  2. Для раствора PEI растворите линейный полиэтиленеимин гидрохлорид (PEI) при 1 мг/мл в воде при низком рН, рН 2. Поднесите рН до 7 с NaOH. Стерильный фильтр с фильтрами 0,22 мкм и хранить при 4 градусах Цельсия.
  3. Разделите клетки на шесть скважин (примерно 150 000 клеток на скважину) и дайте им расти в одночасье в 10% FBS в DMEM media.
  4. Aliquot 1 мкг гена репортера в стерильной трубке и добавить 200 л стерильных фильтрованных 150 мМ NaCl. Смешайте с ДНК путем вихря.
  5. Добавьте PEI раствор к этой смеси и вихрю, кратко центрифугу для сбора образцов на дне трубки. Используйте коэффициент 1 мкг ДНК на 3 ЗЛ ПЭИ.
  6. Инкубировать при комнатной температуре в течение 10 минут, а затем добавить непосредственно в HEK 293 клеток.
  7. Инкубировать HEK293 клетки при 37 градусах Цельсия, 5% CO2,на ночь.
  8. Изолировать РНК для RT-PCR через комплект изоляции РНК.

10. RNase R лечение для удаления линейных РНК

  1. Используйте 10 мкг общей РНК в трубке, свободной от RNase.
  2. Добавьте в РНК 10 кв. м 10x RNase R буфер (0,2 М Tris-HCl (pH 8.0), 1 M KCl, 1 мМ MgCl2.
  3. Добавьте RNase R в РНК (1 ql 20U).
  4. Добавьте в РНК 1 зликольного синего цвета и доведите объем до 100 л со стерильной водой.
  5. Инкубировать образцы при 37 градусах по Цельсию в течение 30 мин.
  6. Добавьте 100 л фенола/хлороформа и вихря в течение 1 мин.
  7. Центрифуга при 21 000 х г в течение 1 мин в отдельные фазы.
  8. Возьмите супернатант (вавную фазу) и добавьте 1 том (около 80 л л хлороформа).
  9. Вихрь в течение 1 мин, а затем центрифуга в течение 1 мин, чтобы отделить фазы.
  10. Возьмите супернатант, добавьте 1:10 вольт КАК и 2,5 вольт этанола, и осадок при -20 градусах по Цельсию в течение 1-4 ч. Центрифуга при 4 КК в течение 30 мин на полной скорости (21 000 х г). Там будет небольшой синий гранулы на дне.
  11. Удалить супернатант, и мыть с 80% этанола. Дайте воздуху высохнуть в течение 5 мин при комнатной температуре и растворите в 10 л воды.

11. Анализ РТ-ПКР

  1. Используйте 1 мкг РНК на реакцию RT.
  2. Сделать реакционную смесь для окончательного общего объема 20 Л л на реакцию. Для одной реакции используйте 1 кЛ 10 мМ dNTPs, 1 л 0,1 М дитиотрейтол (DTT), 4 Зл 5x First-Strand Buffer, и 0,5 л обратной транскриптазы.
  3. Аликвот 6,5 л реакции смешивают с новыми трубками ПЦР.
  4. Смешайте до 5 грунтов к одной смеси. Тем не менее, некоторые грунтовки могут неправильно спариваться с другими грунтовками в ПЦР(рисунок 5). Праймер последовательности находятся в таблице 2. Мы обычно используем генно-специфические праймеры экзон-соединения, но грунтовка со случайными гексемеры также возможно.
  5. Добавьте 1 зл из 10 мкм Обратная грунтовка в желаемую трубку реакции RT.
  6. Добавьте 1 мкг РНК в трубку для реакции ПЦР.
  7. Добавьте H2O без RNase до общего объема 20 Зл.
  8. Спиновые трубки вниз, чтобы удалить остатки на стороне труб и место в термоцикле.
  9. Запустите реакцию RT в термоцикле при 50 градусах по Цельсию в течение 50 минут.
  10. Храните RT cDNA при -20 градусах по Цельсию или переходите к реакции ПЦР.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Гены репортеров позволяют определить регуляторные факторы, влияющие на формирование круговой РНК. Тем не менее, эти гены репортера являются большими и содержат повторяющиеся элементы, которые часто делают днк конструкции нестабильными. Из-за их большого размера, часто необходимо удалить части интронов, что достигается путем усиления геномных частей, содержащих экзоны и меньшие фланговые интронные части. Эти части ДНК ферментно собраны, что позволяет строить без ограничений ферментов.

Пример круговой РНК, генерируемой из микротрубока, связанного с белком тау (MAPT), показывает применение минигенного подхода к анализу круговых РНК. Миниген тау-9'12, используемый в этом примере, был совместно трансинфицирован различными факторами сращивания, и влияние этих факторов сращивания было обнаружено RT-PCR(рисунок 6). Различные транс-действующие факторы влияют как на круговую РНК, так и на линейное формирование домРНК. Эксперимент также показывает, что все элементы последовательности, необходимые для формирования круговой РНК, локализуются в клонированном фрагменте.

Figure 1
Рисунок 1: Обзор техники. (A) Показан гипотетический ген. Интроны линии, экзоны коробки, Алу элементы меньше полосатые коробки. Обратный стыкание от экзона С до А создает круговую РНК. Структура этой круговой РНК показана в панели(E). (B) Для создания репортергена, экзоны и окружающие интроны (по крайней мере 500 nt с каждой стороны) усиливаются. Конструкции должны содержать повторяющиеся элементы, которые, как правило, Alu элементов в организме человека. Экзон вверх по течению экзона А был включен, чтобы обеспечить дополнительный элемент Alu. Геномные фрагменты будут перекрываться с их фланговыми 25 нтс. (C) Фрагменты клонируются в вектор выражения, движимый промоутером CMV. Успешная рекомбинация обнаруживается грунтовками обнаружения и проверяется путем секвенирования. (D) Клетки трансфицируются этой конструкцией. (E) Круговая РНК изолирована и (F) усиливается с помощью круглых РНК конкретных грунтовки, предпочтительно экзон соединения грунтовки. Во время усиления ПЦР линейная РНК также может быть усилена(G). (G)Ориентация грунтовок, используемых для обнаружения круглых РНК. Передний грунт находится в смысле ориентации (т.е., имеет ту же последовательность, как РНК) и обратный грунтовка находится в антисмысленой ориентации (т.е., является обратным дополнением РНК). Обратите внимание, что отличается от RT-PCR для линейных mRNAs, обратный грунтовка вверх по течению переднего грунта. Пожалуйста, нажмите здесь, чтобы просмотреть большую версию этой цифры.

Figure 2
Рисунок 2: Выбор последовательности для строительства минигенов. (A)Дисплей браузера после последовательности, показанной на дополнительной рисунке 1, работает на фоне геномной базы данных человека с использованием BLAT. Литературные экзонные номера36 указаны на генном дисплее, они отличаются от чисел, приведенных браузером.
1. Выровненные последовательности отображаются в соответствии с 'YourSeq'
2-4. Обратите внимание, что из-за круговости РНК, BLAT не соединяет все экзоны с линиями, как это происходит в линейной РНК. Экзоны 10 и 11 (соответствующие 2 и 3) соединены, но экзон 12 (соответствующий 4) не подключен к экзону 11.
5. Элементы Alu отображаются в повторяющейся композиции элементов.
(B) Последовательность выравнивания между запланированной конструкцией и геномной ДНК.
6. Планируемая конструкция была запущена по базе данных с использованием BLAT.
7. Обратите внимание на включение в конструкцию нескольких элементов Алу. Пожалуйста, нажмите здесь, чтобы просмотреть большую версию этой цифры.

Figure 3
Рисунок 3: Пример ампронов до клонирования. (A) Оптимизированные продукты ПЦР разделены на 1% агарозный гель, содержащий 1x GelGreen. Отдельные полосы представляют продукты ПЦР, которые будут использоваться в ферментативной сборке ДНК. (B) Полосы из (A) были вырезаны из геля и очищены. Очищенные продукты ПЦР были разделены на 1% агарозный гель, который впоследствии был окрашен бромидом этидия. Пожалуйста, нажмите здесь, чтобы просмотреть большую версию этой цифры.

Figure 4
Рисунок 4: Анализ ограничений генов репортеров. Миниген тау 9-12, используемый в качестве примера, был вырезан с ферментами ограничения, указанными, чтобы исключить основные рекомбинации. Лейн 1: вырезать с NcoI ожидаемых размеров 735 bp, 3345 bp, 6266 bp, полоса 2 вырезать с XbaI ожидаемый размер 10346 bp, полоса 3 вырезать с HindIII ожидаемых размеров 3951 bp, 6395 bp, полоса 4 вырезать с SmaI ожидается размер 1168 BP, 1688 bp, 2708 bp, 4782 bp.

Figure 5
Рисунок 5: Влияние праймера мультиплексирования и лечения RNase R на круговое обнаружение РНК. (A) cDNA из образцов A и B, полученных из тканей мозга человека, была усилена круглыми РНК праймерами circTau exon12_10 Обратный и circTau exon10_11 Вперед. Обратная транскрипция для кДНК была выполнена с праймерами для линейной и круговой ТА РНК. Ожидаемая полоса, соответствующая тау круговой РНК, показана треугольником. Другие сильные полосы являются артефактами, которые не соответствуют геному человека. (B) Эксперимент был повторен с идентичными условиями ПЦР, но обратная транскрипция была выполнена только с circTau exon12_10 Обратная грунтовка. Только ожидаемая полоса была усилена и проверена путем секвенирования. (C) РНК была обработана с RNase R, который удаляет линейную РНК. Круговая РНК обнаруживается после обработки (слева), в то время как линейная РНК больше не дает обнаруживаемого сигнала (справа), пожалуйста, нажмите здесь, чтобы просмотреть большую версию этой цифры.

Figure 6
Рисунок 6: Пример анализа гена репортера циркрнки. 1 мкг гена репортера тау 9-1237 был трансфицирован с 1 мкг указанных факторов сращивания. РНК была изолирована 24 ч после трансфекции и проанализированы RT-PCR. (A) Усиление линейной тау мРНК. Благодаря альтернативному сращивания экзона наблюдаются 10 две полосы. Их соотношение меняется в связи с переэкспрессией факторов сращивания38,39. (B) Усиление циркулярной РНК 12'10 тау23. Обратите внимание на зависимость от выражения тау циркрнки на экспрессию некоторых факторов сращивания, особенно cdc2, таких как киназа clk2 и белок SR 9G8. (C) Круговая РНК HIPK3 использовалась в качестве положительного контроля, указывающего на равную нагрузку. Пожалуйста, нажмите здесь, чтобы просмотреть большую версию этой цифры.

Таблица 1: Список текущих минигенов, выражающих круговые РНК. Пожалуйста, нажмите здесь, чтобы загрузить этот файл.

Круговые праймеры управления HIPK3
HIPK3 Обратный
HIPK3 Вперед
TGCTGGCTCTACTTGAGTTTTC
TCGGCCAGTCATGTATCAAA
Линейные праймеры
Тау Эксон 12 Обратный
Тау Эксон 9 Вперед
CCCAATCTCGACTGGACTC
TGTCAAGTCCAAGATCGGCT
Круговые праймеры
circTau exon12_10 Обратный
circTau exon10_11 Вперед
CAGCTCTTATTAtTCTGCACCTTTTTT
ГАГГГГККМАГГГГГГГГКГААА

Таблица 2: Список праймеров.

Supplemental Figure 1
Дополнительная рисунок 1: Тау круговая последовательность теста РНК. Последовательность испытаний, соответствующая круговой РНК из локуса MAPT. Различные экзоны указываются подчеркнутом, небольшими колпачками и большими колпачками. Пожалуйста, нажмите здесь, чтобы просмотреть большую версию этой цифры.

Supplemental Figure 2
Дополнительная рисунок 2: Геномная последовательность, содержащая запланированный миниген. Экзоны выделены в цвете и повторяющиеся элементы подчеркнуты, курсивом и смелым. Серое затенение указывает на фланговые области низкой сложности, которые могут быть использованы для генерации грунтовок. Пожалуйста, нажмите здесь, чтобы загрузить этот файл.

Supplemental Figure 3
Дополнительная рисунок 3: Последовательности запланированного гена репортера. Показана векторная последовательность и запланированные геномные фрагменты. Пожалуйста, нажмите здесь, чтобы загрузить этот файл.

Supplemental Figure 4
Дополнительная рисунок 4: Дизайн праймеров для сборки. Последовательность из дополнительной фигуры 3 была введена в инструмент строителя. Пожалуйста, нажмите здесь, чтобы просмотреть большую версию этой цифры.

Supplemental Figure 5
Дополнительная рисунок 5: Последовательность тау 9-й gt;12 репортер ген используется в качестве примера. Пожалуйста, нажмите здесь, чтобы загрузить этот файл.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

В целом, круговые РНК являются низкими обильными1,что усложняет изучение их функции и формирования. Подобно линейным РНК13,использование репортера minigenes позволяет определить cis и транс-действующих факторов, которые регулируют формирование круговых РНК. Таким образом, этот подход порождает гипотезы, которые могут быть дополнительно протестированы с помощью эндогенных генов.

Наиболее важным шагом является дизайн гена репортера. Ферментативная сборка фрагментов ДНК ("клонирование Гибсона"27)облегчает эту конструкцию, так как позволяет строить крупные репортёры, независимо от участков ограничения.

Места сращивания спереди объединяются через фланговые перевернутые повторы, которые следует принимать во внимание при построении генов репортера. Повторы аннотируются в браузере генома 'повторить трек' и их выбор показывает их ориентацию. Имейте в виду, что белки могут также заставить обратно-сплайсинг сайтов во вторичную структуру, необходимую для круговой экспрессии РНК28 и для объективного анализа 1-2 кБ фланговых интронических регионов должны быть исследованы.

Для обеспечения стабильности конструкций важным фактором является тип бактериальных штаммов и условия их роста. Для более коротких, простых конструкций используются стандартные клонирование бактерий, которые почти идентичны DH5-альфа (huA2 q (argF-лака)U169 phoA glnV4 4 (лак) M15 gyrA96 recA1 relA1 endA1 thi-1 hsdR17). Для более длинных фрагментов, содержащих более 6 элементов Alu, используются "стабильные" компетентные клетки, в нее отсутствует рекомбиназа (recA) и эндонуклеаз (endA1) (F' proA-B) lacIq q (лак)M15 zzf::Tn10 (TetR) 7697 araD1 39 fhuA lacX74 galK16 galE15 e14- 80dlac'M15 recA1 relA1 endA1 nupG rpsL (StrR) rph spoT1 (mrr-hsdRMS-mcrBC). Если возникают проблемы с рекомбинацией, о чем свидетельствуют низкие показатели трансформации, наклеить преобразованные бактерии на две пластины и дать им расти при 30 oC и 37 oC соответственно. Из-за присутствия многочисленных повторяющихся элементов в минигенах, они должны быть полностью секвенированы с использованием последовательности следующего поколения, которая коммерчески доступна около $ 150 за плазмид на 2019 ставки. Последовательность примера показана на дополнительном рисунке 5. Кроме того, обычно проводится анализ полиморфизма длины фрагмента ограничения для новой более крупной подготовки конструкций. Например, использование сайтов, которые вырезают 1-4 раза приводит к характерной схеме шаблон, который исключает рекомбинации(Рисунок 4). Ферменты должны быть выбраны, которые дают характерный шаблон полосы фрагментов, которые могут быть разделены на агарозный гель.

Круговые РНК анализируются с помощью RT-PCR с помощью праймеров экзон-соединения, которые пересекаются с событием обратного сжимания(рисунок 1F). Из-за кругового характера РНК, обратный (т.е. антисмысл) грунтовка вверх по течению вперед (т.е. смысл) грунтовка (Рисунок 1G). Праймеры обнаружения обильно выраженных гомеодоменов взаимодействующих белка киназы 3 (HIPK3) круговой РНК1 используются в качестве положительного контроля. HIPK3 и минигенные специфические реверсивные грунтовки переписываются в одну трубку, что позволяет сравнивать их. Реакция ПЦР выполняется с помощью праймеров, усиливающих линейные мРНК для сравнения моделей обработки круговых и линейных предмрн. Мы часто наблюдали аномальные полосы, когда грунтовки для линейных и круговых РНК были смешаны(рисунок 5),и таким образом держать обратную транскрипцию этих образцов отдельно.

RT-PCR анализ круговых РНК является сложной задачей и нуждается в тщательном контроле. В то время как чувствительный и удобный, он может производить артефакты, уникальные для круговых РНК29. Обратная транскрипта может перемещаться несколько раз по кругу РНК, который генерирует конкатемеры. Большинство круглых генов РНК-репортера генерируют как круговую, так и линейную РНК, которая может перекрестно гибридизироваться, что приводит к большему количестве артефактов ПЦР21,30,31. Таким образом, крайне важно последовательности продуктов ПЦР и проверки выводов с использованием различных методов с использованием северных помарки32 или RNase защиты23.

Необъяснимые полосы также могут возникать из аномарного усиления линейной РНК. Линейная РНК может быть удалена с помощью экзонуклеида RNase R, который обогащает круговые РНК33 (рисунок 5C). RNase R лечение помогает в первоначальной оптимизации обнаружения грунтовки и часто могут быть опущены после праймеры оптимизированы.

Альтернативное сплайсинг может также способствовать необъяснимым диапазонам, так как из геномного локуса34могут образоваться несколько круглых РНК. Эта альтернативная сращивание часто является результатом конкурирующих структур предварительной мРНК, образованных более чем двумя перевернутыми элементами повтора. Кроме того, загадочные сайты обратно-сращивания может произойти32,35. В зависимости от экспериментальной цели, элементы Alu могут быть повторены или добавлены к конструкциям. Дополнительные области фланговых участков сращивания могут быть короткими, как 30-40 nt35 и замена элементов Alu с более короткими дополнительными регионами может увеличить круговое образование РНК2, которые могут быть протестированы для улучшения кругового образования РНК. После того, как пре-мРНК последовательностей, которые вызывают обратно-сплайсинг были определены, таким образом, можно сократить круговой РНК выражая конструкции, которые могут улучшить эффективность трансфекции в некоторых случаях.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Нечего раскрывать.

Acknowledgments

Эта работа была поддержана Министерством обороны Министерства обороны грант a180075. Stefan Stamm благодарит фонд Jacqueline Noonan. Анна Павлючина была поддержана DAAD, немецкая программа академического обмена, Джастин Р. Уэлден был получателем Университета Кентукки Макс Стеклер премии.

Materials

Name Company Catalog Number Comments
(PEI) Hydrochloride Polysciences 24765-1
Builder tool NEB https://nebuilder.neb.com/#!/
Dark Reader Transilluminator. Clare Chemical Research
Enzymatic DNA assembly kit NEB E2621S
Gel and PCR cleanup kit Promega A9282
Glyco Blue Thermo Fisher AM9516
pcDNA3.1 cloning site Polycloning site https://assets.thermofisher.com/TFS-Assets/LSG/manuals/pcdna3_1_man.pdf
Polymerase 1 NEB M0491L Q5 DNA polymerase
Polymerase 2 Biorad 1725310 Long range polymerase (NEB), iproof (BioRad)
Polymerase 2 Qiagen 206402 Qiagen long range polymerase kit
Reverse Transcriptase Thermo Fisher 18080044
RNA isolation kit Life Technologies 12183025 Ambion by Life Technologies
RNAse R Lucigen RNR07250 Epicenter/Lucigen
Stable competent cells NEB C3040H NEB stable cells
Standard cloning bacteria NEB C2988J NEB5-alpha competent
Web tool to design primers NEB https://nebuilder.neb.com/#!/
Web-based temperature calculations NEB https://tmcalculator.neb.com/#!/main

DOWNLOAD MATERIALS LIST

References

  1. Jeck, W. R., et al. Circular RNAs are abundant, conserved, and associated with ALU repeats. RNA. 19, (2), 141-157 (2013).
  2. Zhang, X. O., et al. Complementary sequence-mediated exon circularization. Cell. 159, (1), 134-147 (2014).
  3. Deininger, P. Alu elements: know the SINEs. Genome Biology. 12, (12), 236 (2011).
  4. Bazak, L., Levanon, E. Y., Eisenberg, E. Genome-wide analysis of Alu editability. Nucleic Acids Research. 42, (11), 6876-6884 (2014).
  5. Levanon, E. Y., et al. Systematic identification of abundant A-to-I editing sites in the human transcriptome. Nature Biotechnology. 22, (8), 1001-1005 (2004).
  6. Hansen, T. B., et al. Natural RNA circles function as efficient microRNA sponges. Nature. 495, (7441), 384-388 (2013).
  7. Kelly, S., Greenman, C., Cook, P. R., Papantonis, A. Exon Skipping Is Correlated with Exon Circularization. Journal of Molecular Biology. 427, (15), 2414-2417 (2015).
  8. Li, Z., et al. Exon-intron circular RNAs regulate transcription in the nucleus. Nature Structural & Molecular Biology. 22, (3), 256-264 (2015).
  9. Yang, Y., et al. Extensive translation of circular RNAs driven by N(6)-methyladenosine. Cell Research. 27, (6), 626-641 (2017).
  10. Abe, N., et al. Rolling Circle Translation of Circular RNA in Living Human Cells. Scientific Reports. 5, 16435 (2015).
  11. Salzman, J., Chen, R. E., Olsen, M. N., Wang, P. L., Brown, P. O. Cell-type specific features of circular RNA expression. PLOS Genetics. 9, (9), 1003777 (2013).
  12. Ottesen, E. W., Luo, D., Seo, J., Singh, N. N., Singh, R. N. Human Survival Motor Neuron genes generate a vast repertoire of circular RNAs. Nucleic Acids Research. 47, (6), 2884-2905 (2019).
  13. Stoss, O., Stoilov, P., Hartmann, A. M., Nayler, O., Stamm, S. The in vivo minigene approach to analyze tissue-specific splicing. Brain Research Protocols. 4, 383-394 (1999).
  14. Mardon, H. J., Sebastio, G., Baralle, F. E. A role for exon sequences in alternative splicing of the human fibronectin gene. Nucleic Acids Research. 15, 7725-7733 (1987).
  15. Gaildrat, P., et al. Use of splicing reporter minigene assay to evaluate the effect on splicing of unclassified genetic variants. Methods in Molecular Biology. 653, 249-257 (2010).
  16. Cooper, T. A. Use of minigene systems to dissect alternative splicing elements. Methods. 37, (4), 331-340 (2005).
  17. Baralle, D., Baralle, M. Splicing in action: assessing disease causing sequence changes. Journal of Medical Genetics. 42, (10), 737-748 (2005).
  18. Percifield, R., Murphy, D., Stoilov, P. Medium throughput analysis of alternative splicing by fluorescently labeled RT-PCR. Methods in Molecular Biology. 1126, 299-313 (2014).
  19. Stoilov, P., Lin, C. H., Damoiseaux, R., Nikolic, J., Black, D. L. A high-throughput screening strategy identifies cardiotonic steroids as alternative splicing modulators. Proceedings of the National Academy of Sciences of the United States of America. 105, (32), 11218-11223 (2008).
  20. Shen, M., et al. Pyrvinium pamoate changes alternative splicing of the serotonin receptor 2C by influencing its RNA structure. Nucleic Acids Research. 41, (6), 3819-3832 (2013).
  21. Noto, J. J., Schmidt, C. A., Matera, A. G. Engineering and expressing circular RNAs via tRNA splicing. RNA Biology. 1-7 (2017).
  22. Schmidt, C. A., Noto, J. J., Filonov, G. S., Matera, A. G. A Method for Expressing and Imaging Abundant, Stable, Circular RNAs In Vivo Using tRNA Splicing. Methods in Enzymology. 572, 215-236 (2016).
  23. Welden, J. R., van Doorn, J., Nelson, P. T., Stamm, S. The human MAPT locus generates circular RNAs. Biochimica et Biophysica Acta - Molecular Basis of Disease. 2753-2760 (2018).
  24. Casper, J., et al. The UCSC Genome Browser database: 2018 update. Nucleic Acids Research. 46, 762-769 (2018).
  25. Grozdanov, P. N., MacDonald, C. C. Generation of plasmid vectors expressing FLAG-tagged proteins under the regulation of human elongation factor-1alpha promoter using Gibson assembly. Journal of Visualized Experiments. (96), (2015).
  26. Wang, Y., et al. A novel strategy to engineer DNA polymerases for enhanced processivity and improved performance in vitro. Nucleic Acids Research. 32, (3), 1197-1207 (2004).
  27. Gibson, D. G., et al. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nature Methods. 6, (5), 343-345 (2009).
  28. Conn, S. J., et al. The RNA binding protein quaking regulates formation of circRNAs. Cell. 160, (6), 1125-1134 (2015).
  29. Jeck, W. R., Sharpless, N. E. Detecting and characterizing circular RNAs. Nature Biotechnology. 32, (5), 453-461 (2014).
  30. Pamudurti, N. R., et al. Translation of CircRNAs. Molecular Cell. 66, (1), 9-21 (2017).
  31. Kramer, M. C., et al. Combinatorial control of Drosophila circular RNA expression by intronic repeats, hnRNPs, and SR proteins. Genes & Development. 29, (20), 2168-2182 (2015).
  32. Starke, S., et al. Exon circularization requires canonical splice signals. Cell Reports. 10, (1), 103-111 (2015).
  33. Suzuki, H., Tsukahara, T. A view of pre-mRNA splicing from RNase R resistant RNAs. International Journal of Molecular Sciences. 15, (6), 9331-9342 (2014).
  34. Zhang, X. O., et al. Diverse alternative back-splicing and alternative splicing landscape of circular RNAs. Genome Research. 26, (9), 1277-1287 (2016).
  35. Liang, D., Wilusz, J. E. Short intronic repeat sequences facilitate circular RNA production. Genes & Development. 28, (20), 2233-2247 (2014).
  36. Wang, Y., Mandelkow, E. Tau in physiology and pathology. Nature Reviews Neuroscience. 17, (1), 5-21 (2016).
  37. Fejes-Toth, K., et al. Post-transcriptional processing generates a diversity of 5'-modified long and short RNAs. Nature. 457, (7232), 1028-1032 (2009).
  38. Gao, Q. S., et al. Complex regulation of tau exon 10, whose missplicing causes frontotemporal dementia. Journal of Neurochemistry. 74, (2), 490-500 (2000).
  39. Hartmann, A. M., et al. Regulation of alternative splicing of human tau exon 10 by phosphorylation of splicing factors. Molecular and Cellular Neuroscience. 18, (1), 80-90 (2001).
  40. Wang, Y., Wang, Z. Efficient backsplicing produces translatable circular mRNAs. RNA. 21, (2), 172-179 (2015).
  41. Yang, Y., Wang, Z. Constructing GFP-Based Reporter to Study Back Splicing and Translation of Circular RNA. Methods in Molecular Biology. 1724, 107-118 (2018).
  42. Zheng, Q., et al. Circular RNA profiling reveals an abundant circHIPK3 that regulates cell growth by sponging multiple miRNAs. Nature Communications. 7, 11215 (2016).
  43. Jia, W., Xu, B., Wu, J. Circular RNA expression profiles of mouse ovaries during postnatal development and the function of circular RNA epidermal growth factor receptor in granulosa cells. Metabolism. 85, 192-204 (2018).
  44. Liang, D., et al. The Output of Protein-Coding Genes Shifts to Circular RNAs When the Pre-mRNA Processing Machinery Is Limiting. Molecular Cell. 68, (5), 940-954 (2017).
  45. Legnini, I., et al. Circ-ZNF609 Is a Circular RNA that Can Be Translated and Functions in Myogenesis. Molecular Cell. 66, (1), 22-37 (2017).
  46. Li, X., et al. Coordinated circRNA Biogenesis and Function with NF90/NF110 in Viral Infection. Molecular Cell. 67, (2), 214-227 (2017).
  47. Zhang, Y., et al. The Biogenesis of Nascent Circular RNAs. Cell Reports. 15, (3), 611-624 (2016).
Использование <em>элемента Alu,</em> содержащего минигены, для анализа циркулярных РНК
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Welden, J. R., Pawluchin, A., van Doorn, J., Stamm, S. Use of Alu Element Containing Minigenes to Analyze Circular RNAs. J. Vis. Exp. (157), e59760, doi:10.3791/59760 (2020).More

Welden, J. R., Pawluchin, A., van Doorn, J., Stamm, S. Use of Alu Element Containing Minigenes to Analyze Circular RNAs. J. Vis. Exp. (157), e59760, doi:10.3791/59760 (2020).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter